Starting /dee2/code/volunteer_pipeline.sh SRR18888527 current disk space = 1526019588096 free memory = 1555538444 SRR18888527 SRAfilesize ed09917a4a8b2c3d3131ef35285b18d8 SRR18888527.sra SRR18888527.sra file validated SRR18888527 is paired end SRR18888527 is conventional basespace SRR18888527 read1 length is 52-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18888527_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.25025 32.0 32.0 32.0 32.0 32.0 2 31.47075 32.0 32.0 32.0 32.0 32.0 3 31.53625 32.0 32.0 32.0 32.0 32.0 4 31.5125 32.0 32.0 32.0 32.0 32.0 5 31.5835 32.0 32.0 32.0 32.0 32.0 6 34.664 36.0 36.0 36.0 32.0 36.0 7 34.972 36.0 36.0 36.0 32.0 36.0 8 34.81925 36.0 36.0 36.0 32.0 36.0 9 34.8375 36.0 36.0 36.0 32.0 36.0 10-11 34.752624999999995 36.0 36.0 36.0 32.0 36.0 12-13 34.8765 36.0 36.0 36.0 32.0 36.0 14-15 34.8765 36.0 36.0 36.0 32.0 36.0 16-17 34.940124999999995 36.0 36.0 36.0 32.0 36.0 18-19 34.861125 36.0 36.0 36.0 32.0 36.0 20-21 34.89875 36.0 36.0 36.0 32.0 36.0 22-23 34.87125 36.0 36.0 36.0 32.0 36.0 24-25 34.71225 36.0 36.0 36.0 32.0 36.0 26-27 34.727875 36.0 36.0 36.0 32.0 36.0 28-29 34.66875 36.0 36.0 36.0 32.0 36.0 30-31 34.6375 36.0 36.0 36.0 32.0 36.0 32-33 34.476375 36.0 36.0 36.0 32.0 36.0 34-35 34.527 36.0 36.0 36.0 32.0 36.0 36-37 34.390125 36.0 36.0 36.0 32.0 36.0 38-39 34.406875 36.0 36.0 36.0 32.0 36.0 40-41 34.317125000000004 36.0 36.0 36.0 32.0 36.0 42-43 34.3045 36.0 36.0 36.0 32.0 36.0 44-45 34.370875 36.0 36.0 36.0 32.0 36.0 46-47 34.258875 36.0 36.0 36.0 32.0 36.0 48-49 34.162875 36.0 36.0 36.0 32.0 36.0 50-51 34.215 36.0 36.0 36.0 32.0 36.0 52-53 34.18127381845461 36.0 36.0 36.0 32.0 36.0 54-55 34.147411852963245 36.0 36.0 36.0 32.0 36.0 56-57 34.209802450612656 36.0 36.0 36.0 32.0 36.0 58-59 34.1089183001103 36.0 36.0 36.0 32.0 36.0 60-61 33.98423817863397 36.0 36.0 36.0 32.0 36.0 62-63 34.034167709637046 36.0 36.0 36.0 32.0 36.0 64-65 33.99623737206444 36.0 36.0 36.0 32.0 36.0 66-67 33.997235318699964 36.0 36.0 36.0 32.0 36.0 68-69 33.816871396339934 36.0 36.0 36.0 27.0 36.0 70-71 33.69843050596485 36.0 36.0 36.0 24.0 36.0 72-73 33.80358688246709 36.0 36.0 36.0 27.0 36.0 74-75 33.60254311305043 36.0 36.0 36.0 24.0 36.0 76 33.758685800604226 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 6.0 21 6.0 22 10.0 23 21.0 24 31.0 25 30.0 26 26.0 27 37.0 28 47.0 29 69.0 30 96.0 31 147.0 32 204.0 33 289.0 34 608.0 35 2372.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.85 9.55 10.85 46.75 2 20.155038759689923 16.829207301825456 31.43285821455364 31.58289572393098 3 24.25 17.974999999999998 18.675 39.1 4 28.725 26.450000000000003 16.425 28.4 5 26.400000000000002 29.475 21.0 23.125 6 23.02847064751827 31.594860166288736 22.75132275132275 22.625346434870245 7 18.4 23.05 36.199999999999996 22.35 8 21.2 22.525000000000002 27.3 28.975 9 22.55 22.075 30.375000000000004 25.0 10-11 24.2875 29.925 22.3625 23.425 12-13 24.9125 23.65 26.3125 25.124999999999996 14-15 22.277784723090384 25.328166020752597 26.215776972121514 26.178272284035504 16-17 23.9 24.65 26.325 25.124999999999996 18-19 23.7 26.1125 24.637500000000003 25.55 20-21 24.3 25.4625 25.112499999999997 25.124999999999996 22-23 23.962500000000002 24.8625 25.2125 25.9625 24-25 23.4875 24.8125 25.55 26.150000000000002 26-27 24.281070267566893 25.11877969492373 25.268817204301076 25.331332833208304 28-29 24.065508188523566 24.753094136767096 25.153144143017876 26.02825353169146 30-31 23.275000000000002 25.112499999999997 24.875 26.737499999999997 32-33 24.1125 24.4875 25.8625 25.5375 34-35 23.95 25.775 24.75 25.525 36-37 24.359134675503313 25.672127047642867 24.446667500312618 25.5220707765412 38-39 24.25 25.6 24.1125 26.0375 40-41 23.599999999999998 25.874999999999996 24.0625 26.4625 42-43 24.55 24.9375 24.474999999999998 26.0375 44-45 24.1125 26.0375 24.3125 25.5375 46-47 23.777972246530815 27.803475434429302 23.377922240280036 25.040630078759847 48-49 25.01564259792266 25.87911400325366 22.80065073207358 26.304592666750093 50-51 24.090511313914238 25.965745718214777 23.65295661957745 26.290786348293537 52-53 25.065633204150515 26.778347293411674 22.702837854731843 25.453181647705964 54-55 24.793698424606152 26.994248562140534 22.83070767691923 25.381345336334082 56-57 24.093523380845213 26.281570392598148 23.85596399099775 25.76894223555889 58-59 24.337168584292147 27.163581790895446 22.848924462231114 25.65032516258129 60-61 24.22119354435131 26.097835606155385 23.407981984236205 26.2729888652571 62-63 25.053211468636533 26.468010517090274 22.336296481782895 26.142481532490297 64-65 25.097056981840954 25.56042579837195 23.61928616155291 25.72323105823419 66-67 24.962406015037594 26.71679197994987 22.380952380952383 25.93984962406015 68-69 25.582852845324645 26.2847831536726 22.273752820255705 25.858611180747054 70-71 24.855781289189867 26.059694005517937 23.501379483320793 25.58314522197141 72-73 24.889840110789375 26.488732217046458 22.548155608712072 26.073272063452098 74-75 26.24933545986178 23.139287612971824 24.25571504518873 26.35566188197767 76 28.738670694864048 0.0 31.19335347432024 40.06797583081571 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 60.0 1 33.0 2 4.0 3 2.0 4 2.0 5 3.5 6 3.5 7 5.5 8 9.0 9 9.0 10 13.5 11 19.0 12 20.0 13 15.5 14 9.0 15 6.5 16 6.0 17 3.5 18 1.5 19 2.0 20 2.0 21 1.5 22 2.0 23 1.5 24 2.0 25 4.0 26 3.5 27 5.0 28 6.5 29 9.0 30 13.5 31 17.0 32 22.0 33 25.0 34 30.0 35 52.0 36 73.0 37 75.0 38 91.0 39 116.0 40 129.5 41 140.5 42 147.5 43 167.5 44 186.0 45 187.0 46 190.5 47 191.0 48 188.5 49 200.5 50 208.0 51 185.0 52 157.5 53 141.5 54 137.5 55 145.0 56 140.5 57 125.5 58 118.0 59 105.0 60 100.0 61 97.5 62 86.5 63 91.0 64 96.0 65 84.5 66 77.0 67 80.5 68 81.5 69 69.5 70 53.5 71 53.5 72 56.5 73 54.0 74 46.5 75 41.0 76 39.5 77 34.5 78 22.5 79 12.5 80 12.0 81 12.5 82 10.0 83 6.5 84 4.0 85 2.0 86 0.5 87 0.5 88 1.0 89 2.0 90 1.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.775 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0125 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.025 28-29 0.0125 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0375 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0125 48-49 0.11249999999999999 50-51 0.0125 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.012504689258471927 60-61 0.012509382036527395 62-63 0.03754693366708385 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.012539184952978056 72-73 0.0 74-75 0.013289036544850499 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 1.0 60 0.0 61 2.0 62 0.0 63 2.0 64 1.0 65 1.0 66 2.0 67 0.0 68 0.0 69 1.0 70 1.0 71 6.0 72 19.0 73 72.0 74 255.0 75 987.0 76 2648.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.525 #Duplication Level Percentage of deduplicated Percentage of total 1 98.29059829059828 94.875 2 1.3727013727013726 2.65 3 0.2331002331002331 0.675 4 0.0259000259000259 0.1 5 0.0259000259000259 0.125 6 0.0259000259000259 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0259000259000259 1.425 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 57 1.425 No Hit CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA 6 0.15 No Hit GTCGAGTTATCATGAATCATCGGATCAGCGAGCAAAGCCCGCGTCAGCCTTTTATCTAATAAATGCGCCCCTCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18888527 read2 length is 52-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18888527_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.29025 32.0 32.0 32.0 27.0 32.0 2 30.258 32.0 32.0 32.0 21.0 32.0 3 30.32425 32.0 32.0 32.0 21.0 32.0 4 30.1875 32.0 32.0 32.0 21.0 32.0 5 30.055 32.0 32.0 32.0 21.0 32.0 6 33.58575 36.0 36.0 36.0 21.0 36.0 7 33.599 36.0 36.0 36.0 21.0 36.0 8 33.22425 36.0 36.0 36.0 21.0 36.0 9 33.4125 36.0 36.0 36.0 21.0 36.0 10-11 33.350624999999994 36.0 36.0 36.0 21.0 36.0 12-13 33.13825 36.0 36.0 36.0 17.5 36.0 14-15 33.3075 36.0 36.0 36.0 21.0 36.0 16-17 33.271125 36.0 36.0 36.0 21.0 36.0 18-19 33.20675 36.0 36.0 36.0 21.0 36.0 20-21 33.338375 36.0 36.0 36.0 21.0 36.0 22-23 33.54275 36.0 36.0 36.0 26.5 36.0 24-25 33.37775 36.0 36.0 36.0 21.0 36.0 26-27 33.323499999999996 36.0 36.0 36.0 21.0 36.0 28-29 33.082375 36.0 36.0 36.0 17.5 36.0 30-31 33.194125 36.0 36.0 36.0 21.0 36.0 32-33 33.191625 36.0 36.0 36.0 21.0 36.0 34-35 33.303875000000005 36.0 36.0 36.0 24.0 36.0 36-37 33.16 36.0 36.0 36.0 17.5 36.0 38-39 33.171 36.0 36.0 36.0 14.0 36.0 40-41 33.10275 36.0 36.0 36.0 14.0 36.0 42-43 33.120374999999996 36.0 36.0 36.0 14.0 36.0 44-45 33.143625 36.0 36.0 36.0 14.0 36.0 46-47 33.147125 36.0 36.0 36.0 14.0 36.0 48-49 33.14775 36.0 36.0 36.0 14.0 36.0 50-51 33.1855 36.0 36.0 36.0 14.0 36.0 52-53 33.12376603525881 36.0 36.0 36.0 14.0 36.0 54-55 32.987621905476374 36.0 36.0 36.0 14.0 36.0 56-57 33.152163040760186 36.0 36.0 36.0 14.0 36.0 58-59 32.9030875152505 36.0 36.0 36.0 14.0 36.0 60-61 32.85276457343008 36.0 36.0 36.0 14.0 36.0 62-63 32.983854818523156 36.0 36.0 36.0 14.0 36.0 64-65 32.859355544296704 36.0 36.0 36.0 14.0 36.0 66-67 32.916679129947624 36.0 36.0 36.0 14.0 36.0 68-69 32.66746051642016 36.0 36.0 36.0 14.0 36.0 70-71 32.67916915672296 36.0 36.0 36.0 14.0 36.0 72-73 32.65914434118217 36.0 36.0 36.0 14.0 36.0 74-75 32.84973765795419 36.0 36.0 36.0 14.0 36.0 76 32.73985589685248 36.0 36.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 15.0 15 20.0 16 21.0 17 34.0 18 31.0 19 32.0 20 29.0 21 20.0 22 25.0 23 27.0 24 37.0 25 36.0 26 58.0 27 53.0 28 74.0 29 109.0 30 136.0 31 164.0 32 232.0 33 320.0 34 620.0 35 1906.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.871762635152127 14.382700528036207 13.2763389489565 42.46919788785517 2 23.225 25.35 27.125 24.3 3 24.0 25.974999999999998 20.375 29.65 4 27.950000000000003 30.3 15.925 25.825 5 27.55 30.55 18.925 22.975 6 23.35 33.275 19.425 23.95 7 22.780695173793447 17.00425106276569 32.58314578644661 27.631907976994246 8 22.458688032048073 21.607411116675014 24.536805207811717 31.3970956434652 9 23.830957739434858 22.05551387846962 25.531382845711427 28.582145536384097 10-11 26.88844422211106 28.251625812906454 19.109554777388695 25.7503751875938 12-13 26.987499999999997 22.112499999999997 22.8375 28.0625 14-15 24.349999999999998 25.874999999999996 24.0 25.775 16-17 25.726452905811627 24.574148296593187 23.947895791583164 25.751503006012022 18-19 25.300751879699245 24.69924812030075 24.022556390977442 25.977443609022554 20-21 25.691056910569106 24.140087554721703 24.577861163227016 25.59099437148218 22-23 25.3 24.525 24.637500000000003 25.5375 24-25 25.03751875937969 24.937468734367183 24.287143571785894 25.737868934467233 26-27 25.682102628285357 26.070087609511887 23.729662077597 24.518147684605758 28-29 25.436283741368488 24.733207784055242 23.553044569993723 26.27746390458255 30-31 25.87543771885943 25.025012506253123 23.51175587793897 25.587793896948476 32-33 25.681420355088775 25.018754688672168 24.143535883970994 25.156289072268066 34-35 26.0 26.075 23.025000000000002 24.9 36-37 25.409528573214956 25.697136426159812 22.958609478554457 25.934725522070778 38-39 25.76080150281778 24.946775203506576 23.656856606136508 25.635566687539136 40-41 25.9050482274834 25.378930226731804 23.111612175873734 25.604409369911064 42-43 26.119683853970642 24.651863003387277 23.334587881068874 25.8938652615732 44-45 26.446280991735538 25.19408965689958 23.415977961432507 24.94365138993238 46-47 26.35988495685882 25.184444166562457 22.633487557834187 25.82218331874453 48-49 25.649391391642617 24.896473836114946 23.716902999121597 25.737231773120843 50-51 26.270974204858504 25.569747057350362 22.71475081392437 25.444527923866765 52-53 26.00975365762161 25.54708015505815 22.696011004126547 25.747155183193698 54-55 25.831457864466117 25.6064016004001 23.918479619904975 24.643660915228807 56-57 25.465916197623518 26.00375234521576 22.989368355222016 25.54096310193871 58-59 25.97288476023098 25.48330404217926 23.663068039166458 24.8807431584233 60-61 25.960813865862846 25.119316754584275 23.21024868123587 25.709620698317003 62-63 26.89897217347706 25.457508147405367 23.20130358485836 24.442216094259212 64-65 25.407166123778502 26.97318967677274 22.08719619143072 25.532448008018036 66-67 26.35338345864662 25.526315789473685 23.082706766917294 25.03759398496241 68-69 25.560987840040116 26.802055910743388 22.777986711796412 24.858969537420084 70-71 26.73130193905817 26.08914631075296 22.17325610677411 25.006295643414756 72-73 26.108374384236456 26.019957054439814 22.937981558671215 24.93368700265252 74-75 27.00438771439968 22.922483712272303 23.959579843105967 26.113548730222046 76 28.896473265073947 0.0 33.18164580963216 37.92188092529389 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 45.0 1 34.5 2 20.0 3 12.5 4 9.0 5 9.5 6 8.0 7 10.5 8 15.0 9 12.5 10 12.5 11 13.0 12 11.0 13 9.5 14 5.5 15 2.5 16 2.0 17 2.5 18 2.0 19 2.5 20 2.5 21 0.5 22 1.5 23 2.0 24 2.0 25 2.5 26 5.5 27 6.0 28 4.5 29 7.0 30 9.0 31 11.5 32 19.0 33 25.0 34 36.0 35 53.5 36 60.5 37 62.5 38 80.0 39 104.5 40 110.0 41 121.0 42 143.0 43 156.5 44 164.5 45 179.5 46 185.0 47 176.5 48 172.0 49 168.0 50 171.5 51 177.0 52 163.0 53 156.0 54 155.5 55 134.5 56 122.0 57 118.5 58 109.5 59 98.0 60 88.5 61 98.0 62 106.5 63 103.0 64 98.0 65 85.5 66 92.5 67 106.5 68 110.0 69 102.5 70 79.5 71 65.0 72 66.0 73 68.0 74 63.0 75 57.5 76 46.5 77 31.5 78 22.5 79 19.0 80 21.5 81 18.5 82 9.0 83 5.0 84 7.0 85 7.0 86 3.0 87 1.5 88 2.5 89 2.0 90 0.5 91 0.5 92 1.0 93 1.0 94 1.5 95 1.0 96 0.0 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.15 9 0.025 10-11 0.05 12-13 0.0 14-15 0.0 16-17 0.2 18-19 0.25 20-21 0.0625 22-23 0.0 24-25 0.05 26-27 0.125 28-29 0.43750000000000006 30-31 0.05 32-33 0.025 34-35 0.0 36-37 0.0375 38-39 0.1875 40-41 0.21250000000000002 42-43 0.36250000000000004 44-45 0.17500000000000002 46-47 0.0375 48-49 0.3875 50-51 0.17500000000000002 52-53 0.025003125390673835 54-55 0.0 56-57 0.037509377344336084 58-59 0.38764536701262975 60-61 0.40030022516887664 62-63 0.1501877346683354 64-65 0.037570444583594244 66-67 0.0 68-69 0.0125344697919278 70-71 0.3763171098845961 72-73 0.32733224222585927 74-75 0.03987240829346093 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 1.0 60 0.0 61 2.0 62 0.0 63 2.0 64 1.0 65 1.0 66 2.0 67 0.0 68 0.0 69 2.0 70 2.0 71 8.0 72 11.0 73 74.0 74 260.0 75 995.0 76 2637.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.56814114037331 96.375 2 1.048325236512401 2.0500000000000003 3 0.2045512656609563 0.6 4 0.10227563283047815 0.4 5 0.051137816415239075 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025568908207619537 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 13 0.325 No Hit CGAGGATCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCA 5 0.125 No Hit CTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261831 spots for SRR18888527.sra Written 2261831 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra Read 2261819 spots for SRR18888527.sra Written 2261819 spots for SRR18888527.sra SRR ids: ['SRR18888527.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6yu52zhm SRR18888527.sra spots: 45236392 blocks: [[1, 2261819], [2261820, 4523638], [4523639, 6785457], [6785458, 9047276], [9047277, 11309095], [11309096, 13570914], [13570915, 15832733], [15832734, 18094552], [18094553, 20356371], [20356372, 22618190], [22618191, 24880009], [24880010, 27141828], [27141829, 29403647], [29403648, 31665466], [31665467, 33927285], [33927286, 36189104], [36189105, 38450923], [38450924, 40712742], [40712743, 42974561], [42974562, 45236392]] SRR18888527 file size 8635102 SRR18888527 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18888527 SRR18888527_1.fastq SRR18888527_2.fastq Input file: SRR18888527_1.fastq Paired file: SRR18888527_2.fastq trimmed: SRR18888527-trimmed-pair1.fastq, SRR18888527-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:19:35 2024 >> started Tue Dec 10 05:20:12 2024 >> done (37.512s) 45236392 read pairs processed; of these: 9 ( 0.00%) short read pairs filtered out after trimming by size control 6581 ( 0.01%) empty read pairs filtered out after trimming by size control 45229802 (99.99%) read pairs available; of these: 193167 ( 0.43%) trimmed read pairs available after processing 45036635 (99.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 6 0.00% 21 3 0.00% 22 28 0.00% 23 64 0.00% 24 91 0.00% 25 141 0.00% 26 130 0.00% 27 173 0.00% 28 252 0.00% 29 294 0.00% 30 346 0.00% 31 852 0.00% 32 1087 0.00% 33 482 0.00% 34 1402 0.00% 35 772 0.00% 36 940 0.00% 37 1053 0.00% 38 1055 0.00% 39 1147 0.00% 40 1299 0.00% 41 1398 0.00% 42 1478 0.00% 43 1607 0.00% 44 1686 0.00% 45 1854 0.00% 46 1897 0.00% 47 2236 0.00% 48 2262 0.01% 49 2607 0.01% 50 2719 0.01% 51 3230 0.01% 52 3637 0.01% 53 3938 0.01% 54 4016 0.01% 55 4562 0.01% 56 4900 0.01% 57 5246 0.01% 58 5984 0.01% 59 6525 0.01% 60 7124 0.02% 61 7740 0.02% 62 8653 0.02% 63 9514 0.02% 64 10512 0.02% 65 11291 0.02% 66 12598 0.03% 67 13955 0.03% 68 14719 0.03% 69 17202 0.04% 70 22543 0.05% 71 28256 0.06% 72 50828 0.11% 73 358994 0.79% 74 3300118 7.30% 75 20735308 45.84% 76 20547045 45.43% 45229802 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=6.90 fanout-score-rank=28 prefix-density=0.22 prefix-fanout=4.2 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=321.93 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=16.6 sequence=GCGGCGGCGGAGG criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=124.27 fanout-score-rank=18 prefix-density=1.56 prefix-fanout=19.2 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=417.18 fanout-score-rank=1 prefix-density=1.33 prefix-fanout=21.0 sequence=CCGCCGCCGCCC SRR18888527 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:21:04 Started mapping on | Dec 10 05:21:04 Finished on | Dec 10 05:24:48 Mapping speed, Million of reads per hour | 726.91 Number of input reads | 45229802 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 36125449 Uniquely mapped reads % | 79.87% Average mapped length | 150.43 Number of splices: Total | 16732205 Number of splices: Annotated (sjdb) | 15924407 Number of splices: GT/AG | 16510300 Number of splices: GC/AG | 189517 Number of splices: AT/AC | 11617 Number of splices: Non-canonical | 20771 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 1.80 Insertion rate per base | 0.01% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1950336 % of reads mapped to multiple loci | 4.31% Number of reads mapped to too many loci | 1383250 % of reads mapped to too many loci | 3.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.69% % of reads unmapped: other | 7.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7154021 7154021 7154021 N_multimapping 1950336 1950336 1950336 N_noFeature 1037784 35080785 1596699 N_ambiguous 651137 5038 177148 UnstrandedReadsAssigned:34436528 PositiveStrandReadsAssigned:1039626 NegativeStrandReadsAssigned:34351602 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR18888527 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18888527-trimmed-pair1.fastq SRR18888527-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 45,229,802 reads, 36,456,651 reads pseudoaligned [quant] estimated average fragment length: 160.709 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52973 SRR18888527.ke.tsv 35125 SRR18888527.se.tsv 88098 total ==> SRR18888527.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 776.437 0 0 PNS24247 1044 884.291 39.742 1.80565 PNS24249 1928 1768.29 685.485 15.5749 PNS24246 1044 884.291 39.742 1.80565 PNS24248 1044 884.291 39.742 1.80565 PNS24244 1471 1311.29 29.2895 0.897413 PNS24243 293 139.833 0 0 KQK14069 1603 1443.29 4916.69 136.867 KQK14071 474 315.669 792.972 100.927 ==> SRR18888527.se.tsv <== BRADI_1g14170v3 6320 BRADI_1g53295v3 12 BRADI_1g59795v3 461 BRADI_1g07683v3 0 BRADI_1g00485v3 78 BRADI_1g20270v3 4559 BRADI_1g74790v3 141 BRADI_1g09890v3 0 BRADI_1g77505v3 823 BRADI_1g48960v3 3 SRR18888527 completed mapping pipeline successfully