Starting /dee2/code/volunteer_pipeline.sh SRR18697338 current disk space = 1526112993280 free memory = 1555834880 SRR18697338 SRAfilesize e1b4d4f994c77f6cda8fa981a8bf90b7 SRR18697338.sra SRR18697338.sra file validated SRR18697338 is paired end SRR18697338 is conventional basespace SRR18697338 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18697338_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3535 37.0 37.0 37.0 37.0 37.0 2 36.331 37.0 37.0 37.0 37.0 37.0 3 36.347 37.0 37.0 37.0 37.0 37.0 4 36.4875 37.0 37.0 37.0 37.0 37.0 5 36.4355 37.0 37.0 37.0 37.0 37.0 6 36.465 37.0 37.0 37.0 37.0 37.0 7 36.3635 37.0 37.0 37.0 37.0 37.0 8 36.441 37.0 37.0 37.0 37.0 37.0 9 36.4035 37.0 37.0 37.0 37.0 37.0 10-14 36.4478 37.0 37.0 37.0 37.0 37.0 15-19 36.44 37.0 37.0 37.0 37.0 37.0 20-24 36.434 37.0 37.0 37.0 37.0 37.0 25-29 36.304899999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.3018 37.0 37.0 37.0 37.0 37.0 35-39 36.041000000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.19930000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.1536 37.0 37.0 37.0 37.0 37.0 50-54 36.1286 37.0 37.0 37.0 37.0 37.0 55-59 36.1339 37.0 37.0 37.0 37.0 37.0 60-64 36.1519 37.0 37.0 37.0 37.0 37.0 65-69 36.110699999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.099000000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.0006 37.0 37.0 37.0 37.0 37.0 80-84 35.9948 37.0 37.0 37.0 37.0 37.0 85-89 35.8594 37.0 37.0 37.0 37.0 37.0 90-94 35.866 37.0 37.0 37.0 37.0 37.0 95-99 35.8447 37.0 37.0 37.0 37.0 37.0 100-104 35.87230000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.58970000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.4557 37.0 37.0 37.0 32.2 37.0 115-119 35.7073 37.0 37.0 37.0 37.0 37.0 120-124 35.5717 37.0 37.0 37.0 37.0 37.0 125-129 35.5731 37.0 37.0 37.0 37.0 37.0 130-134 35.4668 37.0 37.0 37.0 37.0 37.0 135-139 35.4528 37.0 37.0 37.0 37.0 37.0 140-144 35.4413 37.0 37.0 37.0 37.0 37.0 145-149 35.493399999999994 37.0 37.0 37.0 37.0 37.0 150 35.509 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 1.0 24 3.0 25 2.0 26 21.0 27 23.0 28 30.0 29 40.0 30 39.0 31 59.0 32 82.0 33 115.0 34 150.0 35 327.0 36 2696.0 37 409.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.449999999999996 10.549999999999999 13.100000000000001 47.9 2 25.7 14.149999999999999 33.1 27.05 3 22.675 17.275 22.35 37.7 4 28.599999999999998 22.05 18.75 30.599999999999998 5 29.349999999999998 24.075 21.475 25.1 6 21.575 31.624999999999996 21.475 25.324999999999996 7 19.6 20.974999999999998 35.475 23.95 8 19.975 24.0 29.349999999999998 26.674999999999997 9 21.85 22.0 29.975 26.174999999999997 10-14 24.375 26.235000000000003 23.23 26.16 15-19 24.55 24.295 23.59 27.565 20-24 24.615000000000002 24.805 23.205000000000002 27.375 25-29 24.805 24.805 23.085 27.305 30-34 25.180000000000003 24.33 22.814999999999998 27.675 35-39 24.91 24.005000000000003 23.225 27.860000000000003 40-44 25.935000000000002 24.335 22.215 27.515 45-49 24.665 24.32 23.119999999999997 27.894999999999996 50-54 25.025 24.005000000000003 22.869999999999997 28.1 55-59 25.44 23.71 23.075000000000003 27.775 60-64 25.669999999999998 23.485 22.57 28.275 65-69 25.435000000000002 23.97 22.685 27.91 70-74 25.759999999999998 23.49 22.525000000000002 28.225 75-79 26.174999999999997 22.720000000000002 22.75 28.355000000000004 80-84 25.535000000000004 23.305 23.075000000000003 28.084999999999997 85-89 26.11 22.605 23.145 28.139999999999997 90-94 26.419999999999998 22.439999999999998 22.5 28.64 95-99 26.36 22.62 23.294999999999998 27.725 100-104 26.255 23.23 22.235 28.28 105-109 26.640000000000004 22.720000000000002 22.33 28.310000000000002 110-114 26.474999999999998 22.605 22.535 28.384999999999998 115-119 27.145000000000003 22.425 22.15 28.28 120-124 26.35 22.335 22.785 28.53 125-129 27.185 23.064999999999998 21.990000000000002 27.76 130-134 26.834999999999997 22.74 22.975 27.450000000000003 135-139 27.115000000000002 22.509999999999998 22.185 28.189999999999998 140-144 26.834999999999997 21.925 22.745 28.494999999999997 145-149 26.75 22.55 22.42 28.28 150 25.424999999999997 22.1 23.175 29.299999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.5 27 2.0 28 1.5 29 4.0 30 7.5 31 10.0 32 9.5 33 12.0 34 16.5 35 28.0 36 38.5 37 55.5 38 68.5 39 70.0 40 96.5 41 117.0 42 126.5 43 143.5 44 154.5 45 151.5 46 144.0 47 145.0 48 148.0 49 138.5 50 140.5 51 137.0 52 118.0 53 108.5 54 110.0 55 116.0 56 101.5 57 80.5 58 73.0 59 81.5 60 79.5 61 70.5 62 66.5 63 73.5 64 79.0 65 77.5 66 73.5 67 74.5 68 77.0 69 70.0 70 67.0 71 66.5 72 68.5 73 64.0 74 53.0 75 40.5 76 33.0 77 23.5 78 19.5 79 21.5 80 16.0 81 7.5 82 5.5 83 6.5 84 3.5 85 1.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.2 #Duplication Level Percentage of deduplicated Percentage of total 1 90.18847006651885 81.35 2 8.841463414634147 15.950000000000001 3 0.8869179600886918 2.4 4 0.08314855875831485 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.05 36-37 0.0 0.0 0.0 0.0 0.05 38-39 0.0 0.0 0.0 0.0 0.05 40-41 0.0 0.0 0.0 0.0 0.05 42-43 0.0 0.0 0.0 0.0 0.05 44-45 0.0 0.0 0.0 0.0 0.05 46-47 0.0 0.0 0.0 0.0 0.05 48-49 0.0 0.0 0.0 0.0 0.05 50-51 0.0 0.0 0.0 0.0 0.05 52-53 0.0 0.0 0.0 0.0 0.05 54-55 0.0 0.0 0.0 0.0 0.05 56-57 0.0 0.0 0.0 0.0 0.05 58-59 0.0 0.0 0.0 0.0 0.05 60-61 0.0 0.0 0.0 0.0 0.05 62-63 0.0 0.0 0.0 0.0 0.05 64-65 0.0 0.0 0.0 0.0 0.05 66-67 0.0 0.0 0.0 0.0 0.05 68-69 0.0 0.0 0.0 0.0 0.05 70-71 0.0 0.0 0.0 0.0 0.05 72-73 0.0 0.0 0.0 0.0 0.05 74-75 0.0 0.0 0.0 0.0 0.05 76-77 0.0 0.0 0.0 0.0 0.05 78-79 0.0 0.0 0.0 0.0 0.05 80-81 0.0 0.0 0.0 0.0 0.0625 82-83 0.0 0.0 0.0 0.0 0.075 84-85 0.0 0.0 0.0 0.0 0.075 86-87 0.0 0.0 0.0 0.0 0.075 88-89 0.0125 0.0 0.0 0.0 0.075 90-91 0.05 0.0 0.0 0.0 0.075 92-93 0.075 0.0 0.0 0.0 0.075 94-95 0.1 0.0 0.0 0.0 0.075 96-97 0.125 0.0 0.0 0.0 0.075 98-99 0.125 0.0 0.0 0.0 0.075 100-101 0.125 0.0 0.0 0.0 0.075 102-103 0.125 0.0 0.0 0.0 0.075 104-105 0.15 0.0 0.0 0.0 0.075 106-107 0.16249999999999998 0.0 0.0 0.0 0.075 108-109 0.225 0.0 0.0 0.0 0.075 110-111 0.225 0.0 0.0 0.0 0.075 112-113 0.2625 0.0 0.0 0.0 0.075 114-115 0.32499999999999996 0.0 0.0 0.0 0.075 116-117 0.375 0.0 0.0 0.0 0.075 118-119 0.44999999999999996 0.0 0.0 0.0 0.075 120-121 0.6000000000000001 0.0 0.0 0.0 0.075 122-123 0.675 0.0 0.0 0.0 0.075 124-125 0.725 0.0 0.0 0.0 0.075 126-127 0.8125 0.0 0.0 0.0 0.075 128-129 0.925 0.0 0.0 0.0 0.075 130-131 1.075 0.0 0.0 0.0 0.075 132-133 1.1749999999999998 0.0 0.0 0.0 0.075 134-135 1.2875 0.0 0.0 0.0 0.075 136-137 1.3875 0.0 0.0 0.0 0.075 138 1.475 0.0 0.0 0.0 0.075 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCCAT 10 0.006973645 144.0 5 GGTGGTG 10 0.006973645 144.0 3 AGAGAGA 25 5.183459E-4 28.8 35-39 >>END_MODULE SRR18697338 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18697338_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.171 37.0 37.0 37.0 37.0 37.0 2 36.189 37.0 37.0 37.0 37.0 37.0 3 36.1875 37.0 37.0 37.0 37.0 37.0 4 36.3095 37.0 37.0 37.0 37.0 37.0 5 36.292 37.0 37.0 37.0 37.0 37.0 6 36.1455 37.0 37.0 37.0 37.0 37.0 7 36.089 37.0 37.0 37.0 37.0 37.0 8 36.3285 37.0 37.0 37.0 37.0 37.0 9 36.282 37.0 37.0 37.0 37.0 37.0 10-14 36.30460000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.274899999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.286199999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.2131 37.0 37.0 37.0 37.0 37.0 30-34 36.191100000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.1943 37.0 37.0 37.0 37.0 37.0 40-44 36.1496 37.0 37.0 37.0 37.0 37.0 45-49 36.1546 37.0 37.0 37.0 37.0 37.0 50-54 36.0561 37.0 37.0 37.0 37.0 37.0 55-59 36.0793 37.0 37.0 37.0 37.0 37.0 60-64 36.064699999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.0537 37.0 37.0 37.0 37.0 37.0 70-74 36.0241 37.0 37.0 37.0 37.0 37.0 75-79 35.9977 37.0 37.0 37.0 37.0 37.0 80-84 35.8612 37.0 37.0 37.0 34.6 37.0 85-89 35.772999999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.972699999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.842 37.0 37.0 37.0 37.0 37.0 100-104 35.802800000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.7749 37.0 37.0 37.0 37.0 37.0 110-114 35.704 37.0 37.0 37.0 37.0 37.0 115-119 35.7407 37.0 37.0 37.0 37.0 37.0 120-124 35.670899999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.644400000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.527499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.5838 37.0 37.0 37.0 37.0 37.0 140-144 35.6385 37.0 37.0 37.0 37.0 37.0 145-149 35.525999999999996 37.0 37.0 37.0 37.0 37.0 150 35.3775 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 8.0 24 7.0 25 8.0 26 13.0 27 17.0 28 24.0 29 23.0 30 34.0 31 39.0 32 68.0 33 111.0 34 169.0 35 424.0 36 2759.0 37 294.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.099999999999998 18.025 11.5 40.375 2 27.925 27.650000000000002 24.55 19.875 3 24.125 27.224999999999998 19.55 29.099999999999998 4 28.4 30.425 16.075 25.1 5 26.275 30.049999999999997 19.3 24.375 6 24.275 32.275 20.05 23.400000000000002 7 24.45 17.025000000000002 31.05 27.474999999999998 8 24.099999999999998 19.425 24.6 31.874999999999996 9 24.175 20.4 25.775 29.65 10-14 27.22 24.18 20.59 28.01 15-19 27.315 23.39 21.855 27.439999999999998 20-24 27.245 23.125 21.615000000000002 28.015 25-29 27.279999999999998 23.105 21.415 28.199999999999996 30-34 27.465 23.765 21.425 27.345000000000002 35-39 27.534999999999997 23.205000000000002 21.725 27.534999999999997 40-44 27.47 22.54 21.705 28.285 45-49 27.534999999999997 22.915 21.66 27.889999999999997 50-54 28.57 22.675 21.915000000000003 26.840000000000003 55-59 28.46 23.41 20.91 27.22 60-64 28.305000000000003 22.509999999999998 21.790000000000003 27.395000000000003 65-69 28.050000000000004 23.225 21.925 26.8 70-74 28.315 22.63 21.525 27.529999999999998 75-79 28.08 22.32 22.095000000000002 27.505000000000003 80-84 28.025 22.945 21.815 27.215 85-89 28.804999999999996 22.46 21.97 26.765 90-94 28.79 22.335 21.665 27.21 95-99 28.225 23.044999999999998 21.34 27.389999999999997 100-104 28.610000000000003 22.705000000000002 22.405 26.279999999999998 105-109 28.38 22.97 21.834999999999997 26.815 110-114 28.485 22.689999999999998 22.05 26.775 115-119 28.345 22.775000000000002 22.32 26.56 120-124 28.27 22.61 22.56 26.56 125-129 29.115000000000002 22.455 22.285 26.145000000000003 130-134 28.4 22.509999999999998 22.53 26.56 135-139 28.610000000000003 22.675 22.435 26.279999999999998 140-144 28.994999999999997 22.74 22.84 25.424999999999997 145-149 28.365000000000002 22.6 22.54 26.495 150 28.249999999999996 23.35 21.8 26.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 0.0 26 1.0 27 2.0 28 2.5 29 1.5 30 2.0 31 6.0 32 5.5 33 4.0 34 11.0 35 16.0 36 20.0 37 35.0 38 49.5 39 60.0 40 75.0 41 91.5 42 99.0 43 106.0 44 120.0 45 139.5 46 147.0 47 136.5 48 140.0 49 134.0 50 116.0 51 123.5 52 122.5 53 107.5 54 99.0 55 96.5 56 100.0 57 99.5 58 99.0 59 92.0 60 98.0 61 110.5 62 98.5 63 95.5 64 99.0 65 91.0 66 85.5 67 85.5 68 94.5 69 95.5 70 89.5 71 89.0 72 79.0 73 62.0 74 58.5 75 51.5 76 41.0 77 34.0 78 23.5 79 17.5 80 10.5 81 8.5 82 8.0 83 5.5 84 3.5 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.25 #Duplication Level Percentage of deduplicated Percentage of total 1 90.22160664819945 81.425 2 8.86426592797784 16.0 3 0.8310249307479225 2.25 4 0.0554016620498615 0.2 5 0.02770083102493075 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCAAAAGCAAGCAAGCTAGCTAGCGAGCATCAATGGCGATGACCATGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.44999999999999996 0.0 0.0 0.0 0.0 120-121 0.6000000000000001 0.0 0.0 0.0 0.0 122-123 0.675 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.95 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.225 0.0 0.0 0.0 0.0 134-135 1.3375 0.0 0.0 0.0 0.0 136-137 1.4625 0.0 0.0 0.0 0.0 138 1.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596080 spots for SRR18697338.sra Written 1596080 spots for SRR18697338.sra Read 1596081 spots for SRR18697338.sra Written 1596081 spots for SRR18697338.sra SRR ids: ['SRR18697338.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_67v14uwq SRR18697338.sra spots: 31921601 blocks: [[1, 1596080], [1596081, 3192160], [3192161, 4788240], [4788241, 6384320], [6384321, 7980400], [7980401, 9576480], [9576481, 11172560], [11172561, 12768640], [12768641, 14364720], [14364721, 15960800], [15960801, 17556880], [17556881, 19152960], [19152961, 20749040], [20749041, 22345120], [22345121, 23941200], [23941201, 25537280], [25537281, 27133360], [27133361, 28729440], [28729441, 30325520], [30325521, 31921601]] SRR18697338 file size 10764309 SRR18697338 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18697338 SRR18697338_1.fastq SRR18697338_2.fastq Input file: SRR18697338_1.fastq Paired file: SRR18697338_2.fastq trimmed: SRR18697338-trimmed-pair1.fastq, SRR18697338-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:09:39 2024 >> started Tue Dec 10 07:10:14 2024 >> done (35.151s) 31921601 read pairs processed; of these: 171 ( 0.00%) short read pairs filtered out after trimming by size control 99 ( 0.00%) empty read pairs filtered out after trimming by size control 31921331 (100.00%) read pairs available; of these: 748062 ( 2.34%) trimmed read pairs available after processing 31173269 (97.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 36 0.00% 21 8 0.00% 22 12 0.00% 23 10 0.00% 24 9 0.00% 25 4 0.00% 26 12 0.00% 27 11 0.00% 28 19 0.00% 29 9 0.00% 30 90 0.00% 31 19 0.00% 32 22 0.00% 33 15 0.00% 34 13 0.00% 35 20 0.00% 36 25 0.00% 37 26 0.00% 38 20 0.00% 39 22 0.00% 40 14 0.00% 41 30 0.00% 42 23 0.00% 43 28 0.00% 44 29 0.00% 45 28 0.00% 46 33 0.00% 47 33 0.00% 48 46 0.00% 49 32 0.00% 50 50 0.00% 51 47 0.00% 52 52 0.00% 53 56 0.00% 54 63 0.00% 55 74 0.00% 56 70 0.00% 57 66 0.00% 58 83 0.00% 59 102 0.00% 60 84 0.00% 61 125 0.00% 62 115 0.00% 63 131 0.00% 64 140 0.00% 65 143 0.00% 66 164 0.00% 67 164 0.00% 68 182 0.00% 69 194 0.00% 70 223 0.00% 71 228 0.00% 72 262 0.00% 73 340 0.00% 74 340 0.00% 75 314 0.00% 76 399 0.00% 77 427 0.00% 78 484 0.00% 79 530 0.00% 80 626 0.00% 81 614 0.00% 82 654 0.00% 83 727 0.00% 84 902 0.00% 85 996 0.00% 86 1092 0.00% 87 1101 0.00% 88 1283 0.00% 89 1363 0.00% 90 1482 0.00% 91 1668 0.01% 92 1651 0.01% 93 1888 0.01% 94 2140 0.01% 95 2275 0.01% 96 2512 0.01% 97 2598 0.01% 98 2805 0.01% 99 3098 0.01% 100 3194 0.01% 101 3425 0.01% 102 3817 0.01% 103 4117 0.01% 104 4335 0.01% 105 4752 0.01% 106 4836 0.02% 107 5238 0.02% 108 5443 0.02% 109 5965 0.02% 110 6203 0.02% 111 6269 0.02% 112 7006 0.02% 113 7081 0.02% 114 7610 0.02% 115 8147 0.03% 116 8358 0.03% 117 8898 0.03% 118 9313 0.03% 119 9994 0.03% 120 10329 0.03% 121 10600 0.03% 122 11135 0.03% 123 11486 0.04% 124 12193 0.04% 125 12593 0.04% 126 13431 0.04% 127 14161 0.04% 128 14383 0.05% 129 15164 0.05% 130 15750 0.05% 131 16171 0.05% 132 16882 0.05% 133 17286 0.05% 134 18180 0.06% 135 18931 0.06% 136 19586 0.06% 137 20388 0.06% 138 21331 0.07% 139 22519 0.07% 140 22894 0.07% 141 23707 0.07% 142 25373 0.08% 143 25708 0.08% 144 26272 0.08% 145 27793 0.09% 146 28731 0.09% 147 29537 0.09% 148 31226 0.10% 149 32486 0.10% 150 31173269 97.66% 31921331 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.64 fanout-score-rank=29 prefix-density=0.24 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=15 fanout-score=184.58 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=25.6 sequence=CGCCGCCGCCGA criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=12.03 fanout-score-rank=11 prefix-density=0.45 prefix-fanout=7.6 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTA criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=210.96 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=25.2 sequence=CGGCGGCGGCGA SRR18697338 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:11:01 Started mapping on | Dec 10 07:11:01 Finished on | Dec 10 07:13:42 Mapping speed, Million of reads per hour | 713.77 Number of input reads | 31921331 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 31088841 Uniquely mapped reads % | 97.39% Average mapped length | 297.95 Number of splices: Total | 29394973 Number of splices: Annotated (sjdb) | 27655249 Number of splices: GT/AG | 29000933 Number of splices: GC/AG | 328469 Number of splices: AT/AC | 22557 Number of splices: Non-canonical | 43014 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.54 Insertion rate per base | 0.01% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 368663 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 7871 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 463827 463827 463827 N_multimapping 368663 368663 368663 N_noFeature 601715 27140636 3522142 N_ambiguous 1147571 16292 108089 UnstrandedReadsAssigned:29339555 PositiveStrandReadsAssigned:3931913 NegativeStrandReadsAssigned:27458610 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18697338 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18697338-trimmed-pair1.fastq SRR18697338-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,921,331 reads, 27,614,232 reads pseudoaligned [quant] estimated average fragment length: 250.024 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52973 SRR18697338.ke.tsv 35125 SRR18697338.se.tsv 88098 total ==> SRR18697338.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 687.149 27.4795 1.60458 PNS24247 1044 794.976 51.1415 2.58121 PNS24249 1928 1678.98 424.299 10.1398 PNS24246 1044 794.976 51.1415 2.58121 PNS24248 1044 794.976 51.1415 2.58121 PNS24244 1471 1221.98 37.7974 1.24109 PNS24243 293 64.1531 1 0.62544 KQK14069 1603 1353.98 3169.15 93.915 KQK14071 474 227.556 56.5183 9.96564 ==> SRR18697338.se.tsv <== BRADI_1g14170v3 3235 BRADI_1g53295v3 25 BRADI_1g59795v3 184 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 1112 BRADI_1g74790v3 172 BRADI_1g09890v3 54 BRADI_1g77505v3 975 BRADI_1g48960v3 1 SRR18697338 completed mapping pipeline successfully