Starting /dee2/code/volunteer_pipeline.sh SRR18888531 current disk space = 1525969551360 free memory = 1458882728 SRR18888531 SRAfilesize db246b00cd856c71836626fc14a0b0f9 SRR18888531.sra SRR18888531.sra file validated SRR18888531 is paired end SRR18888531 is conventional basespace SRR18888531 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18888531_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.317 32.0 32.0 32.0 32.0 32.0 2 31.436 32.0 32.0 32.0 32.0 32.0 3 31.48425 32.0 32.0 32.0 32.0 32.0 4 31.49525 32.0 32.0 32.0 32.0 32.0 5 31.4865 32.0 32.0 32.0 32.0 32.0 6 34.73525 36.0 36.0 36.0 32.0 36.0 7 34.88325 36.0 36.0 36.0 32.0 36.0 8 35.0315 36.0 36.0 36.0 36.0 36.0 9 34.93075 36.0 36.0 36.0 32.0 36.0 10-11 34.83075 36.0 36.0 36.0 32.0 36.0 12-13 34.949625 36.0 36.0 36.0 32.0 36.0 14-15 34.881375 36.0 36.0 36.0 32.0 36.0 16-17 34.903875 36.0 36.0 36.0 32.0 36.0 18-19 34.804125 36.0 36.0 36.0 32.0 36.0 20-21 34.855000000000004 36.0 36.0 36.0 32.0 36.0 22-23 34.74275 36.0 36.0 36.0 32.0 36.0 24-25 34.76875 36.0 36.0 36.0 32.0 36.0 26-27 34.698875 36.0 36.0 36.0 32.0 36.0 28-29 34.677375 36.0 36.0 36.0 32.0 36.0 30-31 34.661125 36.0 36.0 36.0 32.0 36.0 32-33 34.50375 36.0 36.0 36.0 32.0 36.0 34-35 34.530125 36.0 36.0 36.0 32.0 36.0 36-37 34.65032516258129 36.0 36.0 36.0 32.0 36.0 38-39 34.57228614307154 36.0 36.0 36.0 32.0 36.0 40-41 34.56453226613307 36.0 36.0 36.0 32.0 36.0 42-43 34.516008004002 36.0 36.0 36.0 32.0 36.0 44-45 34.49399699849925 36.0 36.0 36.0 32.0 36.0 46-47 34.51576182136603 36.0 36.0 36.0 32.0 36.0 48-49 34.392044033024774 36.0 36.0 36.0 32.0 36.0 50-51 34.57693269952465 36.0 36.0 36.0 32.0 36.0 52-53 34.45708208208208 36.0 36.0 36.0 32.0 36.0 54-55 34.43918918918919 36.0 36.0 36.0 32.0 36.0 56-57 34.39299123904881 36.0 36.0 36.0 32.0 36.0 58-59 34.26658322903629 36.0 36.0 36.0 32.0 36.0 60-61 34.20029837522354 36.0 36.0 36.0 32.0 36.0 62-63 34.30024097366836 36.0 36.0 36.0 32.0 36.0 64-65 34.36610289628156 36.0 36.0 36.0 32.0 36.0 66-67 34.25809691187547 36.0 36.0 36.0 32.0 36.0 68-69 34.15181290769619 36.0 36.0 36.0 32.0 36.0 70-71 34.18529761311048 36.0 36.0 36.0 32.0 36.0 72-73 34.08489367161977 36.0 36.0 36.0 32.0 36.0 74-75 34.026646401632185 36.0 36.0 36.0 29.5 36.0 76 33.76262440103207 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 3.0 20 2.0 21 5.0 22 3.0 23 10.0 24 16.0 25 20.0 26 24.0 27 35.0 28 57.0 29 71.0 30 89.0 31 120.0 32 200.0 33 299.0 34 653.0 35 2391.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.5687843921961 9.929964982491246 10.705352676338169 41.795897948974485 2 21.22122122122122 12.637637637637638 31.806806806806808 34.33433433433433 3 22.486243121560783 14.4072036018009 19.959979989995 43.14657328664332 4 27.263631815907953 21.53576788394197 17.733866933466732 33.46673336668334 5 28.789394697348676 25.71285642821411 20.635317658829415 24.862431215607803 6 24.666498867354644 29.65013843443242 22.300528567832874 23.382834130380065 7 20.68534267133567 21.68584292146073 36.79339669834917 20.83541770885443 8 23.1615807903952 22.36118059029515 28.88944472236118 25.587793896948476 9 23.936968484242122 21.38569284642321 30.490245122561284 24.187093546773387 10-11 24.499749874937468 28.676838419209606 24.19959979989995 22.623811905952977 12-13 25.025012506253123 22.623811905952977 25.087543771885944 27.263631815907953 14-15 23.88694347173587 24.262131065532767 25.925462731365684 25.925462731365684 16-17 24.72486243121561 24.337168584292147 24.387193596798397 26.550775387693847 18-19 24.174587293646823 24.54977488744372 26.500750375187593 24.77488744372186 20-21 24.062031015507753 24.312156078039017 25.850425212606304 25.775387693846923 22-23 25.63781890945473 23.58679339669835 24.61230615307654 26.163081540770385 24-25 25.025012506253123 24.73736868434217 24.874937468734366 25.362681340670335 26-27 24.752970606629145 24.86554096310194 23.602251407129458 26.779237023139462 28-29 24.574787393696848 25.22511255627814 24.12456228114057 26.075537768884445 30-31 24.6248124062031 23.78689344672336 24.274637318659327 27.313656828414207 32-33 25.012506253126567 24.299649824912457 24.73736868434217 25.950475237618807 34-35 24.64982491245623 23.686843421710854 25.287643821910955 26.375687843921963 36-37 24.499749874937468 23.536768384192097 24.83741870935468 27.126063031515756 38-39 24.88744372186093 23.774387193596798 24.224612306153077 27.113556778389196 40-41 24.049524762381193 25.53776888444222 24.187093546773387 26.225612806403202 42-43 25.162581290645324 23.724362181090545 24.337168584292147 26.775887943971988 44-45 25.0 24.79989994997499 24.224612306153077 25.975487743871934 46-47 24.931198398799097 24.856142106579934 24.10557918438829 26.10708031023267 48-49 24.198798197295943 24.486730095142715 24.586880320480724 26.727591387080622 50-51 24.418313735301474 24.73104828621466 24.11808856642482 26.732549412059043 52-53 24.987487487487485 24.486986986986985 23.96146146146146 26.564064064064063 54-55 24.83733733733734 25.350350350350347 23.21071071071071 26.601601601601605 56-57 24.44305381727159 25.594493116395494 23.554443053817273 26.408010012515643 58-59 25.06883604505632 25.857321652065078 23.291614518147686 25.782227784730914 60-61 25.015650431951926 24.026543132590458 24.852885939651934 26.104920495805683 62-63 24.3920782150915 24.32940586613186 24.68037102030584 26.598144898470792 64-65 24.62986198243413 24.755332496863236 23.764115432873275 26.85069008782936 66-67 24.45392919909616 24.956063268892795 23.612854632186796 26.977152899824254 68-69 25.740833751883475 24.39728779507785 24.196383726770467 25.665494726268207 70-71 23.884349465744815 24.94028912633564 24.550597108736643 26.6247642991829 72-73 24.861040929762506 25.138959070237494 23.496715512885295 26.503284487114705 74-75 25.623582766439913 21.968787515006003 24.556489262371613 27.85114045618247 76 27.165499447106523 0.0 33.94765941761887 38.8868411352746 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 16.0 1 9.0 2 1.5 3 2.5 4 4.0 5 2.5 6 0.5 7 0.5 8 1.0 9 3.5 10 8.0 11 11.5 12 13.0 13 7.5 14 1.5 15 1.0 16 1.0 17 1.0 18 2.0 19 2.0 20 1.5 21 3.0 22 3.0 23 2.0 24 2.5 25 3.0 26 2.0 27 2.5 28 5.0 29 6.0 30 8.0 31 10.5 32 20.5 33 28.5 34 30.5 35 48.5 36 68.0 37 78.5 38 96.5 39 120.0 40 133.0 41 135.5 42 147.0 43 176.0 44 210.5 45 212.5 46 194.0 47 199.5 48 212.0 49 196.5 50 178.5 51 189.0 52 180.0 53 160.5 54 155.5 55 145.5 56 141.5 57 137.0 58 132.5 59 122.5 60 110.0 61 107.5 62 103.0 63 86.5 64 79.5 65 78.5 66 78.5 67 80.0 68 74.0 69 71.5 70 62.0 71 52.0 72 50.5 73 51.5 74 43.5 75 33.5 76 29.0 77 25.0 78 19.5 79 15.5 80 14.5 81 12.5 82 8.5 83 5.5 84 5.0 85 4.0 86 2.0 87 1.0 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.1 3 0.05 4 0.05 5 0.05 6 0.675 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.0625 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.07505629221916438 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 2.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 3.0 61 0.0 62 6.0 63 0.0 64 2.0 65 1.0 66 0.0 67 0.0 68 2.0 69 3.0 70 1.0 71 7.0 72 24.0 73 65.0 74 265.0 75 903.0 76 2713.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.525 #Duplication Level Percentage of deduplicated Percentage of total 1 97.66899766899768 94.27499999999999 2 1.7353017353017353 3.35 3 0.3108003108003108 0.8999999999999999 4 0.1813001813001813 0.7000000000000001 5 0.0518000518000518 0.25 6 0.0 0.0 7 0.0259000259000259 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0259000259000259 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 14 0.35000000000000003 No Hit GCAGAAATTTGAATGATGCGTCGCCGGCACGAGGGCCGTGCGATCCGTCG 7 0.17500000000000002 No Hit CCTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAAT 5 0.125 No Hit CTCAAACTTCCGTCGCCTAAACGGCGATAGTCCCTCTAAGAAGCTAGCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18888531 read2 length is 45-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18888531_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 45-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.637 32.0 32.0 32.0 32.0 32.0 2 30.47875 32.0 32.0 32.0 32.0 32.0 3 30.5815 32.0 32.0 32.0 32.0 32.0 4 30.448 32.0 32.0 32.0 32.0 32.0 5 30.453 32.0 32.0 32.0 32.0 32.0 6 33.94 36.0 36.0 36.0 32.0 36.0 7 33.8345 36.0 36.0 36.0 32.0 36.0 8 33.74325 36.0 36.0 36.0 27.0 36.0 9 33.9675 36.0 36.0 36.0 32.0 36.0 10-11 33.579875 36.0 36.0 36.0 27.0 36.0 12-13 33.622375000000005 36.0 36.0 36.0 26.5 36.0 14-15 33.684749999999994 36.0 36.0 36.0 29.5 36.0 16-17 33.598625 36.0 36.0 36.0 29.5 36.0 18-19 33.496750000000006 36.0 36.0 36.0 24.0 36.0 20-21 33.65775 36.0 36.0 36.0 27.0 36.0 22-23 33.9095 36.0 36.0 36.0 32.0 36.0 24-25 33.714875 36.0 36.0 36.0 32.0 36.0 26-27 33.6935 36.0 36.0 36.0 29.5 36.0 28-29 33.41825 36.0 36.0 36.0 27.0 36.0 30-31 33.540375 36.0 36.0 36.0 27.0 36.0 32-33 33.48025 36.0 36.0 36.0 24.0 36.0 34-35 33.742125 36.0 36.0 36.0 29.5 36.0 36-37 33.631 36.0 36.0 36.0 26.5 36.0 38-39 33.575625 36.0 36.0 36.0 24.0 36.0 40-41 33.402249999999995 36.0 36.0 36.0 21.0 36.0 42-43 33.50775 36.0 36.0 36.0 24.0 36.0 44-45 33.518625 36.0 36.0 36.0 27.0 36.0 46-47 33.54951237809452 36.0 36.0 36.0 21.0 36.0 48-49 33.58714678669668 36.0 36.0 36.0 27.0 36.0 50-51 33.63053263315829 36.0 36.0 36.0 27.0 36.0 52-53 33.5276388194097 36.0 36.0 36.0 24.0 36.0 54-55 33.602426213106554 36.0 36.0 36.0 21.0 36.0 56-57 33.505629221916436 36.0 36.0 36.0 21.0 36.0 58-59 33.26594946209657 36.0 36.0 36.0 21.0 36.0 60-61 33.305878695451234 36.0 36.0 36.0 21.0 36.0 62-63 33.36479393111733 36.0 36.0 36.0 21.0 36.0 64-65 33.34374674449842 36.0 36.0 36.0 21.0 36.0 66-67 33.275965880582035 36.0 36.0 36.0 21.0 36.0 68-69 33.247049474868874 36.0 36.0 36.0 21.0 36.0 70-71 33.08648977853815 36.0 36.0 36.0 17.5 36.0 72-73 33.159137518732265 36.0 36.0 36.0 14.0 36.0 74-75 33.278799231446435 36.0 36.0 36.0 21.0 36.0 76 32.956245325355276 36.0 36.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 9.0 15 12.0 16 13.0 17 12.0 18 14.0 19 12.0 20 14.0 21 23.0 22 21.0 23 31.0 24 41.0 25 43.0 26 50.0 27 61.0 28 74.0 29 96.0 30 117.0 31 183.0 32 229.0 33 364.0 34 650.0 35 1931.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.76818866031109 15.127947817360763 13.572503763171099 37.53135975915705 2 25.45 23.974999999999998 26.525 24.05 3 24.88122030507627 26.03150787696924 21.80545136284071 27.28182045511378 4 26.950000000000003 28.875 18.575 25.6 5 28.95 29.75 19.1 22.2 6 25.025 32.025 18.7 24.25 7 22.925 20.5 30.5 26.075 8 24.48112028007002 23.15578894723681 23.23080770192548 29.132283070767688 9 26.450000000000003 22.25 24.7 26.6 10-11 27.287499999999998 27.737499999999997 19.6875 25.2875 12-13 27.187499999999996 22.45 23.2625 27.1 14-15 25.35 24.525 23.4625 26.6625 16-17 27.01113474290004 24.734142374577754 22.38208432378331 25.8726385587389 18-19 26.718417428321022 24.38963315387505 22.86215099536747 26.029798422436457 20-21 26.95336917114639 23.952994124265533 23.827978497312163 25.26565820727591 22-23 26.775 24.5125 23.4125 25.3 24-25 26.8125 24.275 23.0125 25.900000000000002 26-27 26.28485682130799 25.334500437664126 23.071151681880707 25.30949105914718 28-29 26.4761188416698 24.59571267393757 23.25435627428858 25.673812210104046 30-31 25.9407425928241 24.915614451806476 23.27790973871734 25.86573321665208 32-33 26.187500000000004 25.2875 22.662499999999998 25.8625 34-35 25.974999999999998 25.874999999999996 22.575 25.575 36-37 26.178272284035504 25.30316289536192 22.46530816352044 26.053256657082137 38-39 26.82011508631474 25.68176132099074 22.041531148361273 25.456592444333246 40-41 25.785455000625863 24.896733007885842 23.30704718988609 26.010764801602203 42-43 25.81453634085213 24.51127819548872 23.333333333333332 26.340852130325814 44-45 26.39809833604404 25.084448892781186 23.032653571875393 25.484799199299385 46-47 25.55638909727432 25.10627656914228 22.093023255813954 27.24431107776944 48-49 25.84889111640145 26.149605312617467 21.977195840120288 26.024307730860798 50-51 26.25516464254413 25.46638287216727 22.47402028295981 25.804432202328787 52-53 27.07603801900951 24.312156078039017 22.961480740370185 25.65032516258129 54-55 26.588294147073537 24.84992496248124 22.611305652826413 25.950475237618807 56-57 26.072813711998 25.034405104466405 23.508069560865756 25.384711622669837 58-59 25.300902708124372 25.125376128385156 22.993981945837515 26.57973921765296 60-61 26.581325301204817 25.301204819277107 22.828815261044177 25.288654618473892 62-63 27.34796238244514 25.956112852664575 21.655172413793103 25.04075235109718 64-65 27.13819914722849 24.667669927263606 22.661148733383495 25.532982192124404 66-67 26.455092824887107 25.802809834420472 22.466131460110386 25.275965880582035 68-69 26.57465495608532 25.897114178168128 22.534504391468005 24.993726474278542 70-71 25.916131469588212 25.576123913864752 23.007177937287494 25.50056667925954 72-73 26.45495951417004 25.29099190283401 22.811234817813766 25.442813765182187 74-75 26.4120710375217 22.780077446922153 24.47589798370944 26.331953531846708 76 29.24457741211668 0.0 33.7322363500374 37.02318623784592 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 16.0 1 12.0 2 6.5 3 5.5 4 6.0 5 3.5 6 3.0 7 3.0 8 1.0 9 3.0 10 4.0 11 6.5 12 10.0 13 6.5 14 1.5 15 1.5 16 2.0 17 0.5 18 0.0 19 0.5 20 1.5 21 2.5 22 1.5 23 1.0 24 2.0 25 3.5 26 5.0 27 6.5 28 9.5 29 12.0 30 13.5 31 14.0 32 14.0 33 20.0 34 32.5 35 47.5 36 59.5 37 78.5 38 103.0 39 110.0 40 118.5 41 136.5 42 153.5 43 168.5 44 184.0 45 187.5 46 181.5 47 182.5 48 185.5 49 181.0 50 166.5 51 167.5 52 165.0 53 151.0 54 143.0 55 132.0 56 129.0 57 127.5 58 124.0 59 118.0 60 114.5 61 113.5 62 106.0 63 104.0 64 94.0 65 97.0 66 103.5 67 94.5 68 87.5 69 76.0 70 63.5 71 59.0 72 58.5 73 55.0 74 54.0 75 55.0 76 51.0 77 36.5 78 26.5 79 25.0 80 19.5 81 13.5 82 8.5 83 4.0 84 2.5 85 2.5 86 4.0 87 5.5 88 3.5 89 1.5 90 1.0 91 0.0 92 0.0 93 0.0 94 1.0 95 1.5 96 1.0 97 0.5 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.08750000000000001 18-19 0.1625 20-21 0.0125 22-23 0.0 24-25 0.0 26-27 0.0375 28-29 0.2875 30-31 0.0125 32-33 0.0 34-35 0.0 36-37 0.0125 38-39 0.075 40-41 0.13749999999999998 42-43 0.25 44-45 0.08750000000000001 46-47 0.0 48-49 0.21255313828457112 50-51 0.13753438359589898 52-53 0.0 54-55 0.0 56-57 0.012509382036527395 58-59 0.2251688766574931 60-61 0.2878238017769991 62-63 0.08769731896767727 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.20108080935025766 72-73 0.20202020202020202 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 3.0 61 0.0 62 6.0 63 0.0 64 2.0 65 0.0 66 0.0 67 0.0 68 2.0 69 4.0 70 3.0 71 7.0 72 20.0 73 80.0 74 251.0 75 945.0 76 2674.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.07247494217425 95.39999999999999 2 1.3621177075301978 2.65 3 0.41120534566949374 1.2 4 0.07710100231303006 0.3 5 0.02570033410434336 0.125 6 0.02570033410434336 0.15 7 0.02570033410434336 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 7 0.17500000000000002 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 6 0.15 No Hit CTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129113 spots for SRR18888531.sra Written 2129113 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra Read 2129102 spots for SRR18888531.sra Written 2129102 spots for SRR18888531.sra SRR ids: ['SRR18888531.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_se1gdd3a SRR18888531.sra spots: 42582051 blocks: [[1, 2129102], [2129103, 4258204], [4258205, 6387306], [6387307, 8516408], [8516409, 10645510], [10645511, 12774612], [12774613, 14903714], [14903715, 17032816], [17032817, 19161918], [19161919, 21291020], [21291021, 23420122], [23420123, 25549224], [25549225, 27678326], [27678327, 29807428], [29807429, 31936530], [31936531, 34065632], [34065633, 36194734], [36194735, 38323836], [38323837, 40452938], [40452939, 42582051]] SRR18888531 file size 8124101 SRR18888531 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18888531 SRR18888531_1.fastq SRR18888531_2.fastq Input file: SRR18888531_1.fastq Paired file: SRR18888531_2.fastq trimmed: SRR18888531-trimmed-pair1.fastq, SRR18888531-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:20:19 2024 >> started Tue Dec 10 05:20:58 2024 >> done (38.995s) 42582051 read pairs processed; of these: 9 ( 0.00%) short read pairs filtered out after trimming by size control 41165 ( 0.10%) empty read pairs filtered out after trimming by size control 42540877 (99.90%) read pairs available; of these: 56649 ( 0.13%) trimmed read pairs available after processing 42484228 (99.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 5 0.00% 22 43 0.00% 23 69 0.00% 24 129 0.00% 25 142 0.00% 26 189 0.00% 27 195 0.00% 28 240 0.00% 29 352 0.00% 30 377 0.00% 31 1152 0.00% 32 1262 0.00% 33 604 0.00% 34 1622 0.00% 35 990 0.00% 36 1064 0.00% 37 1194 0.00% 38 1318 0.00% 39 1330 0.00% 40 1603 0.00% 41 1682 0.00% 42 1828 0.00% 43 2051 0.00% 44 2033 0.00% 45 2184 0.01% 46 2254 0.01% 47 2554 0.01% 48 2778 0.01% 49 3079 0.01% 50 3354 0.01% 51 3784 0.01% 52 4167 0.01% 53 4391 0.01% 54 4874 0.01% 55 5291 0.01% 56 5439 0.01% 57 5808 0.01% 58 6529 0.02% 59 6997 0.02% 60 7806 0.02% 61 8291 0.02% 62 9287 0.02% 63 10122 0.02% 64 10953 0.03% 65 11960 0.03% 66 12717 0.03% 67 14197 0.03% 68 14943 0.04% 69 16956 0.04% 70 22449 0.05% 71 27037 0.06% 72 47266 0.11% 73 337985 0.79% 74 3003634 7.06% 75 19091000 44.88% 76 19809314 46.57% 42540877 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=7.99 fanout-score-rank=22 prefix-density=0.22 prefix-fanout=4.6 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=427.90 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=33.0 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=132.92 fanout-score-rank=15 prefix-density=1.47 prefix-fanout=19.4 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=382.70 fanout-score-rank=1 prefix-density=1.30 prefix-fanout=20.9 sequence=GCCGCCGCCATG SRR18888531 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:21:57 Started mapping on | Dec 10 05:21:57 Finished on | Dec 10 05:25:09 Mapping speed, Million of reads per hour | 797.64 Number of input reads | 42540877 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 33470181 Uniquely mapped reads % | 78.68% Average mapped length | 150.37 Number of splices: Total | 14852236 Number of splices: Annotated (sjdb) | 14107840 Number of splices: GT/AG | 14652845 Number of splices: GC/AG | 169673 Number of splices: AT/AC | 10378 Number of splices: Non-canonical | 19340 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 1.81 Insertion rate per base | 0.01% Insertion average length | 1.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1948063 % of reads mapped to multiple loci | 4.58% Number of reads mapped to too many loci | 1710500 % of reads mapped to too many loci | 4.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.70% % of reads unmapped: other | 9.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7122640 7122640 7122640 N_multimapping 1948063 1948063 1948063 N_noFeature 1048355 32323425 1727769 N_ambiguous 631064 5574 176485 UnstrandedReadsAssigned:31790762 PositiveStrandReadsAssigned:1141182 NegativeStrandReadsAssigned:31565927 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR18888531 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18888531-trimmed-pair1.fastq SRR18888531-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,540,877 reads, 33,256,913 reads pseudoaligned [quant] estimated average fragment length: 158.188 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52973 SRR18888531.ke.tsv 35125 SRR18888531.se.tsv 88098 total ==> SRR18888531.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 779.003 0 0 PNS24247 1044 886.812 54.5036 2.68282 PNS24249 1928 1770.81 600.771 14.8093 PNS24246 1044 886.812 54.5036 2.68282 PNS24248 1044 886.812 54.5036 2.68282 PNS24244 1471 1313.81 59.7186 1.98415 PNS24243 293 140.793 1 0.31004 KQK14069 1603 1445.81 1250.51 37.7549 KQK14071 474 317.997 240.983 33.0797 ==> SRR18888531.se.tsv <== BRADI_1g14170v3 1693 BRADI_1g53295v3 19 BRADI_1g59795v3 579 BRADI_1g07683v3 0 BRADI_1g00485v3 61 BRADI_1g20270v3 3320 BRADI_1g74790v3 89 BRADI_1g09890v3 0 BRADI_1g77505v3 713 BRADI_1g48960v3 2 SRR18888531 completed mapping pipeline successfully