Starting /dee2/code/volunteer_pipeline.sh SRR18888528 current disk space = 1525996351488 free memory = 1572498340 SRR18888528 SRAfilesize 3c8d509002cbc3716b45e5bcbd5a498a SRR18888528.sra SRR18888528.sra file validated SRR18888528 is paired end SRR18888528 is conventional basespace SRR18888528 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18888528_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2125 32.0 32.0 32.0 32.0 32.0 2 31.3585 32.0 32.0 32.0 32.0 32.0 3 31.4595 32.0 32.0 32.0 32.0 32.0 4 31.4965 32.0 32.0 32.0 32.0 32.0 5 31.5245 32.0 32.0 32.0 32.0 32.0 6 34.685 36.0 36.0 36.0 32.0 36.0 7 34.89825 36.0 36.0 36.0 36.0 36.0 8 34.796 36.0 36.0 36.0 32.0 36.0 9 34.9815 36.0 36.0 36.0 32.0 36.0 10-11 34.841375 36.0 36.0 36.0 32.0 36.0 12-13 34.890375000000006 36.0 36.0 36.0 32.0 36.0 14-15 34.80825 36.0 36.0 36.0 32.0 36.0 16-17 34.95975 36.0 36.0 36.0 32.0 36.0 18-19 34.866249999999994 36.0 36.0 36.0 32.0 36.0 20-21 34.864125 36.0 36.0 36.0 32.0 36.0 22-23 34.798 36.0 36.0 36.0 32.0 36.0 24-25 34.741125 36.0 36.0 36.0 32.0 36.0 26-27 34.764624999999995 36.0 36.0 36.0 32.0 36.0 28-29 34.620625000000004 36.0 36.0 36.0 32.0 36.0 30-31 34.681375 36.0 36.0 36.0 32.0 36.0 32-33 34.53875 36.0 36.0 36.0 32.0 36.0 34-35 34.552375 36.0 36.0 36.0 32.0 36.0 36-37 34.58260325406758 36.0 36.0 36.0 32.0 36.0 38-39 34.56720901126408 36.0 36.0 36.0 32.0 36.0 40-41 34.539019906830944 36.0 36.0 36.0 32.0 36.0 42-43 34.517038336256576 36.0 36.0 36.0 32.0 36.0 44-45 34.439614131796546 36.0 36.0 36.0 32.0 36.0 46-47 34.39551490854422 36.0 36.0 36.0 32.0 36.0 48-49 34.44391993514229 36.0 36.0 36.0 32.0 36.0 50-51 34.455562507276156 36.0 36.0 36.0 32.0 36.0 52-53 34.41160982948847 36.0 36.0 36.0 32.0 36.0 54-55 34.442774056171025 36.0 36.0 36.0 32.0 36.0 56-57 34.31157419030882 36.0 36.0 36.0 32.0 36.0 58-59 34.32420894023104 36.0 36.0 36.0 32.0 36.0 60-61 34.27642128081978 36.0 36.0 36.0 32.0 36.0 62-63 34.35628821675789 36.0 36.0 36.0 32.0 36.0 64-65 34.268267276615674 36.0 36.0 36.0 32.0 36.0 66-67 34.22835933568193 36.0 36.0 36.0 32.0 36.0 68-69 34.1834940197406 36.0 36.0 36.0 32.0 36.0 70-71 34.186109064432614 36.0 36.0 36.0 32.0 36.0 72-73 34.214571443399564 36.0 36.0 36.0 32.0 36.0 74-75 34.024912046482754 36.0 36.0 36.0 32.0 36.0 76 33.756439393939395 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 4.0 21 5.0 22 10.0 23 19.0 24 11.0 25 27.0 26 17.0 27 27.0 28 56.0 29 62.0 30 98.0 31 137.0 32 163.0 33 278.0 34 658.0 35 2423.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.16316316316316 9.65965965965966 9.934934934934935 42.24224224224224 2 20.145145145145147 13.338338338338337 31.08108108108108 35.43543543543544 3 22.57257257257257 16.74174174174174 18.993993993993993 41.69169169169169 4 28.803803803803802 22.74774774774775 17.86786786786787 30.58058058058058 5 26.876876876876878 27.55255255255255 20.92092092092092 24.64964964964965 6 24.9685692733216 30.626100075433744 21.9260749308524 22.479255720392256 7 19.544544544544546 24.64964964964965 34.53453453453454 21.27127127127127 8 22.27227227227227 22.972972972972975 29.27927927927928 25.475475475475474 9 22.722722722722725 21.62162162162162 30.255255255255253 25.400400400400404 10-11 24.374374374374376 28.966466466466468 22.81031031031031 23.84884884884885 12-13 24.01151151151151 22.985485485485484 25.575575575575577 27.427427427427425 14-15 22.813164810411713 24.114628957577274 26.955324740332877 26.11688149167814 16-17 24.224224224224226 24.2992992992993 25.400400400400404 26.076076076076077 18-19 23.5985985985986 24.86236236236236 25.38788788788789 26.151151151151154 20-21 24.66216216216216 24.66216216216216 24.687187187187188 25.988488488488485 22-23 25.788288288288285 24.11161161161161 24.61211211211211 25.487987987987985 24-25 24.987487487487485 24.94994994994995 24.224224224224226 25.83833833833834 26-27 24.90301589287949 23.814291077462144 25.078212989613313 26.204480040045052 28-29 24.20525657071339 23.90488110137672 24.80600750938673 27.083854818523157 30-31 24.46196196196196 24.06156156156156 24.93743743743744 26.539039039039036 32-33 24.956195244055067 23.554443053817273 24.881101376720903 26.608260325406757 34-35 24.84355444305382 24.90613266583229 23.92991239048811 26.320400500625784 36-37 24.73400926273626 24.35849292777569 23.632494680185253 27.275003129302792 38-39 24.09261576971214 25.36921151439299 24.30538172715895 26.23279098873592 40-41 24.082654978083905 25.209768315591734 22.642454602379463 28.065122103944894 42-43 25.620145326985718 24.592833876221498 23.715860686544726 26.07116011024806 44-45 24.880982209972437 25.068905036331746 23.653219744424955 26.396893009270862 46-47 24.668003006765222 24.354798296166376 23.991480831871712 26.98571786519669 48-49 25.517241379310345 24.978056426332287 23.059561128526646 26.445141065830718 50-51 25.435627428857966 24.683464961765075 23.6931177134261 26.187789895950857 52-53 24.88716148445336 25.70210631895687 22.968906720160483 26.441825476429287 54-55 25.00940674777374 24.8965257744889 23.692462059450644 26.401605418286717 56-57 24.529249309565653 25.508410745669092 23.047953803665578 26.914386141099673 58-59 24.41290970739671 25.857089036795177 23.30779856837875 26.42220268742936 60-61 24.22414876240734 25.078527453197637 23.658751099384347 27.03857268501068 62-63 24.644966695990952 25.235641573457336 23.35050898579867 26.768882744753046 64-65 25.64457300968432 25.31757011696642 22.877625455917496 26.160231417431767 66-67 24.106693507800706 25.54101660795169 23.125314544539506 27.226975339708105 68-69 25.462788061956932 25.676866893338367 22.994585064853293 25.865759979851404 70-71 24.962197580645164 25.34022177419355 23.172883064516128 26.524697580645164 72-73 25.64783213247377 25.015800783718873 22.689925420300845 26.646441663506508 74-75 26.0184319487111 22.62588486710298 24.161880593027917 27.193802591158008 76 29.545454545454547 0.0 31.553030303030305 38.901515151515156 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 34.0 1 18.5 2 2.5 3 4.5 4 7.0 5 4.5 6 2.0 7 2.5 8 3.0 9 4.0 10 7.5 11 10.5 12 11.0 13 7.5 14 4.5 15 3.0 16 1.0 17 1.5 18 1.0 19 0.5 20 2.0 21 2.0 22 0.5 23 1.5 24 3.5 25 4.0 26 5.0 27 6.5 28 7.0 29 9.0 30 14.5 31 17.5 32 22.0 33 26.5 34 35.0 35 48.5 36 62.0 37 77.5 38 93.0 39 117.0 40 127.5 41 139.0 42 152.0 43 155.0 44 177.5 45 190.0 46 191.5 47 195.0 48 196.0 49 192.0 50 181.5 51 172.5 52 161.0 53 160.5 54 161.5 55 156.5 56 143.5 57 122.5 58 118.0 59 122.0 60 109.0 61 101.5 62 100.5 63 92.5 64 94.5 65 91.0 66 85.5 67 84.0 68 75.0 69 68.0 70 58.5 71 51.0 72 61.0 73 65.0 74 54.0 75 44.5 76 35.0 77 24.5 78 22.0 79 24.0 80 19.0 81 12.5 82 8.5 83 7.5 84 7.5 85 4.0 86 1.0 87 0.0 88 0.0 89 1.5 90 2.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.1 5 0.1 6 0.575 7 0.1 8 0.1 9 0.1 10-11 0.1 12-13 0.1 14-15 0.11249999999999999 16-17 0.1 18-19 0.1 20-21 0.1 22-23 0.1 24-25 0.1 26-27 0.11249999999999999 28-29 0.125 30-31 0.1 32-33 0.125 34-35 0.125 36-37 0.012515644555694618 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.07517854905400326 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.012556504269211453 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.026705835224996664 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 5.0 36 0.0 37 0.0 38 0.0 39 2.0 40 1.0 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 1.0 50 1.0 51 0.0 52 0.0 53 0.0 54 3.0 55 2.0 56 0.0 57 1.0 58 0.0 59 2.0 60 1.0 61 0.0 62 1.0 63 2.0 64 1.0 65 1.0 66 0.0 67 2.0 68 3.0 69 0.0 70 2.0 71 5.0 72 13.0 73 73.0 74 263.0 75 973.0 76 2640.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.125 #Duplication Level Percentage of deduplicated Percentage of total 1 97.97139141742522 94.175 2 1.2223667100130038 2.35 3 0.41612483745123535 1.2 4 0.23407022106631986 0.8999999999999999 5 0.10403120936280884 0.5 6 0.02600780234070221 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02600780234070221 0.7250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 29 0.7250000000000001 No Hit GCCGCAGGCTCCACGCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTT 6 0.15 No Hit CTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATT 5 0.125 No Hit CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA 5 0.125 No Hit CCCATGCTAATGTATCCAGAGCGATGGCTTGCTTTGAGCACTCTAATTTC 5 0.125 No Hit GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACTAGGCATTCCTCGTTGAAGACCAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.025 57 0.0 0.0 0.0 0.0 0.025 58 0.0 0.0 0.0 0.0 0.025 59 0.0 0.0 0.0 0.0 0.025 60 0.0 0.0 0.0 0.0 0.025 61 0.0 0.0 0.0 0.0 0.025 62 0.025 0.0 0.0 0.0 0.025 63 0.025 0.0 0.0 0.0 0.025 64 0.025 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18888528 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18888528_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.5885 32.0 32.0 32.0 32.0 32.0 2 30.274 32.0 32.0 32.0 21.0 32.0 3 30.43375 32.0 32.0 32.0 32.0 32.0 4 30.46975 32.0 32.0 32.0 32.0 32.0 5 30.42925 32.0 32.0 32.0 32.0 32.0 6 33.8585 36.0 36.0 36.0 32.0 36.0 7 33.673 36.0 36.0 36.0 21.0 36.0 8 33.41075 36.0 36.0 36.0 21.0 36.0 9 33.6865 36.0 36.0 36.0 32.0 36.0 10-11 33.542249999999996 36.0 36.0 36.0 24.0 36.0 12-13 33.472125000000005 36.0 36.0 36.0 27.0 36.0 14-15 33.3915 36.0 36.0 36.0 21.0 36.0 16-17 33.422 36.0 36.0 36.0 21.0 36.0 18-19 33.360375000000005 36.0 36.0 36.0 21.0 36.0 20-21 33.4685 36.0 36.0 36.0 27.0 36.0 22-23 33.732124999999996 36.0 36.0 36.0 32.0 36.0 24-25 33.500125 36.0 36.0 36.0 26.5 36.0 26-27 33.318 36.0 36.0 36.0 21.0 36.0 28-29 33.214875000000006 36.0 36.0 36.0 21.0 36.0 30-31 33.352125 36.0 36.0 36.0 24.0 36.0 32-33 33.469625 36.0 36.0 36.0 27.0 36.0 34-35 33.3645 36.0 36.0 36.0 24.0 36.0 36-37 33.26244061015254 36.0 36.0 36.0 17.5 36.0 38-39 33.4558639659915 36.0 36.0 36.0 24.0 36.0 40-41 33.331041511864626 36.0 36.0 36.0 21.0 36.0 42-43 33.372715894868584 36.0 36.0 36.0 21.0 36.0 44-45 33.33041301627034 36.0 36.0 36.0 17.5 36.0 46-47 33.40450563204005 36.0 36.0 36.0 21.0 36.0 48-49 33.266599398471925 36.0 36.0 36.0 17.5 36.0 50-51 33.44145221321682 36.0 36.0 36.0 21.0 36.0 52-53 33.34594188376754 36.0 36.0 36.0 21.0 36.0 54-55 33.354066053892694 36.0 36.0 36.0 21.0 36.0 56-57 33.40305994482067 36.0 36.0 36.0 21.0 36.0 58-59 33.10373808329152 36.0 36.0 36.0 17.5 36.0 60-61 33.224565378007135 36.0 36.0 36.0 21.0 36.0 62-63 33.27817435430046 36.0 36.0 36.0 17.5 36.0 64-65 33.058678126782 36.0 36.0 36.0 14.0 36.0 66-67 33.19136613748369 36.0 36.0 36.0 17.5 36.0 68-69 33.14425012825629 36.0 36.0 36.0 17.5 36.0 70-71 32.94651134769583 36.0 36.0 36.0 17.5 36.0 72-73 33.12573880112491 36.0 36.0 36.0 17.5 36.0 74-75 33.27659291323561 36.0 36.0 36.0 21.0 36.0 76 32.64761188416698 36.0 36.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 14.0 15 15.0 16 12.0 17 17.0 18 19.0 19 15.0 20 24.0 21 24.0 22 25.0 23 31.0 24 31.0 25 51.0 26 62.0 27 63.0 28 82.0 29 113.0 30 123.0 31 168.0 32 224.0 33 310.0 34 648.0 35 1929.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.29503261414952 14.952333166081285 11.465127947817361 39.287506271951834 2 24.15 25.424999999999997 25.474999999999998 24.95 3 25.324999999999996 25.35 20.275000000000002 29.049999999999997 4 28.299999999999997 27.500000000000004 17.424999999999997 26.775 5 29.025000000000002 28.475 18.7 23.799999999999997 6 24.05 33.875 18.375 23.7 7 23.724999999999998 18.075 30.075000000000003 28.125 8 22.7977977977978 22.22222222222222 22.972972972972975 32.007007007007005 9 25.05 21.875 26.224999999999998 26.85 10-11 26.440805100637583 28.491061382672832 19.289911238904864 25.778222277784725 12-13 28.075 22.175 22.75 27.0 14-15 25.275 25.912499999999998 23.5875 25.224999999999998 16-17 26.686694204531232 23.745149580673424 23.14432344473651 26.42383277005883 18-19 26.427855711422843 23.647294589178355 23.196392785571142 26.728456913827653 20-21 25.775387693846923 24.68734367183592 23.936968484242122 25.60030015007504 22-23 26.2125 24.775 23.4875 25.525 24-25 26.15980992872327 24.134050268850817 23.17118919594848 26.53495060647743 26-27 25.52871980978601 26.066825178325615 22.863221123764234 25.541233888124136 28-29 25.946827188362175 26.122397792826686 22.510659643842487 25.42011537496865 30-31 25.86293146573287 25.11255627813907 22.136068034017008 26.88844422211106 32-33 27.081770442610654 24.85621405351338 23.305826456614152 24.756189047261813 34-35 26.25656414103526 25.70642660665166 22.43060765191298 25.6064016004001 36-37 25.106329747310486 25.2064048036027 23.267450587940957 26.419814861145856 38-39 25.6198347107438 25.156523916854496 23.37841222138743 25.845229151014276 40-41 27.312609676610677 24.479819503634996 22.3614941087992 25.846076710955128 42-43 25.119196988707653 25.897114178168128 22.685069008782936 26.29861982434128 44-45 25.78017295400426 25.11592931445043 23.73731043990475 25.366587291640556 46-47 25.85775106436263 25.381918357124967 22.65214124718257 26.10818933132983 48-49 25.593071419605874 25.16631103301117 23.082716204342915 26.15790134304004 50-51 26.72435415099072 25.670930524203662 22.20968146476047 25.395033860045146 52-53 26.42857142857143 24.837092731829575 23.42105263157895 25.31328320802005 54-55 26.688384914171152 24.708683122415735 23.054755043227665 25.54817692018544 56-57 26.04767879548306 25.99749058971142 22.685069008782936 25.269761606022584 58-59 27.32075471698113 25.270440251572328 22.57861635220126 24.830188679245282 60-61 25.89049716803021 24.97168030207678 23.41095028319698 25.726872246696036 62-63 25.273481705016977 25.537533006412676 23.73946938262291 25.44951590594744 64-65 26.26351521247171 24.9057078199648 23.14558712597435 25.68518984158914 66-67 26.254243681629575 25.91474915126367 22.444360618634477 25.386646548472275 68-69 26.76233635448137 25.239174219536757 23.036253776435046 24.962235649546827 70-71 27.195860676426047 24.823321554770317 22.53912165572943 25.4416961130742 72-73 26.850912778904668 25.36764705882353 22.68002028397566 25.101419878296145 74-75 27.11028137084945 22.776370182691025 23.176423523136418 26.936924923323108 76 28.506957502820608 0.0 34.03535163595336 37.45769086122602 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 14.0 1 13.5 2 11.0 3 8.5 4 8.0 5 7.0 6 5.0 7 6.5 8 9.0 9 8.5 10 9.0 11 10.0 12 10.0 13 8.0 14 3.5 15 2.5 16 2.5 17 0.5 18 3.0 19 3.0 20 1.0 21 2.0 22 2.0 23 1.0 24 1.0 25 2.5 26 2.5 27 2.5 28 5.0 29 9.0 30 11.0 31 14.5 32 19.0 33 22.0 34 34.5 35 50.0 36 55.0 37 57.5 38 84.5 39 110.5 40 123.5 41 139.0 42 146.5 43 155.5 44 161.5 45 165.0 46 175.5 47 191.5 48 199.5 49 191.5 50 188.0 51 177.5 52 162.5 53 153.0 54 146.0 55 139.5 56 133.5 57 135.0 58 140.5 59 132.0 60 118.5 61 112.5 62 104.5 63 104.5 64 95.0 65 95.0 66 96.0 67 88.0 68 88.0 69 89.0 70 73.5 71 57.5 72 61.5 73 68.5 74 61.0 75 45.0 76 37.0 77 34.5 78 25.0 79 15.5 80 15.5 81 13.0 82 10.0 83 8.5 84 6.5 85 3.5 86 2.0 87 1.0 88 0.5 89 0.5 90 2.0 91 2.0 92 1.0 93 1.0 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.1 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.13749999999999998 18-19 0.2 20-21 0.05 22-23 0.0 24-25 0.0375 26-27 0.11249999999999999 28-29 0.325 30-31 0.05 32-33 0.025 34-35 0.025 36-37 0.05001250312578145 38-39 0.15003750937734434 40-41 0.18766420618040786 42-43 0.2503128911138924 44-45 0.1376720901126408 46-47 0.05006257822277847 48-49 0.2753786456377519 50-51 0.1377582968065122 52-53 0.0501002004008016 54-55 0.0 56-57 0.05016302984700275 58-59 0.27596588058203714 60-61 0.2761390736789256 62-63 0.12558081125204068 64-65 0.037702651753173305 66-67 0.0 68-69 0.03775009437523594 70-71 0.22664316293125158 72-73 0.24029341090173262 74-75 0.026663111585121982 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 2.0 40 1.0 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 1.0 50 1.0 51 0.0 52 0.0 53 0.0 54 3.0 55 2.0 56 0.0 57 1.0 58 0.0 59 2.0 60 1.0 61 1.0 62 1.0 63 2.0 64 1.0 65 1.0 66 1.0 67 1.0 68 3.0 69 0.0 70 2.0 71 6.0 72 21.0 73 58.0 74 269.0 75 957.0 76 2659.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.18507157464212 96.025 2 1.5081799591002045 2.9499999999999997 3 0.2044989775051125 0.6 4 0.07668711656441718 0.3 5 0.025562372188139063 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935441 spots for SRR18888528.sra Written 1935441 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra Read 1935427 spots for SRR18888528.sra Written 1935427 spots for SRR18888528.sra SRR ids: ['SRR18888528.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dxpy6db0 SRR18888528.sra spots: 38708554 blocks: [[1, 1935427], [1935428, 3870854], [3870855, 5806281], [5806282, 7741708], [7741709, 9677135], [9677136, 11612562], [11612563, 13547989], [13547990, 15483416], [15483417, 17418843], [17418844, 19354270], [19354271, 21289697], [21289698, 23225124], [23225125, 25160551], [25160552, 27095978], [27095979, 29031405], [29031406, 30966832], [30966833, 32902259], [32902260, 34837686], [34837687, 36773113], [36773114, 38708554]] SRR18888528 file size 7378962 SRR18888528 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18888528 SRR18888528_1.fastq SRR18888528_2.fastq Input file: SRR18888528_1.fastq Paired file: SRR18888528_2.fastq trimmed: SRR18888528-trimmed-pair1.fastq, SRR18888528-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:18:58 2024 >> started Tue Dec 10 05:19:29 2024 >> done (30.155s) 38708554 read pairs processed; of these: 5 ( 0.00%) short read pairs filtered out after trimming by size control 46864 ( 0.12%) empty read pairs filtered out after trimming by size control 38661685 (99.88%) read pairs available; of these: 57895 ( 0.15%) trimmed read pairs available after processing 38603790 (99.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 4 0.00% 22 44 0.00% 23 99 0.00% 24 144 0.00% 25 253 0.00% 26 284 0.00% 27 289 0.00% 28 362 0.00% 29 505 0.00% 30 610 0.00% 31 1768 0.00% 32 1950 0.01% 33 913 0.00% 34 2667 0.01% 35 1406 0.00% 36 1675 0.00% 37 1738 0.00% 38 1874 0.00% 39 2082 0.01% 40 2345 0.01% 41 2500 0.01% 42 2617 0.01% 43 2873 0.01% 44 2866 0.01% 45 3071 0.01% 46 3289 0.01% 47 3640 0.01% 48 3845 0.01% 49 4373 0.01% 50 4421 0.01% 51 5020 0.01% 52 5599 0.01% 53 5980 0.02% 54 6273 0.02% 55 6856 0.02% 56 7229 0.02% 57 7782 0.02% 58 8559 0.02% 59 9042 0.02% 60 10049 0.03% 61 10639 0.03% 62 11831 0.03% 63 13161 0.03% 64 14115 0.04% 65 14999 0.04% 66 16318 0.04% 67 17554 0.05% 68 18722 0.05% 69 20983 0.05% 70 26694 0.07% 71 31014 0.08% 72 50768 0.13% 73 312701 0.81% 74 2735366 7.08% 75 17423642 45.07% 76 17816278 46.08% 38661685 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=7.47 fanout-score-rank=20 prefix-density=0.22 prefix-fanout=4.4 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=12 fanout-score=221.01 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=22.9 sequence=CGCCGCCGCCGG criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=126.38 fanout-score-rank=16 prefix-density=1.45 prefix-fanout=18.7 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=369.66 fanout-score-rank=1 prefix-density=1.24 prefix-fanout=19.2 sequence=GCCGCCGCCGCT SRR18888528 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:28:23 Started mapping on | Dec 10 05:28:24 Finished on | Dec 10 05:31:49 Mapping speed, Million of reads per hour | 678.94 Number of input reads | 38661685 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 29687574 Uniquely mapped reads % | 76.79% Average mapped length | 150.29 Number of splices: Total | 13317816 Number of splices: Annotated (sjdb) | 12669039 Number of splices: GT/AG | 13138967 Number of splices: GC/AG | 151973 Number of splices: AT/AC | 9793 Number of splices: Non-canonical | 17083 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 1.81 Insertion rate per base | 0.01% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1985645 % of reads mapped to multiple loci | 5.14% Number of reads mapped to too many loci | 1611821 % of reads mapped to too many loci | 4.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.49% % of reads unmapped: other | 9.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6988470 6988470 6988470 N_multimapping 1985645 1985645 1985645 N_noFeature 978163 28716537 1551400 N_ambiguous 547757 4888 160742 UnstrandedReadsAssigned:28161654 PositiveStrandReadsAssigned:966149 NegativeStrandReadsAssigned:27975432 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR18888528 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18888528-trimmed-pair1.fastq SRR18888528-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,661,685 reads, 29,682,799 reads pseudoaligned [quant] estimated average fragment length: 155.368 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52973 SRR18888528.ke.tsv 35125 SRR18888528.se.tsv 88098 total ==> SRR18888528.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 781.795 0 0 PNS24247 1044 889.632 53.1671 2.92703 PNS24249 1928 1773.63 558.3 15.4169 PNS24246 1044 889.632 53.1671 2.92703 PNS24248 1044 889.632 53.1671 2.92703 PNS24244 1471 1316.63 44.1984 1.64413 PNS24243 293 143.911 0 0 KQK14069 1603 1448.63 759.409 25.6751 KQK14071 474 320.906 212.226 32.3903 ==> SRR18888528.se.tsv <== BRADI_1g14170v3 1237 BRADI_1g53295v3 20 BRADI_1g59795v3 492 BRADI_1g07683v3 0 BRADI_1g00485v3 56 BRADI_1g20270v3 3446 BRADI_1g74790v3 74 BRADI_1g09890v3 0 BRADI_1g77505v3 637 BRADI_1g48960v3 2 SRR18888528 completed mapping pipeline successfully