Starting /dee2/code/volunteer_pipeline.sh SRR18888530 current disk space = 1525987868672 free memory = 1595974848 SRR18888530 SRAfilesize 83e75f5f52a313242b86c3348f3f3e96 SRR18888530.sra SRR18888530.sra file validated SRR18888530 is paired end SRR18888530 is conventional basespace SRR18888530 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18888530_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1775 32.0 32.0 32.0 32.0 32.0 2 31.36625 32.0 32.0 32.0 32.0 32.0 3 31.52025 32.0 32.0 32.0 32.0 32.0 4 31.47825 32.0 32.0 32.0 32.0 32.0 5 31.5485 32.0 32.0 32.0 32.0 32.0 6 34.705 36.0 36.0 36.0 32.0 36.0 7 34.89925 36.0 36.0 36.0 32.0 36.0 8 34.94025 36.0 36.0 36.0 32.0 36.0 9 34.8765 36.0 36.0 36.0 32.0 36.0 10-11 34.738125 36.0 36.0 36.0 32.0 36.0 12-13 34.892375 36.0 36.0 36.0 32.0 36.0 14-15 34.950374999999994 36.0 36.0 36.0 34.0 36.0 16-17 34.833749999999995 36.0 36.0 36.0 32.0 36.0 18-19 34.86175 36.0 36.0 36.0 32.0 36.0 20-21 34.9015 36.0 36.0 36.0 32.0 36.0 22-23 34.80425 36.0 36.0 36.0 32.0 36.0 24-25 34.695125000000004 36.0 36.0 36.0 32.0 36.0 26-27 34.698875 36.0 36.0 36.0 32.0 36.0 28-29 34.6845 36.0 36.0 36.0 32.0 36.0 30-31 34.586375000000004 36.0 36.0 36.0 32.0 36.0 32-33 34.537875 36.0 36.0 36.0 32.0 36.0 34-35 34.566375 36.0 36.0 36.0 32.0 36.0 36-37 34.585396349087276 36.0 36.0 36.0 32.0 36.0 38-39 34.60527631907977 36.0 36.0 36.0 32.0 36.0 40-41 34.472243060765194 36.0 36.0 36.0 32.0 36.0 42-43 34.424356089022254 36.0 36.0 36.0 32.0 36.0 44-45 34.57089272318079 36.0 36.0 36.0 32.0 36.0 46-47 34.35608902225556 36.0 36.0 36.0 32.0 36.0 48-49 34.25068767191798 36.0 36.0 36.0 32.0 36.0 50-51 34.34337714618749 36.0 36.0 36.0 32.0 36.0 52-53 34.38294147073537 36.0 36.0 36.0 32.0 36.0 54-55 34.30365182591296 36.0 36.0 36.0 32.0 36.0 56-57 34.34928558155353 36.0 36.0 36.0 32.0 36.0 58-59 34.15921074979177 36.0 36.0 36.0 32.0 36.0 60-61 34.24541241489081 36.0 36.0 36.0 32.0 36.0 62-63 34.26315130260521 36.0 36.0 36.0 32.0 36.0 64-65 34.158942885771545 36.0 36.0 36.0 32.0 36.0 66-67 34.06928088198447 36.0 36.0 36.0 32.0 36.0 68-69 34.06163868704586 36.0 36.0 36.0 32.0 36.0 70-71 34.02946059055887 36.0 36.0 36.0 32.0 36.0 72-73 33.96842356832873 36.0 36.0 36.0 32.0 36.0 74-75 33.91339845505287 36.0 36.0 36.0 32.0 36.0 76 33.61892393320965 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 4.0 22 9.0 23 15.0 24 14.0 25 19.0 26 33.0 27 40.0 28 44.0 29 66.0 30 96.0 31 137.0 32 172.0 33 312.0 34 741.0 35 2294.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.20830207551888 10.277569392348088 11.902975743935984 44.61115278819705 2 21.705426356589147 15.95398849712428 31.557889472368096 30.782695673918482 3 25.531382845711427 18.754688672168044 18.629657414353588 37.08427106776694 4 27.68192048012003 26.38159539884971 17.67941985496374 28.257064266066518 5 25.406351587896975 29.557389347336834 22.030507626906726 23.005751437859466 6 22.538403424830015 33.26617980357592 22.840594308738353 21.354822462855704 7 19.72993248312078 23.13078269567392 35.80895223805952 21.330332583145786 8 21.280320080020005 23.80595148787197 28.382095523880967 26.531632908227053 9 22.355588897224308 21.555388847211805 30.307576894223555 25.78144536134033 10-11 23.918479619904975 30.92023005751438 21.9679919979995 23.193298324581146 12-13 24.293573393348336 23.330832708177045 26.106526631657918 26.269067266816705 14-15 22.948974487243625 25.52526263131566 25.63781890945473 25.887943971985994 16-17 24.193548387096776 25.84396099024756 24.918729682420604 25.04376094023506 18-19 23.918479619904975 25.49387346836709 25.36884221055264 25.218804701175294 20-21 23.493373343335833 25.76894223555889 24.918729682420604 25.818954738684667 22-23 24.093523380845213 25.731432858214554 25.09377344336084 25.081270317579396 24-25 24.36859214803701 25.95648912228057 24.981245311327832 24.69367341835459 26-27 24.524762381190595 25.512756378189096 24.362181090545274 25.60030015007504 28-29 24.074537268634316 26.063031515757878 24.912456228114056 24.949974987493746 30-31 23.23080770192548 25.44386096524131 24.69367341835459 26.63165791447862 32-33 23.78094523630908 26.094023505876468 24.431107776944234 25.693923480870218 34-35 24.243560890222557 26.38159539884971 24.706176544136035 24.668667166791696 36-37 23.649324662331164 25.587793896948476 24.062031015507753 26.700850425212607 38-39 25.256314078519633 25.78144536134033 23.36834208552138 25.593898474618655 40-41 23.918479619904975 26.85671417854464 23.893473368342086 25.331332833208304 42-43 24.831207801950487 26.406601650412604 23.218304576144035 25.543885971492873 44-45 24.718679669917478 25.168792198049513 23.968492123030757 26.144036009002253 46-47 24.296611229210953 27.42278354382894 23.046142303363762 25.23446292359635 48-49 23.95194593918158 26.51733199849831 23.488925040670754 26.041797021649355 50-51 23.783918969613605 25.609603601350507 24.309115918469427 26.297361510566464 52-53 24.424712356178087 27.226113056528263 23.074037018509255 25.275137568784395 54-55 24.449724862431214 25.987993996998497 23.349174587293646 26.21310655327664 56-57 23.72075566120355 26.610784436381834 23.758288502439633 25.910171399974978 58-59 23.751095530236636 27.256792287467135 23.863778640290473 25.12833354200576 60-61 24.66816929626847 26.170798898071624 23.29075882794891 25.870272977710997 62-63 23.650256795690844 26.230740323186772 23.950895653263185 26.1681072278592 64-65 25.025050100200403 26.828657314629258 22.82064128256513 25.325651302605213 66-67 25.194186920571287 26.48459032823854 23.37759959909797 24.943623152092208 68-69 25.0814332247557 26.409421197694815 23.014282134803306 25.49486344274618 70-71 24.36395538288006 26.70760746960772 23.799974934202282 25.128462213309938 72-73 26.4269549911994 26.11264772441539 22.57983404576314 24.880563238622077 74-75 25.325192460844175 23.082028139102732 24.62171489248739 26.9710645075657 76 28.42300556586271 0.0 33.13543599257885 38.44155844155844 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 85.0 1 44.0 2 2.5 3 1.0 4 0.0 5 0.0 6 0.5 7 3.0 8 5.0 9 6.0 10 10.5 11 14.5 12 15.0 13 10.5 14 4.5 15 2.0 16 1.0 17 2.5 18 2.5 19 0.5 20 1.0 21 2.5 22 3.5 23 2.0 24 0.5 25 1.5 26 2.5 27 4.5 28 6.0 29 5.0 30 6.5 31 17.0 32 28.5 33 31.0 34 42.5 35 62.0 36 69.5 37 73.0 38 84.5 39 119.5 40 149.0 41 159.0 42 167.0 43 184.0 44 206.0 45 210.0 46 210.0 47 196.5 48 187.5 49 202.0 50 195.0 51 168.5 52 162.5 53 148.0 54 123.0 55 113.0 56 114.5 57 113.5 58 107.5 59 106.5 60 103.0 61 96.5 62 89.0 63 83.5 64 80.0 65 77.5 66 74.0 67 71.5 68 71.0 69 69.0 70 58.0 71 48.5 72 44.5 73 46.5 74 51.0 75 48.0 76 40.0 77 34.5 78 25.5 79 17.0 80 16.0 81 12.5 82 6.0 83 2.5 84 4.0 85 5.0 86 3.0 87 1.0 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.7250000000000001 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.05 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.05 28-29 0.05 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.025006251562890724 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.012503125781445362 48-49 0.08752188047011752 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.025034422330704718 60-61 0.0125203455615375 62-63 0.0125250501002004 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.03980363539869975 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 1.0 57 1.0 58 1.0 59 0.0 60 1.0 61 1.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 0.0 69 1.0 70 1.0 71 5.0 72 14.0 73 72.0 74 259.0 75 944.0 76 2695.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.17737789203085 96.45 2 0.7712082262210797 1.5 3 0.025706940874035987 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025706940874035987 1.975 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 79 1.975 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 45 0.0039632837 30.877777 1 >>END_MODULE SRR18888530 read2 length is 50-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18888530_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.4195 32.0 32.0 32.0 32.0 32.0 2 30.245 32.0 32.0 32.0 21.0 32.0 3 30.2785 32.0 32.0 32.0 21.0 32.0 4 30.2215 32.0 32.0 32.0 21.0 32.0 5 30.12925 32.0 32.0 32.0 21.0 32.0 6 33.46975 36.0 36.0 36.0 21.0 36.0 7 33.442 36.0 36.0 36.0 21.0 36.0 8 33.1235 36.0 36.0 36.0 14.0 36.0 9 33.485 36.0 36.0 36.0 21.0 36.0 10-11 33.4465 36.0 36.0 36.0 21.0 36.0 12-13 33.193124999999995 36.0 36.0 36.0 21.0 36.0 14-15 33.302875 36.0 36.0 36.0 21.0 36.0 16-17 33.093875 36.0 36.0 36.0 17.5 36.0 18-19 33.137625 36.0 36.0 36.0 21.0 36.0 20-21 33.314875 36.0 36.0 36.0 21.0 36.0 22-23 33.658249999999995 36.0 36.0 36.0 32.0 36.0 24-25 33.462 36.0 36.0 36.0 26.5 36.0 26-27 33.312625 36.0 36.0 36.0 21.0 36.0 28-29 33.15975 36.0 36.0 36.0 21.0 36.0 30-31 33.182874999999996 36.0 36.0 36.0 17.5 36.0 32-33 33.17175 36.0 36.0 36.0 21.0 36.0 34-35 33.285125 36.0 36.0 36.0 20.5 36.0 36-37 33.239625000000004 36.0 36.0 36.0 21.0 36.0 38-39 33.305499999999995 36.0 36.0 36.0 21.0 36.0 40-41 33.243625 36.0 36.0 36.0 21.0 36.0 42-43 33.209875 36.0 36.0 36.0 14.0 36.0 44-45 33.131625 36.0 36.0 36.0 14.0 36.0 46-47 33.229375000000005 36.0 36.0 36.0 14.0 36.0 48-49 33.095625 36.0 36.0 36.0 14.0 36.0 50-51 33.1480179419855 36.0 36.0 36.0 14.0 36.0 52-53 33.10677669417355 36.0 36.0 36.0 14.0 36.0 54-55 33.14853713428357 36.0 36.0 36.0 14.0 36.0 56-57 33.05503790173796 36.0 36.0 36.0 14.0 36.0 58-59 32.96133796499879 36.0 36.0 36.0 14.0 36.0 60-61 32.911265208200284 36.0 36.0 36.0 14.0 36.0 62-63 33.02867518156775 36.0 36.0 36.0 14.0 36.0 64-65 32.92173804157275 36.0 36.0 36.0 14.0 36.0 66-67 32.991858717434866 36.0 36.0 36.0 14.0 36.0 68-69 32.90429094847174 36.0 36.0 36.0 14.0 36.0 70-71 32.742519109094644 36.0 36.0 36.0 14.0 36.0 72-73 32.635251944082206 36.0 36.0 36.0 14.0 36.0 74-75 32.83312972078126 36.0 36.0 36.0 14.0 36.0 76 32.27432978332721 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 20.0 15 19.0 16 25.0 17 18.0 18 23.0 19 26.0 20 31.0 21 25.0 22 23.0 23 28.0 24 34.0 25 48.0 26 45.0 27 68.0 28 98.0 29 110.0 30 121.0 31 132.0 32 239.0 33 346.0 34 656.0 35 1864.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.132312327391414 13.708260105448156 13.08059251820236 42.07883504895808 2 22.475 25.4 27.800000000000004 24.325 3 23.674999999999997 25.924999999999997 19.925 30.475 4 27.1 29.025000000000002 16.85 27.025 5 27.55 30.675 18.625 23.150000000000002 6 22.45 33.225 19.075 25.25 7 22.655663915978995 17.029257314328582 31.932983245811453 28.382095523880967 8 23.24824824824825 20.945945945945947 24.574574574574577 31.23123123123123 9 23.40585146286572 22.05551387846962 26.131532883220803 28.40710177544386 10-11 25.96622889305816 28.430268918073796 20.187617260787995 25.41588492808005 12-13 25.9875 22.2625 23.7 28.050000000000004 14-15 25.275 24.15 24.7375 25.837500000000002 16-17 25.519659403956922 23.64137240170298 23.99198597545705 26.84698221888305 18-19 24.912324649298597 24.498997995991985 23.885270541082164 26.703406813627257 20-21 26.113056528264135 24.474737368684345 24.174587293646823 25.237618809404704 22-23 25.1875 23.8625 24.474999999999998 26.474999999999998 24-25 25.50956608728273 24.109040890333873 25.32199574840565 25.05939727397774 26-27 25.293970477858394 24.34325744308231 24.74355766825119 25.619214410808105 28-29 26.044410989838163 23.485133609333836 24.275498682724876 26.194956718103125 30-31 25.03125781445361 25.818954738684667 23.23080770192548 25.918979744936234 32-33 25.831457864466117 25.268817204301076 23.99349837459365 24.90622655663916 34-35 25.775 25.0 23.474999999999998 25.75 36-37 25.693923480870218 25.29382345586397 23.280820205051263 25.731432858214554 38-39 25.86055826761797 25.52259356615346 23.732632369508075 24.88421579672049 40-41 25.47890321772881 24.589958682859645 24.139226242644295 25.791911856767246 42-43 25.69888429234048 24.47035226275542 23.856086247962892 25.974677196941204 44-45 25.2784382430234 25.86659992491553 24.014516330872233 24.84044550118884 46-47 25.581395348837212 25.71892973243311 23.018254563640912 25.681420355088775 48-49 25.134762442020808 25.347875141030464 23.37971668547073 26.137645731478 50-51 26.239359038557836 25.951427140711065 23.798197295943915 24.01101652478718 52-53 25.881911433575183 24.39329497122842 24.305729296972732 25.41906429822367 54-55 25.49387346836709 25.906476619154787 23.69342335583896 24.90622655663916 56-57 25.684974352558488 26.097835606155385 24.659076692105593 23.55811334918053 58-59 25.79389983682691 25.05334504832434 23.697753232082338 25.45500188276641 60-61 25.794298631169156 25.681275901042323 23.383147055129978 25.141278412658547 62-63 26.96840521564694 25.840020060180542 22.893681043129387 24.297893681043128 64-65 25.951903807615228 26.23997995991984 23.18386773547094 24.62424849699399 66-67 26.089679358717433 25.175350701402806 23.334168336673347 25.400801603206414 68-69 25.435409096604435 25.886480390928458 23.39305851397068 25.285051998496428 70-71 25.339366515837103 25.917546505781804 23.340874811463046 25.402212166918048 72-73 26.19949494949495 26.224747474747474 22.79040404040404 24.785353535353536 74-75 26.618037135278517 22.546419098143236 24.137931034482758 26.69761273209549 76 27.983841351450607 0.0 34.22695556371649 37.789203084832906 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 35.0 1 22.5 2 7.5 3 5.5 4 6.0 5 5.5 6 7.5 7 11.5 8 13.0 9 14.0 10 15.0 11 19.5 12 24.0 13 15.5 14 3.5 15 1.0 16 1.5 17 1.5 18 1.0 19 2.5 20 5.0 21 4.0 22 2.5 23 3.0 24 4.0 25 4.0 26 2.5 27 2.5 28 7.5 29 9.0 30 8.5 31 15.5 32 23.5 33 28.5 34 35.5 35 55.0 36 75.5 37 82.0 38 90.0 39 106.5 40 130.0 41 143.5 42 142.5 43 159.0 44 171.5 45 182.5 46 199.0 47 192.5 48 190.0 49 189.0 50 178.0 51 156.0 52 138.5 53 139.0 54 137.0 55 127.5 56 125.0 57 124.5 58 120.5 59 116.0 60 104.5 61 106.5 62 115.0 63 106.5 64 97.0 65 103.0 66 97.0 67 88.0 68 84.5 69 84.5 70 82.0 71 66.5 72 70.5 73 66.5 74 49.5 75 46.5 76 45.0 77 35.5 78 23.0 79 19.0 80 20.0 81 13.5 82 8.0 83 9.0 84 5.5 85 4.0 86 4.5 87 3.0 88 2.0 89 3.0 90 2.5 91 0.5 92 1.0 93 1.0 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.1 9 0.025 10-11 0.0625 12-13 0.0 14-15 0.0 16-17 0.17500000000000002 18-19 0.2 20-21 0.05 22-23 0.0 24-25 0.0375 26-27 0.075 28-29 0.36250000000000004 30-31 0.025 32-33 0.025 34-35 0.0 36-37 0.025 38-39 0.13749999999999998 40-41 0.1625 42-43 0.2875 44-45 0.11249999999999999 46-47 0.025 48-49 0.2875 50-51 0.1375171896487061 52-53 0.05001250312578145 54-55 0.0 56-57 0.025015634771732333 58-59 0.3003378801151295 60-61 0.32544749029916137 62-63 0.12521913348359628 64-65 0.025043826696719257 66-67 0.0 68-69 0.025053238131028437 70-71 0.2632568634825122 72-73 0.2518891687657431 74-75 0.013260840737302744 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50 1.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 1.0 57 1.0 58 1.0 59 0.0 60 1.0 61 1.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 1.0 69 2.0 70 1.0 71 7.0 72 22.0 73 70.0 74 237.0 75 929.0 76 2723.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.18905220476432 97.85000000000001 2 0.6842372022301064 1.35 3 0.07602635580334516 0.22499999999999998 4 0.025342118601115054 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025342118601115054 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 19 0.475 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra Read 1885838 spots for SRR18888530.sra Written 1885838 spots for SRR18888530.sra SRR ids: ['SRR18888530.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_etaj1efw SRR18888530.sra spots: 37716760 blocks: [[1, 1885838], [1885839, 3771676], [3771677, 5657514], [5657515, 7543352], [7543353, 9429190], [9429191, 11315028], [11315029, 13200866], [13200867, 15086704], [15086705, 16972542], [16972543, 18858380], [18858381, 20744218], [20744219, 22630056], [22630057, 24515894], [24515895, 26401732], [26401733, 28287570], [28287571, 30173408], [30173409, 32059246], [32059247, 33945084], [33945085, 35830922], [35830923, 37716760]] SRR18888530 file size 7196174 SRR18888530 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18888530 SRR18888530_1.fastq SRR18888530_2.fastq Input file: SRR18888530_1.fastq Paired file: SRR18888530_2.fastq trimmed: SRR18888530-trimmed-pair1.fastq, SRR18888530-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:20:02 2024 >> started Tue Dec 10 05:20:36 2024 >> done (33.751s) 37716760 read pairs processed; of these: 4 ( 0.00%) short read pairs filtered out after trimming by size control 5705 ( 0.02%) empty read pairs filtered out after trimming by size control 37711051 (99.98%) read pairs available; of these: 220640 ( 0.59%) trimmed read pairs available after processing 37490411 (99.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 5 0.00% 22 33 0.00% 23 64 0.00% 24 84 0.00% 25 136 0.00% 26 143 0.00% 27 169 0.00% 28 211 0.00% 29 286 0.00% 30 309 0.00% 31 747 0.00% 32 919 0.00% 33 411 0.00% 34 1166 0.00% 35 684 0.00% 36 775 0.00% 37 790 0.00% 38 866 0.00% 39 1007 0.00% 40 1138 0.00% 41 1170 0.00% 42 1232 0.00% 43 1416 0.00% 44 1369 0.00% 45 1521 0.00% 46 1605 0.00% 47 1772 0.00% 48 2001 0.01% 49 2150 0.01% 50 2453 0.01% 51 2739 0.01% 52 3032 0.01% 53 3185 0.01% 54 3438 0.01% 55 3848 0.01% 56 4030 0.01% 57 4436 0.01% 58 4886 0.01% 59 5366 0.01% 60 5944 0.02% 61 6308 0.02% 62 7073 0.02% 63 7773 0.02% 64 8575 0.02% 65 9383 0.02% 66 10086 0.03% 67 11427 0.03% 68 12270 0.03% 69 13631 0.04% 70 18048 0.05% 71 22990 0.06% 72 41550 0.11% 73 301725 0.80% 74 2791986 7.40% 75 17355148 46.02% 76 17025539 45.15% 37711051 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=7.56 fanout-score-rank=22 prefix-density=0.25 prefix-fanout=4.4 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=325.07 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=21.9 sequence=GCGGCGGCGGCC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=120.21 fanout-score-rank=21 prefix-density=1.52 prefix-fanout=19.1 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=441.05 fanout-score-rank=1 prefix-density=1.31 prefix-fanout=23.3 sequence=CCGCCGCCGCCC SRR18888530 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:21:30 Started mapping on | Dec 10 05:21:30 Finished on | Dec 10 05:24:46 Mapping speed, Million of reads per hour | 692.65 Number of input reads | 37711051 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 31616320 Uniquely mapped reads % | 83.84% Average mapped length | 150.43 Number of splices: Total | 14372795 Number of splices: Annotated (sjdb) | 13672150 Number of splices: GT/AG | 14181569 Number of splices: GC/AG | 163535 Number of splices: AT/AC | 9734 Number of splices: Non-canonical | 17957 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.01% Deletion average length | 1.79 Insertion rate per base | 0.01% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1593279 % of reads mapped to multiple loci | 4.22% Number of reads mapped to too many loci | 630025 % of reads mapped to too many loci | 1.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.20% % of reads unmapped: other | 4.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4501458 4501458 4501458 N_multimapping 1593279 1593279 1593279 N_noFeature 932160 30688706 1427528 N_ambiguous 571853 4653 148506 UnstrandedReadsAssigned:30112307 PositiveStrandReadsAssigned:922961 NegativeStrandReadsAssigned:30040286 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR18888530 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18888530-trimmed-pair1.fastq SRR18888530-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,711,051 reads, 31,831,082 reads pseudoaligned [quant] estimated average fragment length: 161.502 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR18888530.ke.tsv 35125 SRR18888530.se.tsv 88098 total ==> SRR18888530.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 775.694 0 0 PNS24247 1044 883.498 27.8334 1.46804 PNS24249 1928 1767.5 610.61 16.0983 PNS24246 1044 883.498 27.8334 1.46804 PNS24248 1044 883.498 27.8334 1.46804 PNS24244 1471 1310.5 32.8895 1.16949 PNS24243 293 139.001 0 0 KQK14069 1603 1442.5 3461.5 111.821 KQK14071 474 314.956 853.063 126.214 ==> SRR18888530.se.tsv <== BRADI_1g14170v3 5193 BRADI_1g53295v3 13 BRADI_1g59795v3 462 BRADI_1g07683v3 0 BRADI_1g00485v3 80 BRADI_1g20270v3 4448 BRADI_1g74790v3 119 BRADI_1g09890v3 0 BRADI_1g77505v3 665 BRADI_1g48960v3 3 SRR18888530 completed mapping pipeline successfully