Starting /dee2/code/volunteer_pipeline.sh SRR18697337 current disk space = 1526116626432 free memory = 1599168960 SRR18697337 SRAfilesize 62af22162d905ad58b143dc4debeb94c SRR18697337.sra SRR18697337.sra file validated SRR18697337 is paired end SRR18697337 is conventional basespace SRR18697337 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18697337_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.244 37.0 37.0 37.0 37.0 37.0 2 36.18 37.0 37.0 37.0 37.0 37.0 3 36.364 37.0 37.0 37.0 37.0 37.0 4 36.3595 37.0 37.0 37.0 37.0 37.0 5 36.3525 37.0 37.0 37.0 37.0 37.0 6 36.314 37.0 37.0 37.0 37.0 37.0 7 36.258 37.0 37.0 37.0 37.0 37.0 8 36.418 37.0 37.0 37.0 37.0 37.0 9 36.39 37.0 37.0 37.0 37.0 37.0 10-14 36.4138 37.0 37.0 37.0 37.0 37.0 15-19 36.424699999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.362199999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.285399999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.2281 37.0 37.0 37.0 37.0 37.0 35-39 36.0051 37.0 37.0 37.0 37.0 37.0 40-44 36.217200000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.1365 37.0 37.0 37.0 37.0 37.0 50-54 36.0526 37.0 37.0 37.0 37.0 37.0 55-59 36.0578 37.0 37.0 37.0 37.0 37.0 60-64 36.0475 37.0 37.0 37.0 37.0 37.0 65-69 35.9681 37.0 37.0 37.0 37.0 37.0 70-74 35.9808 37.0 37.0 37.0 37.0 37.0 75-79 35.89919999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.88870000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.8994 37.0 37.0 37.0 37.0 37.0 90-94 35.8398 37.0 37.0 37.0 37.0 37.0 95-99 35.8534 37.0 37.0 37.0 37.0 37.0 100-104 35.818000000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.516600000000004 37.0 37.0 37.0 34.6 37.0 110-114 35.39970000000001 37.0 37.0 37.0 32.2 37.0 115-119 35.7331 37.0 37.0 37.0 37.0 37.0 120-124 35.6028 37.0 37.0 37.0 37.0 37.0 125-129 35.5668 37.0 37.0 37.0 37.0 37.0 130-134 35.5329 37.0 37.0 37.0 37.0 37.0 135-139 35.4771 37.0 37.0 37.0 37.0 37.0 140-144 35.462 37.0 37.0 37.0 37.0 37.0 145-149 35.492000000000004 37.0 37.0 37.0 37.0 37.0 150 35.498 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 7.0 25 7.0 26 11.0 27 16.0 28 28.0 29 39.0 30 62.0 31 78.0 32 88.0 33 113.0 34 143.0 35 310.0 36 2688.0 37 407.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.599999999999998 8.975 13.25 49.175000000000004 2 25.95 13.675 34.175 26.200000000000003 3 23.549999999999997 15.275 21.275 39.900000000000006 4 27.3 22.475 19.1 31.125000000000004 5 28.275 23.65 24.099999999999998 23.974999999999998 6 24.25 28.95 22.85 23.95 7 19.15 20.5 37.25 23.1 8 19.175 21.775 31.225 27.825 9 21.8 20.375 32.725 25.1 10-14 24.635 26.02 24.01 25.335 15-19 25.615 23.549999999999997 23.79 27.045 20-24 25.224999999999998 24.26 23.305 27.21 25-29 24.91 24.295 23.505000000000003 27.29 30-34 24.83 24.035 23.34 27.794999999999998 35-39 25.115 23.54 23.825 27.52 40-44 25.624999999999996 23.985 22.715 27.675 45-49 25.72 23.285 23.805 27.189999999999998 50-54 25.905 23.200000000000003 23.43 27.465 55-59 25.474999999999998 23.335 23.330000000000002 27.860000000000003 60-64 26.02 23.419999999999998 22.725 27.834999999999997 65-69 25.645 23.285 23.330000000000002 27.74 70-74 26.025 23.62 22.905 27.450000000000003 75-79 26.14 23.305 22.705000000000002 27.85 80-84 26.125 23.015 23.3 27.560000000000002 85-89 26.529999999999998 22.919999999999998 23.055 27.495000000000005 90-94 26.645000000000003 22.439999999999998 22.755 28.16 95-99 26.075 22.689999999999998 23.16 28.075 100-104 26.924999999999997 22.455 22.795 27.825 105-109 26.534999999999997 22.8 22.755 27.91 110-114 27.1 22.34 22.91 27.650000000000002 115-119 26.784999999999997 22.065 22.78 28.37 120-124 27.11 22.535 22.335 28.02 125-129 27.505000000000003 22.25 22.384999999999998 27.860000000000003 130-134 26.825 22.15 22.75 28.275 135-139 27.229999999999997 22.145 22.42 28.205000000000002 140-144 27.76 21.83 22.31 28.1 145-149 27.224999999999998 22.705000000000002 22.6 27.47 150 26.724999999999998 22.525000000000002 21.8 28.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 2.0 28 3.5 29 3.5 30 3.5 31 4.5 32 5.5 33 8.5 34 14.5 35 20.5 36 28.0 37 55.0 38 70.0 39 71.5 40 88.0 41 103.0 42 122.5 43 140.0 44 153.5 45 168.0 46 179.5 47 170.0 48 153.5 49 142.5 50 144.0 51 136.5 52 116.0 53 106.5 54 99.0 55 101.5 56 93.0 57 83.5 58 83.5 59 80.0 60 87.5 61 90.0 62 70.0 63 67.0 64 83.0 65 95.5 66 94.0 67 85.5 68 76.0 69 69.5 70 62.0 71 63.0 72 62.5 73 50.0 74 43.0 75 32.5 76 25.5 77 25.0 78 16.5 79 7.0 80 10.0 81 8.5 82 5.0 83 4.5 84 3.5 85 3.0 86 3.0 87 1.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.45 #Duplication Level Percentage of deduplicated Percentage of total 1 91.60743575724439 83.775 2 7.517769272826682 13.750000000000002 3 0.7927829414980863 2.175 4 0.08201202843083652 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0125 112-113 0.625 0.0 0.0 0.0 0.025 114-115 0.675 0.0 0.0 0.0 0.025 116-117 0.75 0.0 0.0 0.0 0.025 118-119 0.825 0.0 0.0 0.0 0.025 120-121 0.9 0.0 0.0 0.0 0.025 122-123 0.9375 0.0 0.0 0.0 0.025 124-125 0.9875 0.0 0.0 0.0 0.025 126-127 1.0375 0.0 0.0 0.0 0.025 128-129 1.1125 0.0 0.0 0.0 0.025 130-131 1.125 0.0 0.0 0.0 0.025 132-133 1.1749999999999998 0.0 0.0 0.0 0.025 134-135 1.2625000000000002 0.0 0.0 0.0 0.025 136-137 1.4375 0.0 0.0 0.0 0.025 138 1.55 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18697337 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18697337_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.001 37.0 37.0 37.0 37.0 37.0 2 36.1715 37.0 37.0 37.0 37.0 37.0 3 36.0795 37.0 37.0 37.0 37.0 37.0 4 36.231 37.0 37.0 37.0 37.0 37.0 5 36.2025 37.0 37.0 37.0 37.0 37.0 6 36.1535 37.0 37.0 37.0 37.0 37.0 7 36.1975 37.0 37.0 37.0 37.0 37.0 8 36.3145 37.0 37.0 37.0 37.0 37.0 9 36.159 37.0 37.0 37.0 37.0 37.0 10-14 36.23230000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.1951 37.0 37.0 37.0 37.0 37.0 20-24 36.236200000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.170500000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.0986 37.0 37.0 37.0 37.0 37.0 35-39 36.1225 37.0 37.0 37.0 37.0 37.0 40-44 36.1273 37.0 37.0 37.0 37.0 37.0 45-49 36.15319999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.0526 37.0 37.0 37.0 37.0 37.0 55-59 35.9774 37.0 37.0 37.0 37.0 37.0 60-64 36.004400000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.0092 37.0 37.0 37.0 37.0 37.0 70-74 35.931400000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.9123 37.0 37.0 37.0 37.0 37.0 80-84 35.7348 37.0 37.0 37.0 34.6 37.0 85-89 35.7284 37.0 37.0 37.0 37.0 37.0 90-94 35.8426 37.0 37.0 37.0 37.0 37.0 95-99 35.793 37.0 37.0 37.0 37.0 37.0 100-104 35.719 37.0 37.0 37.0 37.0 37.0 105-109 35.7241 37.0 37.0 37.0 37.0 37.0 110-114 35.6723 37.0 37.0 37.0 37.0 37.0 115-119 35.6355 37.0 37.0 37.0 37.0 37.0 120-124 35.6481 37.0 37.0 37.0 37.0 37.0 125-129 35.5717 37.0 37.0 37.0 37.0 37.0 130-134 35.4868 37.0 37.0 37.0 37.0 37.0 135-139 35.52389999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.49209999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.404199999999996 37.0 37.0 37.0 32.2 37.0 150 35.308 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 8.0 24 14.0 25 8.0 26 13.0 27 16.0 28 29.0 29 33.0 30 36.0 31 54.0 32 61.0 33 103.0 34 180.0 35 440.0 36 2759.0 37 244.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.675 17.25 11.225 41.85 2 26.825 27.425 27.250000000000004 18.5 3 23.549999999999997 27.450000000000003 19.775000000000002 29.225 4 28.525 28.675 16.5 26.3 5 27.05 31.3 18.375 23.275000000000002 6 21.5 33.7 19.375 25.424999999999997 7 25.074999999999996 16.425 31.324999999999996 27.175 8 21.75 19.975 26.025 32.25 9 25.025 19.875 27.075 28.025 10-14 27.145000000000003 24.44 20.599999999999998 27.815 15-19 26.900000000000002 23.435 21.46 28.205000000000002 20-24 26.56 23.885 22.37 27.185 25-29 27.55 23.055 21.365000000000002 28.03 30-34 26.919999999999998 23.215 22.035 27.83 35-39 27.6 23.13 21.67 27.6 40-44 27.584999999999997 23.01 21.59 27.815 45-49 27.689999999999998 23.09 21.545 27.675 50-54 28.27 22.919999999999998 21.740000000000002 27.07 55-59 28.12 22.445 21.62 27.815 60-64 27.51 22.435 22.34 27.715 65-69 27.794999999999998 22.235 22.07 27.900000000000002 70-74 27.76 22.825 21.64 27.775 75-79 27.615000000000002 22.3 22.43 27.655 80-84 28.175 22.689999999999998 21.57 27.565 85-89 28.110000000000003 22.465 21.865000000000002 27.560000000000002 90-94 28.335 22.605 21.825 27.235 95-99 27.79 22.759999999999998 21.665 27.785 100-104 29.005 22.015 21.455 27.525 105-109 28.125 22.75 21.895 27.229999999999997 110-114 28.095 23.105 21.295 27.505000000000003 115-119 27.77 22.96 22.12 27.150000000000002 120-124 27.87 22.525000000000002 22.1 27.505000000000003 125-129 27.63 22.965 22.39 27.015 130-134 28.1 23.285 21.92 26.695 135-139 28.155 23.13 22.185 26.529999999999998 140-144 28.575 22.900000000000002 22.065 26.46 145-149 28.555000000000003 22.79 22.15 26.505000000000003 150 28.249999999999996 22.45 23.175 26.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.0 25 1.5 26 1.0 27 0.0 28 0.5 29 1.0 30 1.0 31 2.0 32 5.0 33 9.5 34 12.5 35 16.5 36 21.5 37 33.0 38 45.0 39 54.5 40 70.0 41 85.5 42 112.5 43 126.0 44 130.0 45 136.5 46 142.5 47 138.5 48 138.5 49 133.5 50 123.5 51 121.5 52 119.5 53 123.5 54 106.5 55 92.0 56 90.5 57 89.5 58 95.0 59 96.0 60 97.0 61 100.0 62 98.5 63 91.5 64 91.5 65 107.0 66 106.0 67 91.0 68 84.0 69 92.5 70 94.5 71 88.0 72 78.5 73 58.5 74 46.5 75 46.5 76 41.0 77 29.5 78 20.5 79 13.0 80 14.0 81 14.0 82 7.0 83 4.0 84 2.5 85 2.0 86 1.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.325 #Duplication Level Percentage of deduplicated Percentage of total 1 91.3495756912127 83.42500000000001 2 7.801806734191076 14.249999999999998 3 0.8486175745962223 2.325 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.36250000000000004 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.775 0.0 0.0 0.0 0.0 120-121 0.85 0.0 0.0 0.0 0.0 122-123 0.8875 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 0.9875 0.0 0.0 0.0 0.0 128-129 1.0625 0.0 0.0 0.0 0.0 130-131 1.075 0.0 0.0 0.0 0.0 132-133 1.125 0.0 0.0 0.0 0.0 134-135 1.2125 0.0 0.0 0.0 0.0 136-137 1.3624999999999998 0.0 0.0 0.0 0.0 138 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609223 spots for SRR18697337.sra Written 1609223 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra Read 1609214 spots for SRR18697337.sra Written 1609214 spots for SRR18697337.sra SRR ids: ['SRR18697337.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kz_fxlt6 SRR18697337.sra spots: 32184289 blocks: [[1, 1609214], [1609215, 3218428], [3218429, 4827642], [4827643, 6436856], [6436857, 8046070], [8046071, 9655284], [9655285, 11264498], [11264499, 12873712], [12873713, 14482926], [14482927, 16092140], [16092141, 17701354], [17701355, 19310568], [19310569, 20919782], [20919783, 22528996], [22528997, 24138210], [24138211, 25747424], [25747425, 27356638], [27356639, 28965852], [28965853, 30575066], [30575067, 32184289]] SRR18697337 file size 10853069 SRR18697337 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18697337 SRR18697337_1.fastq SRR18697337_2.fastq Input file: SRR18697337_1.fastq Paired file: SRR18697337_2.fastq trimmed: SRR18697337-trimmed-pair1.fastq, SRR18697337-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:08:55 2024 >> started Tue Dec 10 07:09:35 2024 >> done (39.759s) 32184289 read pairs processed; of these: 541 ( 0.00%) short read pairs filtered out after trimming by size control 211 ( 0.00%) empty read pairs filtered out after trimming by size control 32183537 (100.00%) read pairs available; of these: 669795 ( 2.08%) trimmed read pairs available after processing 31513742 (97.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 17 0.00% 20 27 0.00% 21 14 0.00% 22 15 0.00% 23 28 0.00% 24 14 0.00% 25 23 0.00% 26 10 0.00% 27 9 0.00% 28 15 0.00% 29 17 0.00% 30 76 0.00% 31 19 0.00% 32 23 0.00% 33 20 0.00% 34 19 0.00% 35 18 0.00% 36 17 0.00% 37 12 0.00% 38 21 0.00% 39 26 0.00% 40 28 0.00% 41 22 0.00% 42 19 0.00% 43 28 0.00% 44 31 0.00% 45 51 0.00% 46 36 0.00% 47 44 0.00% 48 51 0.00% 49 47 0.00% 50 59 0.00% 51 53 0.00% 52 59 0.00% 53 69 0.00% 54 92 0.00% 55 81 0.00% 56 70 0.00% 57 93 0.00% 58 99 0.00% 59 116 0.00% 60 125 0.00% 61 127 0.00% 62 172 0.00% 63 141 0.00% 64 165 0.00% 65 184 0.00% 66 188 0.00% 67 188 0.00% 68 236 0.00% 69 245 0.00% 70 276 0.00% 71 314 0.00% 72 319 0.00% 73 361 0.00% 74 403 0.00% 75 396 0.00% 76 416 0.00% 77 516 0.00% 78 530 0.00% 79 557 0.00% 80 662 0.00% 81 732 0.00% 82 817 0.00% 83 875 0.00% 84 926 0.00% 85 996 0.00% 86 1155 0.00% 87 1281 0.00% 88 1349 0.00% 89 1534 0.00% 90 1555 0.00% 91 1647 0.01% 92 1900 0.01% 93 1978 0.01% 94 2075 0.01% 95 2321 0.01% 96 2339 0.01% 97 2643 0.01% 98 2837 0.01% 99 3007 0.01% 100 3312 0.01% 101 3486 0.01% 102 3711 0.01% 103 4023 0.01% 104 4175 0.01% 105 4350 0.01% 106 4819 0.01% 107 5030 0.02% 108 5194 0.02% 109 5332 0.02% 110 5838 0.02% 111 6073 0.02% 112 6348 0.02% 113 6541 0.02% 114 6955 0.02% 115 7158 0.02% 116 7694 0.02% 117 7968 0.02% 118 8503 0.03% 119 8728 0.03% 120 8939 0.03% 121 9604 0.03% 122 9828 0.03% 123 10266 0.03% 124 10834 0.03% 125 11093 0.03% 126 11747 0.04% 127 12449 0.04% 128 12605 0.04% 129 13038 0.04% 130 13784 0.04% 131 14270 0.04% 132 14770 0.05% 133 15275 0.05% 134 16122 0.05% 135 16499 0.05% 136 17342 0.05% 137 18028 0.06% 138 18430 0.06% 139 19475 0.06% 140 20203 0.06% 141 21060 0.07% 142 21879 0.07% 143 22514 0.07% 144 23107 0.07% 145 24284 0.08% 146 25264 0.08% 147 26444 0.08% 148 27089 0.08% 149 28216 0.09% 150 31513742 97.92% 32183537 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=10.91 fanout-score-rank=17 prefix-density=0.45 prefix-fanout=5.9 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=257.69 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=27.0 sequence=CGCCGCCGCCGA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=17.20 fanout-score-rank=15 prefix-density=0.41 prefix-fanout=9.4 sequence=AAGGAGCTGGAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=337.35 fanout-score-rank=1 prefix-density=1.32 prefix-fanout=23.9 sequence=CGCCGCCGCCGG SRR18697337 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:11:00 Started mapping on | Dec 10 07:11:00 Finished on | Dec 10 07:14:03 Mapping speed, Million of reads per hour | 633.12 Number of input reads | 32183537 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 31371026 Uniquely mapped reads % | 97.48% Average mapped length | 298.06 Number of splices: Total | 32150631 Number of splices: Annotated (sjdb) | 30534182 Number of splices: GT/AG | 31723118 Number of splices: GC/AG | 361544 Number of splices: AT/AC | 22409 Number of splices: Non-canonical | 43560 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.61 Insertion rate per base | 0.01% Insertion average length | 3.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 383791 % of reads mapped to multiple loci | 1.19% Number of reads mapped to too many loci | 11007 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.99% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 428720 428720 428720 N_multimapping 383791 383791 383791 N_noFeature 449226 27437189 3235511 N_ambiguous 1246036 12658 89771 UnstrandedReadsAssigned:29675764 PositiveStrandReadsAssigned:3921179 NegativeStrandReadsAssigned:28045744 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18697337 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18697337-trimmed-pair1.fastq SRR18697337-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,183,537 reads, 28,218,829 reads pseudoaligned [quant] estimated average fragment length: 254.44 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52973 SRR18697337.ke.tsv 35125 SRR18697337.se.tsv 88098 total ==> SRR18697337.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 682.802 55.7744 3.72816 PNS24247 1044 790.561 36.284 2.09476 PNS24249 1928 1674.56 444.211 12.1072 PNS24246 1044 790.561 36.284 2.09476 PNS24248 1044 790.561 36.284 2.09476 PNS24244 1471 1217.56 41.1629 1.54301 PNS24243 293 61.533 1 0.741731 KQK14069 1603 1349.56 4051.85 137.03 KQK14071 474 223.286 35.4432 7.2448 ==> SRR18697337.se.tsv <== BRADI_1g14170v3 4123 BRADI_1g53295v3 21 BRADI_1g59795v3 138 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 1606 BRADI_1g74790v3 71 BRADI_1g09890v3 33 BRADI_1g77505v3 585 BRADI_1g48960v3 0 SRR18697337 completed mapping pipeline successfully