Starting /dee2/code/volunteer_pipeline.sh SRR18697340 current disk space = 1526024462336 free memory = 1602352216 SRR18697340 SRAfilesize 517840e65e017cdda4e21af53c43a3f0 SRR18697340.sra SRR18697340.sra file validated SRR18697340 is paired end SRR18697340 is conventional basespace SRR18697340 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18697340_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.192 37.0 37.0 37.0 37.0 37.0 2 36.3235 37.0 37.0 37.0 37.0 37.0 3 36.384 37.0 37.0 37.0 37.0 37.0 4 36.3255 37.0 37.0 37.0 37.0 37.0 5 36.3225 37.0 37.0 37.0 37.0 37.0 6 36.3785 37.0 37.0 37.0 37.0 37.0 7 36.366 37.0 37.0 37.0 37.0 37.0 8 36.3615 37.0 37.0 37.0 37.0 37.0 9 36.332 37.0 37.0 37.0 37.0 37.0 10-14 36.4154 37.0 37.0 37.0 37.0 37.0 15-19 36.394600000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.3649 37.0 37.0 37.0 37.0 37.0 25-29 36.305899999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.2161 37.0 37.0 37.0 37.0 37.0 35-39 35.975 37.0 37.0 37.0 37.0 37.0 40-44 36.16270000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.16199999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.073699999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.0967 37.0 37.0 37.0 37.0 37.0 60-64 36.016 37.0 37.0 37.0 37.0 37.0 65-69 35.989999999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.9379 37.0 37.0 37.0 37.0 37.0 75-79 35.917 37.0 37.0 37.0 37.0 37.0 80-84 35.933 37.0 37.0 37.0 37.0 37.0 85-89 35.9028 37.0 37.0 37.0 37.0 37.0 90-94 35.8276 37.0 37.0 37.0 37.0 37.0 95-99 35.7745 37.0 37.0 37.0 37.0 37.0 100-104 35.836 37.0 37.0 37.0 37.0 37.0 105-109 35.5307 37.0 37.0 37.0 37.0 37.0 110-114 35.322799999999994 37.0 37.0 37.0 32.2 37.0 115-119 35.6818 37.0 37.0 37.0 37.0 37.0 120-124 35.5604 37.0 37.0 37.0 37.0 37.0 125-129 35.6069 37.0 37.0 37.0 37.0 37.0 130-134 35.502300000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.5073 37.0 37.0 37.0 37.0 37.0 140-144 35.4149 37.0 37.0 37.0 34.6 37.0 145-149 35.425599999999996 37.0 37.0 37.0 37.0 37.0 150 35.4255 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 5.0 25 11.0 26 11.0 27 25.0 28 21.0 29 40.0 30 64.0 31 66.0 32 96.0 33 104.0 34 155.0 35 332.0 36 2685.0 37 383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.224999999999998 8.175 13.0 51.6 2 24.85 14.399999999999999 34.050000000000004 26.700000000000003 3 23.425 15.45 21.625 39.5 4 29.875 19.650000000000002 18.099999999999998 32.375 5 28.875 25.924999999999997 20.95 24.25 6 23.3 28.9 24.05 23.75 7 19.85 19.950000000000003 36.4 23.799999999999997 8 21.55 20.7 29.875 27.875 9 23.525 20.4 31.4 24.675 10-14 25.264999999999997 25.455 23.165 26.115 15-19 25.685000000000002 23.345 23.25 27.72 20-24 25.055 23.98 23.365 27.6 25-29 25.97 23.535 23.36 27.134999999999998 30-34 24.68 23.225 23.48 28.615000000000002 35-39 26.474999999999998 23.105 22.95 27.47 40-44 25.94 23.22 23.21 27.63 45-49 25.865 22.6 23.395 28.139999999999997 50-54 26.025 23.39 23.025000000000002 27.560000000000002 55-59 26.174999999999997 22.595000000000002 23.34 27.889999999999997 60-64 26.735 21.605 23.095 28.565 65-69 26.145000000000003 23.189999999999998 22.675 27.99 70-74 26.534999999999997 23.365 22.11 27.99 75-79 26.775 22.435 22.855 27.935 80-84 26.340000000000003 23.105 22.29 28.265 85-89 26.619999999999997 21.995 22.775000000000002 28.610000000000003 90-94 26.534999999999997 22.49 22.595000000000002 28.38 95-99 26.415 22.509999999999998 23.29 27.785 100-104 26.655 22.685 22.275 28.384999999999998 105-109 27.415 22.89 22.18 27.515 110-114 27.49 22.919999999999998 22.045 27.544999999999998 115-119 27.275 21.875 22.59 28.26 120-124 27.405 22.105 22.225 28.265 125-129 27.800000000000004 22.189999999999998 22.439999999999998 27.57 130-134 27.555000000000003 22.220000000000002 22.115000000000002 28.110000000000003 135-139 27.365000000000002 21.92 22.375 28.34 140-144 27.505000000000003 21.87 22.25 28.375 145-149 27.339999999999996 22.24 22.08 28.34 150 25.874999999999996 21.375 23.75 28.999999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 0.0 28 1.5 29 3.5 30 4.0 31 5.5 32 9.0 33 11.5 34 15.0 35 27.5 36 32.5 37 37.5 38 57.5 39 75.5 40 78.0 41 93.5 42 117.5 43 140.0 44 155.5 45 154.0 46 143.0 47 146.5 48 153.0 49 133.5 50 130.0 51 131.0 52 121.0 53 116.0 54 106.0 55 95.0 56 87.5 57 86.5 58 87.5 59 87.0 60 89.0 61 74.5 62 69.5 63 76.5 64 83.5 65 99.5 66 107.5 67 90.0 68 78.5 69 85.0 70 78.0 71 63.0 72 62.0 73 60.0 74 50.0 75 39.5 76 32.5 77 27.0 78 21.0 79 18.5 80 13.0 81 12.5 82 11.0 83 7.0 84 4.0 85 1.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.95 #Duplication Level Percentage of deduplicated Percentage of total 1 89.85547526403558 80.825 2 9.199555308504726 16.55 3 0.8615897720956087 2.325 4 0.08337965536409116 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0375 82-83 0.0 0.0 0.0 0.0 0.075 84-85 0.0 0.0 0.0 0.0 0.075 86-87 0.0125 0.0 0.0 0.0 0.075 88-89 0.025 0.0 0.0 0.0 0.075 90-91 0.025 0.0 0.0 0.0 0.075 92-93 0.025 0.0 0.0 0.0 0.075 94-95 0.025 0.0 0.0 0.0 0.075 96-97 0.025 0.0 0.0 0.0 0.075 98-99 0.025 0.0 0.0 0.0 0.075 100-101 0.025 0.0 0.0 0.0 0.075 102-103 0.0625 0.0 0.0 0.0 0.075 104-105 0.1125 0.0 0.0 0.0 0.075 106-107 0.1375 0.0 0.0 0.0 0.075 108-109 0.175 0.0 0.0 0.0 0.075 110-111 0.225 0.0 0.0 0.0 0.075 112-113 0.3125 0.0 0.0 0.0 0.075 114-115 0.4125 0.0 0.0 0.0 0.075 116-117 0.44999999999999996 0.0 0.0 0.0 0.075 118-119 0.5375000000000001 0.0 0.0 0.0 0.075 120-121 0.6125 0.0 0.0 0.0 0.075 122-123 0.675 0.0 0.0 0.0 0.075 124-125 0.75 0.0 0.0 0.0 0.075 126-127 0.8625 0.0 0.0 0.0 0.075 128-129 0.975 0.0 0.0 0.0 0.075 130-131 1.0499999999999998 0.0 0.0 0.0 0.075 132-133 1.175 0.0 0.0 0.0 0.075 134-135 1.325 0.0 0.0 0.0 0.075 136-137 1.4625 0.0 0.0 0.0 0.075 138 1.625 0.0 0.0 0.0 0.075 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTGTA 10 0.006973645 144.0 4 TTGTATA 10 0.006973645 144.0 6 TGGGCGA 10 0.006973645 144.0 3 GGGCGAC 10 0.006973645 144.0 4 TGCAGCA 10 0.006973645 144.0 8 GTTGTAT 10 0.006973645 144.0 5 CTATCAT 10 0.006973645 144.0 8 >>END_MODULE SRR18697340 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18697340_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2225 37.0 37.0 37.0 37.0 37.0 2 36.226 37.0 37.0 37.0 37.0 37.0 3 36.283 37.0 37.0 37.0 37.0 37.0 4 36.275 37.0 37.0 37.0 37.0 37.0 5 36.2835 37.0 37.0 37.0 37.0 37.0 6 36.1635 37.0 37.0 37.0 37.0 37.0 7 36.1545 37.0 37.0 37.0 37.0 37.0 8 36.299 37.0 37.0 37.0 37.0 37.0 9 36.2545 37.0 37.0 37.0 37.0 37.0 10-14 36.292500000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.251799999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.260000000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.256 37.0 37.0 37.0 37.0 37.0 30-34 36.1969 37.0 37.0 37.0 37.0 37.0 35-39 36.18140000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.1827 37.0 37.0 37.0 37.0 37.0 45-49 36.083 37.0 37.0 37.0 37.0 37.0 50-54 36.076299999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.081500000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.045500000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.9678 37.0 37.0 37.0 37.0 37.0 70-74 35.9957 37.0 37.0 37.0 37.0 37.0 75-79 35.9324 37.0 37.0 37.0 37.0 37.0 80-84 35.797799999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.8106 37.0 37.0 37.0 37.0 37.0 90-94 35.947500000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.860800000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.8256 37.0 37.0 37.0 37.0 37.0 105-109 35.8073 37.0 37.0 37.0 37.0 37.0 110-114 35.7736 37.0 37.0 37.0 37.0 37.0 115-119 35.7094 37.0 37.0 37.0 37.0 37.0 120-124 35.783 37.0 37.0 37.0 37.0 37.0 125-129 35.705400000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.609700000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.6365 37.0 37.0 37.0 37.0 37.0 140-144 35.573299999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.594199999999994 37.0 37.0 37.0 37.0 37.0 150 35.2865 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 4.0 24 6.0 25 9.0 26 16.0 27 17.0 28 23.0 29 27.0 30 38.0 31 56.0 32 51.0 33 91.0 34 167.0 35 425.0 36 2747.0 37 319.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.625 18.0 10.9 42.475 2 28.299999999999997 27.150000000000002 25.900000000000002 18.65 3 24.0 26.224999999999998 19.7 30.075000000000003 4 27.400000000000002 30.349999999999998 15.174999999999999 27.075 5 28.075 30.8 18.875 22.25 6 23.175 31.825 19.55 25.45 7 22.725 16.575 31.075000000000003 29.625 8 24.2 19.6 23.400000000000002 32.800000000000004 9 25.0 19.2 26.275 29.525000000000002 10-14 27.51 23.91 20.505000000000003 28.075 15-19 26.965 23.155 21.67 28.21 20-24 27.57 22.985 21.58 27.865000000000002 25-29 27.83 23.35 21.32 27.500000000000004 30-34 27.355 22.86 21.195 28.59 35-39 27.505000000000003 22.31 21.94 28.244999999999997 40-44 27.47 23.01 21.709999999999997 27.810000000000002 45-49 27.735 22.935 21.490000000000002 27.839999999999996 50-54 28.405 22.645 21.125 27.825 55-59 28.749999999999996 22.84 20.76 27.650000000000002 60-64 27.900000000000002 22.64 21.395 28.065 65-69 27.615000000000002 22.61 22.18 27.595 70-74 28.4 22.255 21.495 27.85 75-79 28.4 22.175 21.64 27.785 80-84 28.375 22.5 21.26 27.865000000000002 85-89 28.54 22.155 21.375 27.93 90-94 28.285 22.49 21.395 27.83 95-99 28.7 22.7 21.245 27.355 100-104 28.585 22.439999999999998 21.65 27.325 105-109 28.51 22.725 21.535 27.229999999999997 110-114 29.12 22.73 21.16 26.99 115-119 28.325 22.765 21.63 27.279999999999998 120-124 28.375 22.68 21.575 27.37 125-129 27.665 22.965 22.145 27.224999999999998 130-134 28.07 22.53 21.91 27.49 135-139 28.32 22.28 21.915000000000003 27.485 140-144 28.12 22.61 22.43 26.840000000000003 145-149 28.444999999999997 22.765 22.14 26.650000000000002 150 28.375 23.849999999999998 22.525000000000002 25.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 1.0 27 2.0 28 1.0 29 1.0 30 3.0 31 4.5 32 4.5 33 5.0 34 6.5 35 9.0 36 18.0 37 30.5 38 38.5 39 47.0 40 54.5 41 73.0 42 105.5 43 121.0 44 126.5 45 128.5 46 134.0 47 143.0 48 138.0 49 134.0 50 135.0 51 131.5 52 110.0 53 101.0 54 113.0 55 106.5 56 96.0 57 96.0 58 94.0 59 95.5 60 100.0 61 100.0 62 100.0 63 99.0 64 99.0 65 105.5 66 111.0 67 111.5 68 98.0 69 93.0 70 93.5 71 80.0 72 71.0 73 66.0 74 58.5 75 45.0 76 38.0 77 32.0 78 24.5 79 21.0 80 15.5 81 8.0 82 6.5 83 6.5 84 2.0 85 0.0 86 1.5 87 2.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.125 #Duplication Level Percentage of deduplicated Percentage of total 1 90.124826629681 81.22500000000001 2 9.042995839112344 16.3 3 0.6934812760055479 1.875 4 0.08321775312066575 0.3 5 0.0 0.0 6 0.055478502080443824 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAGCAAGCAAGCTAGCTAGCGAGCATCAATGGCGATGACCATGAGGAAG 6 0.15 No Hit AAGCAAGCAAGCTAGCTAGCGAGCATCAATGGCGATGACCATGAGGAAGA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0125 0.0 0.0 18-19 0.0 0.0 0.025 0.0 0.0 20-21 0.0 0.0 0.025 0.0 0.0 22-23 0.0 0.0 0.025 0.0 0.0 24-25 0.0 0.0 0.025 0.0 0.0 26-27 0.0 0.0 0.025 0.0 0.0 28-29 0.0 0.0 0.025 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.025 70-71 0.0 0.0 0.025 0.0 0.025 72-73 0.0 0.0 0.025 0.0 0.025 74-75 0.0 0.0 0.025 0.0 0.025 76-77 0.0 0.0 0.025 0.0 0.025 78-79 0.0 0.0 0.025 0.0 0.025 80-81 0.0 0.0 0.025 0.0 0.025 82-83 0.0 0.0 0.025 0.0 0.025 84-85 0.0 0.0 0.025 0.0 0.025 86-87 0.0125 0.0 0.025 0.0 0.025 88-89 0.025 0.0 0.025 0.0 0.025 90-91 0.025 0.0 0.025 0.0 0.025 92-93 0.025 0.0 0.025 0.0 0.025 94-95 0.025 0.0 0.025 0.0 0.025 96-97 0.025 0.0 0.025 0.0 0.025 98-99 0.025 0.0 0.025 0.0 0.025 100-101 0.025 0.0 0.025 0.0 0.025 102-103 0.0625 0.0 0.025 0.0 0.025 104-105 0.1125 0.0 0.025 0.0 0.025 106-107 0.1375 0.0 0.025 0.0 0.025 108-109 0.175 0.0 0.025 0.0 0.025 110-111 0.225 0.0 0.025 0.0 0.025 112-113 0.3125 0.0 0.025 0.0 0.025 114-115 0.4125 0.0 0.025 0.0 0.025 116-117 0.475 0.0 0.025 0.0 0.025 118-119 0.5625 0.0 0.025 0.0 0.025 120-121 0.6375 0.0 0.025 0.0 0.025 122-123 0.7 0.0 0.025 0.0 0.025 124-125 0.7749999999999999 0.0 0.025 0.0 0.025 126-127 0.8875 0.0 0.025 0.0 0.025 128-129 1.0 0.0 0.025 0.0 0.025 130-131 1.0750000000000002 0.0 0.025 0.0 0.025 132-133 1.1875 0.0 0.025 0.0 0.025 134-135 1.3125 0.0 0.025 0.0 0.025 136-137 1.4375 0.0 0.025 0.0 0.025 138 1.6 0.0 0.025 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGAT 10 0.006973645 144.0 2 GATTGTG 10 0.006973645 144.0 6 ATTGTGC 10 0.006973645 144.0 7 AGAGATT 10 0.006973645 144.0 3 TTGTGCA 10 0.006973645 144.0 8 AGATTGT 10 0.006973645 144.0 5 GAGATTG 10 0.006973645 144.0 4 >>END_MODULE Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710681 spots for SRR18697340.sra Written 1710681 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra Read 1710670 spots for SRR18697340.sra Written 1710670 spots for SRR18697340.sra SRR ids: ['SRR18697340.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7wtw6ac0 SRR18697340.sra spots: 34213411 blocks: [[1, 1710670], [1710671, 3421340], [3421341, 5132010], [5132011, 6842680], [6842681, 8553350], [8553351, 10264020], [10264021, 11974690], [11974691, 13685360], [13685361, 15396030], [15396031, 17106700], [17106701, 18817370], [18817371, 20528040], [20528041, 22238710], [22238711, 23949380], [23949381, 25660050], [25660051, 27370720], [27370721, 29081390], [29081391, 30792060], [30792061, 32502730], [32502731, 34213411]] SRR18697340 file size 11538690 SRR18697340 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18697340 SRR18697340_1.fastq SRR18697340_2.fastq Input file: SRR18697340_1.fastq Paired file: SRR18697340_2.fastq trimmed: SRR18697340-trimmed-pair1.fastq, SRR18697340-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:14:11 2024 >> started Tue Dec 10 07:14:49 2024 >> done (37.517s) 34213411 read pairs processed; of these: 104 ( 0.00%) short read pairs filtered out after trimming by size control 62 ( 0.00%) empty read pairs filtered out after trimming by size control 34213245 (100.00%) read pairs available; of these: 704558 ( 2.06%) trimmed read pairs available after processing 33508687 (97.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 14 0.00% 21 8 0.00% 22 13 0.00% 23 6 0.00% 24 6 0.00% 25 12 0.00% 26 7 0.00% 27 12 0.00% 28 9 0.00% 29 10 0.00% 30 50 0.00% 31 20 0.00% 32 14 0.00% 33 24 0.00% 34 15 0.00% 35 18 0.00% 36 21 0.00% 37 17 0.00% 38 21 0.00% 39 24 0.00% 40 22 0.00% 41 25 0.00% 42 33 0.00% 43 21 0.00% 44 38 0.00% 45 37 0.00% 46 33 0.00% 47 36 0.00% 48 41 0.00% 49 54 0.00% 50 50 0.00% 51 54 0.00% 52 70 0.00% 53 65 0.00% 54 80 0.00% 55 69 0.00% 56 81 0.00% 57 95 0.00% 58 106 0.00% 59 108 0.00% 60 127 0.00% 61 139 0.00% 62 154 0.00% 63 143 0.00% 64 119 0.00% 65 150 0.00% 66 171 0.00% 67 226 0.00% 68 224 0.00% 69 223 0.00% 70 243 0.00% 71 282 0.00% 72 309 0.00% 73 328 0.00% 74 305 0.00% 75 382 0.00% 76 426 0.00% 77 438 0.00% 78 510 0.00% 79 583 0.00% 80 587 0.00% 81 636 0.00% 82 769 0.00% 83 819 0.00% 84 940 0.00% 85 1023 0.00% 86 1108 0.00% 87 1278 0.00% 88 1384 0.00% 89 1484 0.00% 90 1631 0.00% 91 1657 0.00% 92 1868 0.01% 93 2010 0.01% 94 2164 0.01% 95 2335 0.01% 96 2360 0.01% 97 2628 0.01% 98 2828 0.01% 99 3082 0.01% 100 3393 0.01% 101 3700 0.01% 102 3674 0.01% 103 3980 0.01% 104 4341 0.01% 105 4488 0.01% 106 4722 0.01% 107 5057 0.01% 108 5296 0.02% 109 5609 0.02% 110 5764 0.02% 111 6191 0.02% 112 6447 0.02% 113 6789 0.02% 114 7198 0.02% 115 7650 0.02% 116 7980 0.02% 117 8331 0.02% 118 8793 0.03% 119 9103 0.03% 120 9373 0.03% 121 9827 0.03% 122 10221 0.03% 123 10812 0.03% 124 11232 0.03% 125 11821 0.03% 126 12418 0.04% 127 12915 0.04% 128 13252 0.04% 129 13842 0.04% 130 14887 0.04% 131 15055 0.04% 132 15584 0.05% 133 16207 0.05% 134 16653 0.05% 135 17212 0.05% 136 18539 0.05% 137 19437 0.06% 138 19691 0.06% 139 20711 0.06% 140 21632 0.06% 141 22292 0.07% 142 23215 0.07% 143 24036 0.07% 144 24789 0.07% 145 26104 0.08% 146 26975 0.08% 147 28121 0.08% 148 29125 0.09% 149 30554 0.09% 150 33508687 97.94% 34213245 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=32 prefix-density=0.23 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=12 fanout-score=196.25 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=26.6 sequence=CGCCGCCGCCGA criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=12.26 fanout-score-rank=12 prefix-density=0.44 prefix-fanout=7.6 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=255.87 fanout-score-rank=1 prefix-density=1.18 prefix-fanout=24.3 sequence=GCGGCGGCGGCG SRR18697340 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:15:36 Started mapping on | Dec 10 07:15:36 Finished on | Dec 10 07:18:25 Mapping speed, Million of reads per hour | 728.80 Number of input reads | 34213245 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 33277928 Uniquely mapped reads % | 97.27% Average mapped length | 298.03 Number of splices: Total | 32913491 Number of splices: Annotated (sjdb) | 31265298 Number of splices: GT/AG | 32485194 Number of splices: GC/AG | 360966 Number of splices: AT/AC | 23640 Number of splices: Non-canonical | 43691 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.60 Insertion rate per base | 0.01% Insertion average length | 3.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 515046 % of reads mapped to multiple loci | 1.51% Number of reads mapped to too many loci | 7478 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.98% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 420271 420271 420271 N_multimapping 515046 515046 515046 N_noFeature 440060 29435467 3165528 N_ambiguous 1225624 12926 99800 UnstrandedReadsAssigned:31612244 PositiveStrandReadsAssigned:3829535 NegativeStrandReadsAssigned:30012600 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18697340 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18697340-trimmed-pair1.fastq SRR18697340-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,213,245 reads, 30,321,202 reads pseudoaligned [quant] estimated average fragment length: 253.318 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,258 rounds 52973 SRR18697340.ke.tsv 35125 SRR18697340.se.tsv 88098 total ==> SRR18697340.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.882 90.9446 5.31804 PNS24247 1044 791.682 22.3286 1.12789 PNS24249 1928 1675.68 426.541 10.1795 PNS24246 1044 791.682 22.3286 1.12789 PNS24248 1044 791.682 22.3286 1.12789 PNS24244 1471 1218.68 46.5285 1.52681 PNS24243 293 61.9214 0 0 KQK14069 1603 1350.68 3438.69 101.811 KQK14071 474 223.922 24.9194 4.45036 ==> SRR18697340.se.tsv <== BRADI_1g14170v3 3501 BRADI_1g53295v3 26 BRADI_1g59795v3 111 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 1963 BRADI_1g74790v3 141 BRADI_1g09890v3 30 BRADI_1g77505v3 601 BRADI_1g48960v3 0 SRR18697340 completed mapping pipeline successfully