Starting /dee2/code/volunteer_pipeline.sh SRR18888529 current disk space = 1525991485440 free memory = 1558881952 SRR18888529 SRAfilesize 0e2ac0847be9f848c2c009a45b0beab7 SRR18888529.sra SRR18888529.sra file validated SRR18888529 is paired end SRR18888529 is conventional basespace SRR18888529 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18888529_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.345 32.0 32.0 32.0 32.0 32.0 2 31.4955 32.0 32.0 32.0 32.0 32.0 3 31.5955 32.0 32.0 32.0 32.0 32.0 4 31.498 32.0 32.0 32.0 32.0 32.0 5 31.5425 32.0 32.0 32.0 32.0 32.0 6 34.95325 36.0 36.0 36.0 36.0 36.0 7 34.936 36.0 36.0 36.0 36.0 36.0 8 34.90975 36.0 36.0 36.0 32.0 36.0 9 34.91825 36.0 36.0 36.0 32.0 36.0 10-11 34.831625 36.0 36.0 36.0 32.0 36.0 12-13 34.968125 36.0 36.0 36.0 34.0 36.0 14-15 34.947 36.0 36.0 36.0 32.0 36.0 16-17 35.05675 36.0 36.0 36.0 34.0 36.0 18-19 34.9405 36.0 36.0 36.0 32.0 36.0 20-21 34.898875000000004 36.0 36.0 36.0 32.0 36.0 22-23 34.837625 36.0 36.0 36.0 32.0 36.0 24-25 34.77025 36.0 36.0 36.0 32.0 36.0 26-27 34.708875 36.0 36.0 36.0 32.0 36.0 28-29 34.785 36.0 36.0 36.0 32.0 36.0 30-31 34.647625 36.0 36.0 36.0 32.0 36.0 32-33 34.646875 36.0 36.0 36.0 32.0 36.0 34-35 34.586375000000004 36.0 36.0 36.0 32.0 36.0 36-37 34.533391695847925 36.0 36.0 36.0 32.0 36.0 38-39 34.42933966983492 36.0 36.0 36.0 32.0 36.0 40-41 34.50887943971986 36.0 36.0 36.0 32.0 36.0 42-43 34.606623739690704 36.0 36.0 36.0 32.0 36.0 44-45 34.42894671003252 36.0 36.0 36.0 32.0 36.0 46-47 34.443193193193196 36.0 36.0 36.0 32.0 36.0 48-49 34.443568568568566 36.0 36.0 36.0 32.0 36.0 50-51 34.39489489489489 36.0 36.0 36.0 32.0 36.0 52-53 34.315190190190194 36.0 36.0 36.0 32.0 36.0 54-55 34.30784213500108 36.0 36.0 36.0 32.0 36.0 56-57 34.29757135703555 36.0 36.0 36.0 32.0 36.0 58-59 34.2537247046058 36.0 36.0 36.0 32.0 36.0 60-61 34.21181284518423 36.0 36.0 36.0 32.0 36.0 62-63 34.17481203007519 36.0 36.0 36.0 32.0 36.0 64-65 34.283140779642764 36.0 36.0 36.0 32.0 36.0 66-67 34.157630522088354 36.0 36.0 36.0 32.0 36.0 68-69 34.15446074151062 36.0 36.0 36.0 32.0 36.0 70-71 34.0310496705984 36.0 36.0 36.0 32.0 36.0 72-73 34.006076701614234 36.0 36.0 36.0 32.0 36.0 74-75 34.073462797166954 36.0 36.0 36.0 32.0 36.0 76 33.79245283018868 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 0.0 21 2.0 22 13.0 23 21.0 24 14.0 25 25.0 26 24.0 27 46.0 28 47.0 29 41.0 30 93.0 31 120.0 32 196.0 33 303.0 34 625.0 35 2426.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.79189594797399 9.929964982491246 10.105052526263131 46.17308654327164 2 19.70985492746373 12.756378189094548 32.91645822911456 34.61730865432716 3 21.785892946473236 15.332666333166584 19.759879939969984 43.1215607803902 4 27.913956978489246 23.036518259129565 17.10855427713857 31.94097048524262 5 27.288644322161083 25.26263131565783 22.536268134067033 24.912456228114056 6 23.971915747241727 30.140421263791374 22.49247743229689 23.395185556670008 7 18.78439219609805 24.462231115557778 35.19259629814908 21.5607803901951 8 21.360680340170084 22.71135567783892 28.864432216108053 27.063531765882942 9 21.98599299649825 21.085542771385693 31.915957978989496 25.012506253126567 10-11 23.774387193596798 28.4392196098049 23.724362181090545 24.062031015507753 12-13 24.862431215607803 22.28614307153577 26.475737868934466 26.375687843921963 14-15 24.274637318659327 24.637318659329665 25.912956478239117 25.175087543771884 16-17 24.249624812406203 24.474737368684345 25.18759379689845 26.088044022011005 18-19 24.64982491245623 24.337168584292147 24.72486243121561 26.28814407203602 20-21 23.961980990495245 25.03751875937969 25.65032516258129 25.350175087543768 22-23 25.137568784392194 23.799399699849925 25.30015007503752 25.76288144072036 24-25 25.100050025012504 24.112056028014006 24.374687343671837 26.413206603301653 26-27 24.387193596798397 25.0 24.72486243121561 25.887943971985994 28-29 25.962981490745374 24.149574787393696 24.524762381190595 25.362681340670335 30-31 24.349674837418707 24.437218609304654 24.81240620310155 26.40070035017509 32-33 23.71185592796398 25.100050025012504 24.54977488744372 26.638319159579787 34-35 24.787393696848426 24.73736868434217 25.11255627813907 25.362681340670335 36-37 25.987993996998497 24.19959979989995 23.82441220610305 25.987993996998497 38-39 25.30015007503752 24.974987493746873 24.062031015507753 25.662831415707853 40-41 24.349674837418707 25.050025012506254 23.836918459229615 26.76338169084542 42-43 24.940587867417136 25.403377110694187 23.777360850531583 25.878674171357098 44-45 24.818613960470355 25.469101826369776 23.78033525143858 25.93194896172129 46-47 24.88738738738739 25.33783783783784 23.26076076076076 26.514014014014016 48-49 24.383527350106394 25.62273125547628 23.14432344473651 26.84941794968081 50-51 24.94994994994995 25.225225225225223 23.373373373373376 26.45145145145145 52-53 25.075075075075077 25.900900900900904 23.0980980980981 25.925925925925924 54-55 24.02703040921036 25.378550869728443 24.014516330872233 26.579902390188963 56-57 24.661992989484226 25.43815723585378 23.823234852278418 26.076614922383573 58-59 24.53350031308704 25.773324984345646 23.068252974326864 26.62492172824045 60-61 24.3141676061631 26.2557935613178 23.22435174746336 26.205687085055747 62-63 24.523809523809522 25.38847117794486 24.072681704260653 26.015037593984964 64-65 24.614420062695924 26.169278996865202 23.648902821316614 25.56739811912226 66-67 24.962349397590362 25.27610441767068 23.895582329317268 25.865963855421686 68-69 24.852442546778853 24.651513248775586 23.408263217380384 27.087780987065173 70-71 24.81458202388435 25.46825895663105 23.70835952231301 26.00879949717159 72-73 25.483015532264176 25.078924106579116 22.477585553731533 26.96047480742518 74-75 25.986047759592168 22.457740810303193 24.040783471961362 27.515427958143277 76 29.698113207547173 0.0 30.754716981132074 39.54716981132076 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 23.0 1 12.0 2 1.5 3 1.5 4 1.0 5 1.0 6 2.0 7 3.0 8 3.0 9 3.0 10 7.0 11 14.5 12 18.0 13 11.0 14 7.0 15 7.0 16 4.5 17 5.0 18 3.0 19 1.5 20 2.0 21 2.0 22 2.0 23 2.0 24 1.5 25 2.0 26 3.0 27 5.0 28 7.0 29 8.5 30 9.0 31 13.0 32 22.5 33 31.0 34 38.0 35 51.5 36 65.5 37 73.5 38 92.0 39 117.5 40 128.5 41 150.0 42 176.5 43 183.0 44 184.5 45 188.5 46 193.0 47 193.0 48 215.0 49 203.5 50 176.0 51 172.5 52 165.5 53 161.0 54 151.0 55 145.0 56 129.0 57 108.5 58 101.0 59 116.5 60 125.0 61 104.0 62 87.0 63 87.0 64 94.0 65 94.0 66 82.0 67 73.0 68 70.5 69 70.0 70 64.5 71 59.0 72 55.5 73 50.5 74 50.0 75 49.0 76 38.0 77 31.0 78 23.0 79 11.5 80 11.0 81 11.0 82 10.0 83 7.5 84 4.0 85 3.5 86 2.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.05 5 0.05 6 0.3 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.03753753753753754 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 2.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0 43 0.0 44 0.0 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 1.0 56 0.0 57 1.0 58 1.0 59 0.0 60 1.0 61 1.0 62 0.0 63 1.0 64 3.0 65 2.0 66 0.0 67 2.0 68 1.0 69 3.0 70 1.0 71 10.0 72 15.0 73 97.0 74 256.0 75 949.0 76 2650.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7251402345742 96.8 2 1.0708822029576748 2.1 3 0.12748597654258031 0.375 4 0.025497195308516064 0.1 5 0.0 0.0 6 0.025497195308516064 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025497195308516064 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 19 0.475 No Hit CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.025 38 0.0 0.0 0.0 0.0 0.025 39 0.0 0.0 0.0 0.0 0.025 40 0.0 0.0 0.0 0.0 0.025 41 0.0 0.0 0.0 0.0 0.025 42 0.0 0.0 0.0 0.0 0.025 43 0.0 0.0 0.0 0.0 0.025 44 0.0 0.0 0.0 0.0 0.025 45 0.0 0.0 0.0 0.0 0.025 46 0.0 0.0 0.0 0.0 0.025 47 0.0 0.0 0.0 0.0 0.025 48 0.0 0.0 0.0 0.0 0.025 49 0.0 0.0 0.0 0.0 0.025 50 0.0 0.0 0.0 0.0 0.025 51 0.0 0.0 0.0 0.0 0.025 52 0.0 0.0 0.0 0.0 0.025 53 0.0 0.0 0.0 0.0 0.025 54 0.0 0.0 0.0 0.0 0.025 55 0.0 0.0 0.0 0.0 0.025 56 0.0 0.0 0.0 0.0 0.025 57 0.0 0.0 0.0 0.0 0.025 58 0.0 0.0 0.0 0.0 0.025 59 0.0 0.0 0.0 0.0 0.025 60 0.0 0.0 0.0 0.0 0.025 61 0.0 0.0 0.0 0.0 0.025 62 0.0 0.0 0.0 0.0 0.025 63 0.0 0.0 0.0 0.0 0.025 64 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18888529 read2 length is 42-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18888529_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 42-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.6405 32.0 32.0 32.0 32.0 32.0 2 30.36475 32.0 32.0 32.0 21.0 32.0 3 30.3575 32.0 32.0 32.0 21.0 32.0 4 30.4365 32.0 32.0 32.0 32.0 32.0 5 30.504 32.0 32.0 32.0 32.0 32.0 6 33.76725 36.0 36.0 36.0 32.0 36.0 7 33.834 36.0 36.0 36.0 32.0 36.0 8 33.649 36.0 36.0 36.0 27.0 36.0 9 33.76825 36.0 36.0 36.0 32.0 36.0 10-11 33.723 36.0 36.0 36.0 29.5 36.0 12-13 33.51575 36.0 36.0 36.0 24.0 36.0 14-15 33.668499999999995 36.0 36.0 36.0 29.5 36.0 16-17 33.559124999999995 36.0 36.0 36.0 24.0 36.0 18-19 33.524 36.0 36.0 36.0 29.5 36.0 20-21 33.65075 36.0 36.0 36.0 27.0 36.0 22-23 33.806375 36.0 36.0 36.0 32.0 36.0 24-25 33.707875 36.0 36.0 36.0 32.0 36.0 26-27 33.47825 36.0 36.0 36.0 24.0 36.0 28-29 33.437 36.0 36.0 36.0 27.0 36.0 30-31 33.4485 36.0 36.0 36.0 27.0 36.0 32-33 33.429500000000004 36.0 36.0 36.0 24.0 36.0 34-35 33.591875 36.0 36.0 36.0 27.0 36.0 36-37 33.554125 36.0 36.0 36.0 27.0 36.0 38-39 33.4695 36.0 36.0 36.0 24.0 36.0 40-41 33.489999999999995 36.0 36.0 36.0 24.0 36.0 42-43 33.478299762440614 36.0 36.0 36.0 24.0 36.0 44-45 33.524381095273824 36.0 36.0 36.0 24.0 36.0 46-47 33.57828914457228 36.0 36.0 36.0 27.0 36.0 48-49 33.540520260130066 36.0 36.0 36.0 27.0 36.0 50-51 33.44247123561781 36.0 36.0 36.0 21.0 36.0 52-53 33.50850425212606 36.0 36.0 36.0 21.0 36.0 54-55 33.490808232487524 36.0 36.0 36.0 21.0 36.0 56-57 33.38976476476476 36.0 36.0 36.0 21.0 36.0 58-59 33.25372940512145 36.0 36.0 36.0 21.0 36.0 60-61 33.31715689612555 36.0 36.0 36.0 21.0 36.0 62-63 33.361347695390776 36.0 36.0 36.0 21.0 36.0 64-65 33.177442594634314 36.0 36.0 36.0 21.0 36.0 66-67 33.171600602107375 36.0 36.0 36.0 17.5 36.0 68-69 33.15134436743209 36.0 36.0 36.0 17.5 36.0 70-71 33.04119574259138 36.0 36.0 36.0 17.5 36.0 72-73 33.187576520066905 36.0 36.0 36.0 17.5 36.0 74-75 33.12036403905361 36.0 36.0 36.0 17.5 36.0 76 32.84876773711725 36.0 36.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 12.0 15 8.0 16 24.0 17 10.0 18 20.0 19 20.0 20 22.0 21 23.0 22 23.0 23 35.0 24 44.0 25 36.0 26 41.0 27 58.0 28 74.0 29 96.0 30 116.0 31 164.0 32 218.0 33 323.0 34 647.0 35 1986.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.66533066132264 15.831663326653306 11.197394789579159 40.30561122244489 2 24.6 26.05 26.85 22.5 3 22.375 26.474999999999998 22.35 28.799999999999997 4 29.375 27.125 17.7 25.8 5 28.275 29.25 18.95 23.525 6 23.075000000000003 33.300000000000004 18.325 25.3 7 23.0 19.675 30.2 27.125 8 24.0 22.400000000000002 22.7 30.9 9 24.375 21.8 26.575 27.250000000000004 10-11 27.9125 27.1 19.4875 25.5 12-13 26.474999999999998 23.849999999999998 21.837500000000002 27.8375 14-15 25.85 24.087500000000002 23.724999999999998 26.337500000000002 16-17 27.360260097536575 23.458797048893334 22.671001625609605 26.50994122796049 18-19 26.444833625218916 24.48086064548411 22.0540405303978 27.020265198899175 20-21 25.724999999999998 24.5 23.724999999999998 26.05 22-23 26.700000000000003 24.2 23.2125 25.887500000000003 24-25 25.275 24.4875 23.325000000000003 26.9125 26-27 26.174999999999997 24.712500000000002 23.425 25.687500000000004 28-29 26.827741612418627 24.374061091637454 22.8092138207311 25.98898347521282 30-31 26.825 24.55 23.125 25.5 32-33 26.087500000000002 26.3625 22.375 25.174999999999997 34-35 25.7 25.912499999999998 22.6 25.7875 36-37 25.95 25.4875 22.8625 25.7 38-39 25.456364091022753 26.406601650412604 22.280570142535634 25.85646411602901 40-41 26.804252657911192 25.97873671044403 21.713570981863665 25.50343964978111 42-43 26.32369508073601 24.896733007885842 22.480911252972838 26.29866065840531 44-45 24.96872654490868 25.65674255691769 23.592694520890667 25.781836377282964 46-47 26.113056528264135 25.350175087543768 22.873936968484244 25.662831415707853 48-49 26.060833646263614 25.68531731130304 22.781324320941295 25.47252472149205 50-51 25.49117757477162 25.87911400325366 22.562883243649104 26.066825178325615 52-53 26.488244122061033 25.237618809404704 22.736368184092047 25.53776888444222 54-55 25.753595997498437 25.916197623514698 22.61413383364603 25.71607254534084 56-57 26.151151151151154 25.625625625625624 23.423423423423422 24.7997997997998 58-59 26.670008773029203 24.91540293269833 22.759744328863267 25.654843965409196 60-61 27.07784881534411 24.319919769336842 22.865738999623918 25.73649241569512 62-63 27.819548872180448 25.012531328320804 22.656641604010026 24.51127819548872 64-65 26.858002255921793 25.88043614488031 21.832309813259805 25.42925178593809 66-67 26.003512293025587 25.489212242849973 23.14350225790266 25.363773206221772 68-69 26.327017191617518 25.71213452126992 22.938888191743004 25.021960095369554 70-71 26.618885954985537 25.386646548472275 22.469508361624545 25.52495913491764 72-73 25.262226715531405 25.14848982686718 23.379249336534816 26.2100341210666 74-75 26.681763687225256 22.618889036898896 24.390568802451046 26.308778473424805 76 28.30470500373413 0.0 33.159073935772966 38.536221060492906 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 18.0 1 15.0 2 10.0 3 7.5 4 7.0 5 7.5 6 9.0 7 7.5 8 5.0 9 7.0 10 9.0 11 8.5 12 8.0 13 7.0 14 5.5 15 3.5 16 1.5 17 1.0 18 2.0 19 2.5 20 2.5 21 2.5 22 3.5 23 3.5 24 2.0 25 2.0 26 2.0 27 4.0 28 7.0 29 7.5 30 8.0 31 12.0 32 16.5 33 18.5 34 27.5 35 39.0 36 49.0 37 63.5 38 78.5 39 109.5 40 133.0 41 146.5 42 162.5 43 178.5 44 193.0 45 189.0 46 186.5 47 181.5 48 181.5 49 187.0 50 180.5 51 158.0 52 142.5 53 141.0 54 137.0 55 135.0 56 127.0 57 114.0 58 109.5 59 106.5 60 104.0 61 105.5 62 102.5 63 104.5 64 106.5 65 105.5 66 101.0 67 89.5 68 86.0 69 84.0 70 77.5 71 75.0 72 70.5 73 69.5 74 65.5 75 61.0 76 49.5 77 32.5 78 23.0 79 16.0 80 14.5 81 12.5 82 8.5 83 6.0 84 6.5 85 4.5 86 3.5 87 4.5 88 3.0 89 1.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0375 18-19 0.075 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.15 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.025 40-41 0.0625 42-43 0.12501562695336918 44-45 0.05001250312578145 46-47 0.0 48-49 0.08754377188594298 50-51 0.06253126563281641 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.1251721116535236 60-61 0.12520345561537496 62-63 0.0501002004008016 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.10048988820499938 72-73 0.10099734881959348 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 42 1.0 43 0.0 44 0.0 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 1.0 56 0.0 57 1.0 58 1.0 59 0.0 60 1.0 61 1.0 62 0.0 63 1.0 64 3.0 65 2.0 66 0.0 67 1.0 68 1.0 69 3.0 70 1.0 71 8.0 72 23.0 73 65.0 74 261.0 75 945.0 76 2678.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83248730964466 97.35000000000001 2 0.9390862944162437 1.8499999999999999 3 0.15228426395939085 0.44999999999999996 4 0.025380710659898477 0.1 5 0.050761421319796954 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 5 0.125 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954984 spots for SRR18888529.sra Written 1954984 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra Read 1954982 spots for SRR18888529.sra Written 1954982 spots for SRR18888529.sra SRR ids: ['SRR18888529.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4uqv3rb2 SRR18888529.sra spots: 39099642 blocks: [[1, 1954982], [1954983, 3909964], [3909965, 5864946], [5864947, 7819928], [7819929, 9774910], [9774911, 11729892], [11729893, 13684874], [13684875, 15639856], [15639857, 17594838], [17594839, 19549820], [19549821, 21504802], [21504803, 23459784], [23459785, 25414766], [25414767, 27369748], [27369749, 29324730], [29324731, 31279712], [31279713, 33234694], [33234695, 35189676], [35189677, 37144658], [37144659, 39099642]] SRR18888529 file size 7457003 SRR18888529 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18888529 SRR18888529_1.fastq SRR18888529_2.fastq Input file: SRR18888529_1.fastq Paired file: SRR18888529_2.fastq trimmed: SRR18888529-trimmed-pair1.fastq, SRR18888529-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:18:37 2024 >> started Tue Dec 10 05:19:10 2024 >> done (32.712s) 39099642 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 35598 ( 0.09%) empty read pairs filtered out after trimming by size control 39064042 (99.91%) read pairs available; of these: 63911 ( 0.16%) trimmed read pairs available after processing 39000131 (99.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 4 0.00% 21 11 0.00% 22 33 0.00% 23 80 0.00% 24 125 0.00% 25 153 0.00% 26 192 0.00% 27 204 0.00% 28 267 0.00% 29 356 0.00% 30 396 0.00% 31 1172 0.00% 32 1349 0.00% 33 573 0.00% 34 1696 0.00% 35 1016 0.00% 36 1142 0.00% 37 1267 0.00% 38 1316 0.00% 39 1501 0.00% 40 1730 0.00% 41 1792 0.00% 42 1990 0.01% 43 2070 0.01% 44 2130 0.01% 45 2303 0.01% 46 2363 0.01% 47 2778 0.01% 48 2999 0.01% 49 3290 0.01% 50 3617 0.01% 51 4072 0.01% 52 4409 0.01% 53 4676 0.01% 54 5049 0.01% 55 5483 0.01% 56 5923 0.02% 57 6275 0.02% 58 6947 0.02% 59 7430 0.02% 60 8023 0.02% 61 8774 0.02% 62 9916 0.03% 63 10626 0.03% 64 11901 0.03% 65 12853 0.03% 66 13791 0.04% 67 15154 0.04% 68 16122 0.04% 69 18166 0.05% 70 23109 0.06% 71 28015 0.07% 72 47643 0.12% 73 319904 0.82% 74 2771181 7.09% 75 17565429 44.97% 76 18093255 46.32% 39064042 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=7.69 fanout-score-rank=26 prefix-density=0.24 prefix-fanout=4.5 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=17 fanout-score=331.95 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=18.6 sequence=GCGGCGGCGGAGG criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=126.92 fanout-score-rank=19 prefix-density=1.55 prefix-fanout=19.5 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=441.98 fanout-score-rank=1 prefix-density=1.35 prefix-fanout=21.7 sequence=GCCGCCGCCGCT SRR18888529 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:19:43 Started mapping on | Dec 10 05:19:44 Finished on | Dec 10 05:22:10 Mapping speed, Million of reads per hour | 963.22 Number of input reads | 39064042 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 32755872 Uniquely mapped reads % | 83.85% Average mapped length | 150.36 Number of splices: Total | 14395385 Number of splices: Annotated (sjdb) | 13664765 Number of splices: GT/AG | 14200747 Number of splices: GC/AG | 164655 Number of splices: AT/AC | 10298 Number of splices: Non-canonical | 19685 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 1.78 Insertion rate per base | 0.01% Insertion average length | 1.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1743168 % of reads mapped to multiple loci | 4.46% Number of reads mapped to too many loci | 921820 % of reads mapped to too many loci | 2.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.96% % of reads unmapped: other | 5.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4565004 4565004 4565004 N_multimapping 1743168 1743168 1743168 N_noFeature 994035 31621952 1660955 N_ambiguous 634188 5439 181644 UnstrandedReadsAssigned:31127649 PositiveStrandReadsAssigned:1128481 NegativeStrandReadsAssigned:30913273 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR18888529 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18888529-trimmed-pair1.fastq SRR18888529-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,064,042 reads, 32,521,958 reads pseudoaligned [quant] estimated average fragment length: 159.742 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52973 SRR18888529.ke.tsv 35125 SRR18888529.se.tsv 88098 total ==> SRR18888529.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 777.422 0 0 PNS24247 1044 885.258 57.1023 2.85048 PNS24249 1928 1769.26 545.527 13.6257 PNS24246 1044 885.258 57.1023 2.85048 PNS24248 1044 885.258 57.1023 2.85048 PNS24244 1471 1312.26 57.1664 1.92511 PNS24243 293 140.305 0 0 KQK14069 1603 1444.26 1214.87 37.1721 KQK14071 474 316.54 347.457 48.5071 ==> SRR18888529.se.tsv <== BRADI_1g14170v3 1847 BRADI_1g53295v3 42 BRADI_1g59795v3 530 BRADI_1g07683v3 0 BRADI_1g00485v3 54 BRADI_1g20270v3 3564 BRADI_1g74790v3 102 BRADI_1g09890v3 0 BRADI_1g77505v3 708 BRADI_1g48960v3 0 SRR18888529 completed mapping pipeline successfully