Starting /dee2/code/volunteer_pipeline.sh SRR18697339 current disk space = 1526114050048 free memory = 1477335796 SRR18697339 SRAfilesize 7e473a18bad320600709cb27c52a1360 SRR18697339.sra SRR18697339.sra file validated SRR18697339 is paired end SRR18697339 is conventional basespace SRR18697339 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18697339_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.329 37.0 37.0 37.0 37.0 37.0 2 36.3335 37.0 37.0 37.0 37.0 37.0 3 36.3005 37.0 37.0 37.0 37.0 37.0 4 36.44 37.0 37.0 37.0 37.0 37.0 5 36.3765 37.0 37.0 37.0 37.0 37.0 6 36.4155 37.0 37.0 37.0 37.0 37.0 7 36.311 37.0 37.0 37.0 37.0 37.0 8 36.5015 37.0 37.0 37.0 37.0 37.0 9 36.2925 37.0 37.0 37.0 37.0 37.0 10-14 36.448 37.0 37.0 37.0 37.0 37.0 15-19 36.423700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.3985 37.0 37.0 37.0 37.0 37.0 25-29 36.31079999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.2641 37.0 37.0 37.0 37.0 37.0 35-39 36.0632 37.0 37.0 37.0 37.0 37.0 40-44 36.2382 37.0 37.0 37.0 37.0 37.0 45-49 36.155800000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.1491 37.0 37.0 37.0 37.0 37.0 55-59 36.1271 37.0 37.0 37.0 37.0 37.0 60-64 36.1061 37.0 37.0 37.0 37.0 37.0 65-69 36.046899999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.9959 37.0 37.0 37.0 37.0 37.0 75-79 35.9664 37.0 37.0 37.0 37.0 37.0 80-84 35.9544 37.0 37.0 37.0 37.0 37.0 85-89 35.956 37.0 37.0 37.0 37.0 37.0 90-94 35.866400000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.831300000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.799099999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.5601 37.0 37.0 37.0 34.6 37.0 110-114 35.3823 37.0 37.0 37.0 32.2 37.0 115-119 35.7925 37.0 37.0 37.0 37.0 37.0 120-124 35.6171 37.0 37.0 37.0 37.0 37.0 125-129 35.6027 37.0 37.0 37.0 37.0 37.0 130-134 35.5646 37.0 37.0 37.0 37.0 37.0 135-139 35.572900000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.480599999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.5542 37.0 37.0 37.0 37.0 37.0 150 35.4375 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 5.0 25 15.0 26 9.0 27 20.0 28 25.0 29 47.0 30 53.0 31 60.0 32 67.0 33 91.0 34 163.0 35 312.0 36 2708.0 37 421.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.15 8.425 13.375 50.05 2 24.125 15.9 34.025 25.95 3 22.375 16.5 22.175 38.95 4 31.025000000000002 19.8 17.424999999999997 31.75 5 28.199999999999996 25.674999999999997 21.099999999999998 25.025 6 24.925 28.799999999999997 22.825 23.45 7 20.875 18.95 36.475 23.7 8 21.0 20.775 30.675 27.55 9 23.549999999999997 19.525000000000002 31.175000000000004 25.75 10-14 24.5 25.1 23.905 26.495 15-19 25.665 23.465 23.56 27.310000000000002 20-24 25.6 23.815 22.95 27.634999999999998 25-29 25.264999999999997 23.68 23.29 27.765 30-34 25.985000000000003 22.725 23.47 27.82 35-39 25.759999999999998 23.265 22.975 28.000000000000004 40-44 26.27 23.515 22.325 27.889999999999997 45-49 26.08 22.81 22.42 28.689999999999998 50-54 26.71 23.13 22.259999999999998 27.900000000000002 55-59 26.43 23.35 22.25 27.97 60-64 26.66 22.939999999999998 22.64 27.76 65-69 26.27 23.175 22.705000000000002 27.85 70-74 27.11 22.755 21.955 28.18 75-79 26.705000000000002 22.425 22.775000000000002 28.095 80-84 26.715 22.875 22.775000000000002 27.634999999999998 85-89 27.005000000000003 22.525000000000002 22.205 28.265 90-94 26.66 21.945 22.435 28.96 95-99 26.85 22.53 22.405 28.215 100-104 26.745 22.41 22.445 28.4 105-109 27.015 23.1 22.1 27.785 110-114 27.265 22.915 21.69 28.13 115-119 27.11 22.525000000000002 22.009999999999998 28.355000000000004 120-124 27.96 22.245 21.759999999999998 28.035 125-129 27.775 22.335 22.189999999999998 27.700000000000003 130-134 27.79 21.795 22.03 28.384999999999998 135-139 27.705000000000002 22.31 21.67 28.315 140-144 27.445000000000004 22.465 21.85 28.24 145-149 27.68 21.965 22.17 28.185 150 27.025 22.625 22.125 28.225 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.0 27 0.5 28 1.5 29 2.0 30 2.5 31 4.0 32 6.5 33 6.0 34 11.5 35 20.0 36 28.5 37 34.5 38 45.5 39 64.5 40 82.0 41 102.5 42 120.5 43 136.0 44 151.0 45 152.0 46 153.5 47 149.0 48 151.0 49 157.0 50 131.0 51 117.5 52 120.0 53 115.0 54 106.0 55 93.5 56 82.5 57 80.0 58 87.5 59 97.5 60 89.0 61 74.0 62 79.5 63 86.5 64 86.0 65 97.5 66 101.5 67 98.0 68 90.0 69 75.0 70 73.5 71 71.5 72 62.5 73 57.5 74 57.0 75 47.0 76 32.0 77 28.5 78 23.0 79 13.0 80 13.5 81 11.0 82 6.0 83 5.0 84 2.0 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.7 #Duplication Level Percentage of deduplicated Percentage of total 1 90.60088202866594 82.175 2 8.572216097023153 15.55 3 0.7993384785005513 2.175 4 0.027563395810363836 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.5375000000000001 0.0 0.0 0.0 0.0 128-129 0.6125 0.0 0.0 0.0 0.0 130-131 0.6625000000000001 0.0 0.0 0.0 0.0 132-133 0.7875 0.0 0.0 0.0 0.0 134-135 0.8625 0.0 0.0 0.0 0.0 136-137 1.0625 0.0 0.0 0.0 0.0 138 1.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGTGC 10 0.006973645 144.0 6 >>END_MODULE SRR18697339 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18697339_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.146 37.0 37.0 37.0 37.0 37.0 2 36.3005 37.0 37.0 37.0 37.0 37.0 3 36.181 37.0 37.0 37.0 37.0 37.0 4 36.228 37.0 37.0 37.0 37.0 37.0 5 36.236 37.0 37.0 37.0 37.0 37.0 6 36.127 37.0 37.0 37.0 37.0 37.0 7 36.148 37.0 37.0 37.0 37.0 37.0 8 36.369 37.0 37.0 37.0 37.0 37.0 9 36.1885 37.0 37.0 37.0 37.0 37.0 10-14 36.3218 37.0 37.0 37.0 37.0 37.0 15-19 36.3232 37.0 37.0 37.0 37.0 37.0 20-24 36.32469999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.268800000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.1749 37.0 37.0 37.0 37.0 37.0 35-39 36.1859 37.0 37.0 37.0 37.0 37.0 40-44 36.162600000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.1846 37.0 37.0 37.0 37.0 37.0 50-54 36.1436 37.0 37.0 37.0 37.0 37.0 55-59 36.1195 37.0 37.0 37.0 37.0 37.0 60-64 36.064800000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.048700000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.9939 37.0 37.0 37.0 37.0 37.0 75-79 35.9777 37.0 37.0 37.0 37.0 37.0 80-84 35.79260000000001 37.0 37.0 37.0 34.6 37.0 85-89 35.8466 37.0 37.0 37.0 37.0 37.0 90-94 35.903800000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.858900000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.8526 37.0 37.0 37.0 37.0 37.0 105-109 35.776300000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.808899999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.7976 37.0 37.0 37.0 37.0 37.0 120-124 35.7211 37.0 37.0 37.0 37.0 37.0 125-129 35.702400000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.568799999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.653800000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.6619 37.0 37.0 37.0 37.0 37.0 145-149 35.646 37.0 37.0 37.0 37.0 37.0 150 35.4285 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 2.0 24 3.0 25 7.0 26 15.0 27 19.0 28 17.0 29 26.0 30 36.0 31 55.0 32 64.0 33 108.0 34 182.0 35 389.0 36 2746.0 37 327.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.099999999999998 15.875 11.85 43.175000000000004 2 29.525000000000002 25.224999999999998 25.575 19.675 3 22.925 26.05 18.825 32.2 4 29.375 27.900000000000002 16.6 26.125 5 28.075 30.45 19.25 22.225 6 23.35 32.175 18.7 25.775 7 22.775000000000002 16.775000000000002 32.824999999999996 27.625 8 23.05 19.825 24.0 33.125 9 24.6 19.0 26.75 29.65 10-14 27.985 24.195 19.55 28.27 15-19 27.52 22.275 21.63 28.575 20-24 27.58 23.385 21.48 27.555000000000003 25-29 28.115000000000002 22.91 21.665 27.310000000000002 30-34 27.279999999999998 22.855 21.705 28.16 35-39 27.66 23.53 21.105 27.705000000000002 40-44 28.01 22.39 21.425 28.175 45-49 27.800000000000004 22.814999999999998 21.32 28.065 50-54 28.215 22.695 21.345 27.744999999999997 55-59 27.685 22.36 21.63 28.325 60-64 28.405 22.38 21.47 27.744999999999997 65-69 28.26 21.82 21.775 28.144999999999996 70-74 27.965 22.405 22.27 27.36 75-79 27.975 22.005 22.12 27.900000000000002 80-84 28.105000000000004 22.355 22.205 27.334999999999997 85-89 28.660000000000004 22.24 21.72 27.38 90-94 27.915 21.925 22.095000000000002 28.065 95-99 28.99 22.665 21.065 27.279999999999998 100-104 28.255000000000003 21.959999999999997 22.0 27.785 105-109 28.505000000000003 22.455 21.825 27.215 110-114 28.59 22.18 21.654999999999998 27.575 115-119 28.660000000000004 22.040000000000003 21.58 27.72 120-124 28.48 22.825 22.09 26.605 125-129 28.560000000000002 21.845 22.1 27.495000000000005 130-134 28.849999999999998 21.48 22.46 27.21 135-139 29.085 21.795 22.314999999999998 26.805 140-144 28.599999999999998 22.040000000000003 22.145 27.215 145-149 29.21 22.235 22.075 26.479999999999997 150 28.975 22.675 22.075 26.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 0.5 27 0.5 28 0.5 29 0.5 30 1.0 31 1.5 32 1.0 33 5.5 34 12.5 35 14.0 36 25.0 37 32.5 38 39.5 39 50.5 40 63.0 41 82.5 42 89.0 43 106.5 44 123.5 45 121.0 46 137.5 47 150.0 48 141.5 49 132.0 50 124.0 51 115.0 52 114.0 53 115.0 54 118.0 55 111.5 56 100.0 57 94.5 58 86.5 59 93.0 60 100.5 61 99.0 62 94.0 63 100.5 64 101.5 65 102.0 66 105.0 67 102.0 68 108.0 69 111.0 70 104.0 71 89.0 72 68.5 73 61.0 74 56.5 75 44.0 76 36.5 77 31.5 78 26.5 79 19.5 80 11.0 81 4.5 82 4.5 83 6.5 84 4.5 85 1.5 86 1.0 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.60864775543928 82.25 2 8.675296061690995 15.75 3 0.6609749380335995 1.7999999999999998 4 0.0550812448361333 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.5375000000000001 0.0 0.0 0.0 0.0 128-129 0.625 0.0 0.0 0.0 0.0 130-131 0.7124999999999999 0.0 0.0 0.0 0.0 132-133 0.8125 0.0 0.0 0.0 0.0 134-135 0.8875 0.0 0.0 0.0 0.0 136-137 1.0875 0.0 0.0 0.0 0.0 138 1.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTCGCC 10 0.006973645 144.0 9 >>END_MODULE Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1724001 spots for SRR18697339.sra Written 1724001 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra Read 1723985 spots for SRR18697339.sra Written 1723985 spots for SRR18697339.sra SRR ids: ['SRR18697339.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j776w5om SRR18697339.sra spots: 34479716 blocks: [[1, 1723985], [1723986, 3447970], [3447971, 5171955], [5171956, 6895940], [6895941, 8619925], [8619926, 10343910], [10343911, 12067895], [12067896, 13791880], [13791881, 15515865], [15515866, 17239850], [17239851, 18963835], [18963836, 20687820], [20687821, 22411805], [22411806, 24135790], [24135791, 25859775], [25859776, 27583760], [27583761, 29307745], [29307746, 31031730], [31031731, 32755715], [32755716, 34479716]] SRR18697339 file size 11628672 SRR18697339 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18697339 SRR18697339_1.fastq SRR18697339_2.fastq Input file: SRR18697339_1.fastq Paired file: SRR18697339_2.fastq trimmed: SRR18697339-trimmed-pair1.fastq, SRR18697339-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:08:43 2024 >> started Tue Dec 10 07:09:26 2024 >> done (43.040s) 34479716 read pairs processed; of these: 34 ( 0.00%) short read pairs filtered out after trimming by size control 80 ( 0.00%) empty read pairs filtered out after trimming by size control 34479602 (100.00%) read pairs available; of these: 621067 ( 1.80%) trimmed read pairs available after processing 33858535 (98.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 294 0.00% 21 3 0.00% 22 5 0.00% 23 7 0.00% 24 4 0.00% 25 9 0.00% 26 7 0.00% 27 7 0.00% 28 13 0.00% 29 18 0.00% 30 37 0.00% 31 22 0.00% 32 18 0.00% 33 10 0.00% 34 12 0.00% 35 10 0.00% 36 14 0.00% 37 15 0.00% 38 23 0.00% 39 14 0.00% 40 19 0.00% 41 17 0.00% 42 21 0.00% 43 19 0.00% 44 18 0.00% 45 25 0.00% 46 20 0.00% 47 32 0.00% 48 30 0.00% 49 46 0.00% 50 29 0.00% 51 44 0.00% 52 32 0.00% 53 54 0.00% 54 51 0.00% 55 54 0.00% 56 70 0.00% 57 77 0.00% 58 66 0.00% 59 88 0.00% 60 70 0.00% 61 78 0.00% 62 98 0.00% 63 107 0.00% 64 101 0.00% 65 111 0.00% 66 133 0.00% 67 140 0.00% 68 147 0.00% 69 181 0.00% 70 177 0.00% 71 179 0.00% 72 198 0.00% 73 228 0.00% 74 240 0.00% 75 276 0.00% 76 346 0.00% 77 356 0.00% 78 359 0.00% 79 398 0.00% 80 451 0.00% 81 490 0.00% 82 537 0.00% 83 588 0.00% 84 689 0.00% 85 790 0.00% 86 865 0.00% 87 889 0.00% 88 1057 0.00% 89 1028 0.00% 90 1132 0.00% 91 1304 0.00% 92 1335 0.00% 93 1514 0.00% 94 1670 0.00% 95 1822 0.01% 96 1926 0.01% 97 2052 0.01% 98 2193 0.01% 99 2320 0.01% 100 2411 0.01% 101 2687 0.01% 102 2855 0.01% 103 3058 0.01% 104 3240 0.01% 105 3438 0.01% 106 3663 0.01% 107 3904 0.01% 108 4043 0.01% 109 4256 0.01% 110 4450 0.01% 111 4670 0.01% 112 4879 0.01% 113 5359 0.02% 114 5628 0.02% 115 6192 0.02% 116 6343 0.02% 117 6540 0.02% 118 6968 0.02% 119 7171 0.02% 120 7592 0.02% 121 8220 0.02% 122 8331 0.02% 123 9016 0.03% 124 9258 0.03% 125 9775 0.03% 126 10489 0.03% 127 11090 0.03% 128 11687 0.03% 129 12055 0.03% 130 12957 0.04% 131 13209 0.04% 132 13612 0.04% 133 14400 0.04% 134 15041 0.04% 135 15469 0.04% 136 16829 0.05% 137 17458 0.05% 138 17972 0.05% 139 19158 0.06% 140 19939 0.06% 141 20487 0.06% 142 21622 0.06% 143 22713 0.07% 144 24079 0.07% 145 24750 0.07% 146 26328 0.08% 147 27003 0.08% 148 28744 0.08% 149 30092 0.09% 150 33858535 98.20% 34479602 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=37 prefix-density=0.17 prefix-fanout=2.1 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=8 fanout-score=215.12 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=27.1 sequence=CGCCGCCGCCGA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=15.17 fanout-score-rank=11 prefix-density=0.41 prefix-fanout=8.8 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTA criterion=fanout-score sequence-density=0.12 sequence-density-rank=18 fanout-score=232.80 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=24.4 sequence=GCGGCGGCGGCC SRR18697339 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:10:23 Started mapping on | Dec 10 07:10:23 Finished on | Dec 10 07:13:16 Mapping speed, Million of reads per hour | 717.49 Number of input reads | 34479602 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 33477204 Uniquely mapped reads % | 97.09% Average mapped length | 298.29 Number of splices: Total | 32517029 Number of splices: Annotated (sjdb) | 30841026 Number of splices: GT/AG | 32084290 Number of splices: GC/AG | 363883 Number of splices: AT/AC | 22256 Number of splices: Non-canonical | 46600 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.58 Insertion rate per base | 0.01% Insertion average length | 3.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 548493 % of reads mapped to multiple loci | 1.59% Number of reads mapped to too many loci | 12579 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.94% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 453905 453905 453905 N_multimapping 548493 548493 548493 N_noFeature 473140 29321724 3669473 N_ambiguous 1066112 14335 96809 UnstrandedReadsAssigned:31937952 PositiveStrandReadsAssigned:4141145 NegativeStrandReadsAssigned:29710922 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18697339 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18697339-trimmed-pair1.fastq SRR18697339-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,479,602 reads, 30,034,880 reads pseudoaligned [quant] estimated average fragment length: 246.584 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52973 SRR18697339.ke.tsv 35125 SRR18697339.se.tsv 88098 total ==> SRR18697339.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 690.605 11.8317 0.71664 PNS24247 1044 798.416 38.5768 2.02106 PNS24249 1928 1682.42 481.261 11.9655 PNS24246 1044 798.416 38.5768 2.02106 PNS24248 1044 798.416 38.5768 2.02106 PNS24244 1471 1225.42 38.1766 1.30316 PNS24243 293 63.7243 1 0.656414 KQK14069 1603 1357.42 5198.23 160.186 KQK14071 474 230.718 78.3474 14.2045 ==> SRR18697339.se.tsv <== BRADI_1g14170v3 5346 BRADI_1g53295v3 20 BRADI_1g59795v3 145 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 1675 BRADI_1g74790v3 109 BRADI_1g09890v3 30 BRADI_1g77505v3 612 BRADI_1g48960v3 0 SRR18697339 completed mapping pipeline successfully