Starting /dee2/code/volunteer_pipeline.sh SRR18888532 current disk space = 1525970112512 free memory = 1599189184 SRR18888532 SRAfilesize 161d4d464eb63ee2bb06bcb8515f3de0 SRR18888532.sra SRR18888532.sra file validated SRR18888532 is paired end SRR18888532 is conventional basespace SRR18888532 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18888532_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.34025 32.0 32.0 32.0 32.0 32.0 2 31.4585 32.0 32.0 32.0 32.0 32.0 3 31.45375 32.0 32.0 32.0 32.0 32.0 4 31.5835 32.0 32.0 32.0 32.0 32.0 5 31.56675 32.0 32.0 32.0 32.0 32.0 6 34.74575 36.0 36.0 36.0 36.0 36.0 7 34.898 36.0 36.0 36.0 32.0 36.0 8 35.0235 36.0 36.0 36.0 32.0 36.0 9 34.88475 36.0 36.0 36.0 32.0 36.0 10-11 34.896249999999995 36.0 36.0 36.0 32.0 36.0 12-13 34.907375 36.0 36.0 36.0 32.0 36.0 14-15 34.958 36.0 36.0 36.0 32.0 36.0 16-17 34.911500000000004 36.0 36.0 36.0 32.0 36.0 18-19 34.879374999999996 36.0 36.0 36.0 32.0 36.0 20-21 34.8785 36.0 36.0 36.0 32.0 36.0 22-23 34.78075 36.0 36.0 36.0 32.0 36.0 24-25 34.78 36.0 36.0 36.0 32.0 36.0 26-27 34.662125 36.0 36.0 36.0 32.0 36.0 28-29 34.76 36.0 36.0 36.0 32.0 36.0 30-31 34.7085 36.0 36.0 36.0 32.0 36.0 32-33 34.5565 36.0 36.0 36.0 32.0 36.0 34-35 34.622749999999996 36.0 36.0 36.0 32.0 36.0 36-37 34.6615807903952 36.0 36.0 36.0 32.0 36.0 38-39 34.59154577288644 36.0 36.0 36.0 32.0 36.0 40-41 34.541645822911455 36.0 36.0 36.0 32.0 36.0 42-43 34.524585944463354 36.0 36.0 36.0 32.0 36.0 44-45 34.539799749687106 36.0 36.0 36.0 32.0 36.0 46-47 34.48310387984981 36.0 36.0 36.0 32.0 36.0 48-49 34.47609511889863 36.0 36.0 36.0 32.0 36.0 50-51 34.508385481852315 36.0 36.0 36.0 32.0 36.0 52-53 34.37064109932107 36.0 36.0 36.0 32.0 36.0 54-55 34.35286751815677 36.0 36.0 36.0 32.0 36.0 56-57 34.25920360631105 36.0 36.0 36.0 32.0 36.0 58-59 34.3236074578408 36.0 36.0 36.0 32.0 36.0 60-61 34.213927855711425 36.0 36.0 36.0 32.0 36.0 62-63 34.278213844376296 36.0 36.0 36.0 32.0 36.0 64-65 34.27090742337721 36.0 36.0 36.0 32.0 36.0 66-67 34.14247683451861 36.0 36.0 36.0 32.0 36.0 68-69 34.12079439855003 36.0 36.0 36.0 32.0 36.0 70-71 34.18065089598938 36.0 36.0 36.0 32.0 36.0 72-73 33.98224628557038 36.0 36.0 36.0 29.5 36.0 74-75 34.04107340237971 36.0 36.0 36.0 32.0 36.0 76 33.85066371681416 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 5.0 22 9.0 23 12.0 24 17.0 25 16.0 26 29.0 27 33.0 28 36.0 29 87.0 30 86.0 31 127.0 32 183.0 33 291.0 34 699.0 35 2367.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.934483620905226 8.752188047011753 10.127531882970743 43.18579644911228 2 21.1408556417313 13.635226419814861 31.523642732049034 33.700275206404804 3 22.80570142535634 16.504126031507877 19.629907476869217 41.06026506626657 4 27.431857964491122 23.20580145036259 17.20430107526882 32.15803950987747 5 26.25656414103526 27.081770442610654 20.855213803450862 25.806451612903224 6 25.044047319405994 31.36169141706519 22.250188774226025 21.344072489302793 7 20.255063765941486 22.53063265816454 34.60865216304076 22.605651412853213 8 22.980745186296573 22.230557639409852 28.68217054263566 26.106526631657918 9 22.88072018004501 21.8304576144036 30.682670667666915 24.60615153788447 10-11 24.90622655663916 28.91972993248312 22.818204551137786 23.355838959739934 12-13 24.55613903475869 22.655663915978995 26.056514128532132 26.731682920730183 14-15 23.280820205051263 24.568642160540136 26.19404851212803 25.95648912228057 16-17 24.50612653163291 24.781195298824706 25.831457864466117 24.88122030507627 18-19 24.90622655663916 24.33108277069267 24.756189047261813 26.006501625406354 20-21 23.69342335583896 25.71892973243311 24.69367341835459 25.893973493373345 22-23 24.468617154288573 24.843710927731934 24.956239059764943 25.731432858214554 24-25 24.218554638659665 24.681170292573142 24.468617154288573 26.63165791447862 26-27 24.274637318659327 24.83741870935468 24.287143571785894 26.600800400200097 28-29 24.98436913842691 25.209453545079402 23.983993997749156 25.82218331874453 30-31 25.71892973243311 24.18104526131533 23.730932733183295 26.36909227306827 32-33 25.26263131565783 24.524762381190595 24.562281140570285 25.65032516258129 34-35 24.68734367183592 24.862431215607803 23.699349674837418 26.750875437718857 36-37 24.637318659329665 24.824912456228116 24.224612306153077 26.313156578289142 38-39 24.54977488744372 24.112056028014006 24.899949974987493 26.43821910955478 40-41 24.79989994997499 25.83791895947974 22.886443221610804 26.475737868934466 42-43 25.184536469410734 24.771675215813836 24.183660703115226 25.860127611660204 44-45 24.81852315394243 24.718397997496872 24.23028785982478 26.23279098873592 46-47 25.544430538172712 25.90738423028786 22.803504380475594 25.744680851063826 48-49 25.591882750845546 24.351747463359636 23.299511461856444 26.75685832393837 50-51 24.668335419274094 24.96871088861076 23.44180225281602 26.921151439299123 52-53 24.959319063712606 25.397421454499934 23.056702966579046 26.58655651520841 54-55 25.244177310293015 25.156523916854496 22.739794640621085 26.859504132231404 56-57 25.169045830202858 25.093914350112694 23.904332582018533 25.832707237665915 58-59 23.71947401377583 25.710707576706326 24.007514088916718 26.562304320601125 60-61 26.23997995991984 24.160821643286575 22.77054108216433 26.828657314629258 62-63 25.04071151196292 26.067894275335085 23.349617938118502 25.541776274583487 64-65 25.764411027568922 24.862155388471177 23.63408521303258 25.739348370927317 66-67 26.08804715916217 25.749404239307665 22.162297754922864 26.000250846607297 68-69 25.728277247614262 24.083375188347564 23.204419889502763 26.98392767453541 70-71 24.839723444374606 25.83280955373979 23.280955373978628 26.046511627906977 72-73 25.48277167739493 24.422567209390383 23.665278303672853 26.429382809541842 74-75 26.44045242847638 22.75449101796407 23.526280771789754 27.27877578176979 76 26.327433628318587 0.0 32.448377581120944 41.224188790560476 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 21.0 1 12.5 2 2.5 3 1.0 4 1.0 5 0.5 6 0.0 7 2.0 8 4.5 9 4.0 10 9.5 11 17.0 12 18.0 13 10.0 14 1.5 15 1.5 16 1.0 17 0.5 18 1.5 19 2.5 20 3.5 21 2.5 22 1.0 23 2.0 24 3.0 25 2.5 26 1.0 27 1.0 28 3.5 29 8.0 30 8.0 31 11.5 32 19.5 33 23.0 34 35.5 35 51.0 36 60.0 37 70.5 38 91.0 39 103.5 40 126.0 41 151.0 42 158.5 43 179.5 44 196.5 45 197.0 46 198.5 47 198.5 48 193.5 49 189.0 50 190.0 51 187.0 52 171.5 53 151.0 54 138.5 55 144.0 56 146.0 57 131.5 58 118.5 59 117.5 60 109.0 61 104.0 62 101.0 63 84.0 64 87.0 65 86.0 66 79.5 67 87.0 68 78.0 69 66.5 70 66.5 71 66.5 72 55.5 73 50.5 74 48.0 75 42.0 76 37.0 77 27.5 78 22.0 79 17.5 80 14.5 81 11.5 82 8.0 83 6.0 84 4.0 85 1.5 86 0.0 87 0.5 88 2.0 89 2.5 90 1.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.075 3 0.025 4 0.025 5 0.025 6 0.675 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.05 28-29 0.0375 30-31 0.025 32-33 0.05 34-35 0.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.08760951188986232 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.013304949441192123 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 2.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 1.0 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 2.0 65 1.0 66 3.0 67 2.0 68 2.0 69 1.0 70 5.0 71 4.0 72 19.0 73 77.0 74 234.0 75 929.0 76 2712.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.61892583120205 96.39999999999999 2 1.0741687979539642 2.1 3 0.1278772378516624 0.375 4 0.10230179028132991 0.4 5 0.025575447570332477 0.125 6 0.025575447570332477 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025575447570332477 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 18 0.44999999999999996 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 6 0.15 No Hit GTAGGAGCGACGGGCGGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18888532 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18888532_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.63775 32.0 32.0 32.0 32.0 32.0 2 30.314 32.0 32.0 32.0 21.0 32.0 3 30.489 32.0 32.0 32.0 32.0 32.0 4 30.5705 32.0 32.0 32.0 32.0 32.0 5 30.505 32.0 32.0 32.0 32.0 32.0 6 33.80475 36.0 36.0 36.0 32.0 36.0 7 33.82075 36.0 36.0 36.0 32.0 36.0 8 33.50675 36.0 36.0 36.0 27.0 36.0 9 33.80025 36.0 36.0 36.0 32.0 36.0 10-11 33.594625 36.0 36.0 36.0 24.0 36.0 12-13 33.604 36.0 36.0 36.0 27.0 36.0 14-15 33.554125 36.0 36.0 36.0 29.5 36.0 16-17 33.499875 36.0 36.0 36.0 29.5 36.0 18-19 33.474875 36.0 36.0 36.0 29.5 36.0 20-21 33.584375 36.0 36.0 36.0 27.0 36.0 22-23 33.819874999999996 36.0 36.0 36.0 32.0 36.0 24-25 33.618625 36.0 36.0 36.0 32.0 36.0 26-27 33.661249999999995 36.0 36.0 36.0 29.5 36.0 28-29 33.423625 36.0 36.0 36.0 27.0 36.0 30-31 33.4695 36.0 36.0 36.0 27.0 36.0 32-33 33.406375 36.0 36.0 36.0 27.0 36.0 34-35 33.4585 36.0 36.0 36.0 24.0 36.0 36-37 33.515628907226805 36.0 36.0 36.0 27.0 36.0 38-39 33.49074768692173 36.0 36.0 36.0 24.0 36.0 40-41 33.54513628407102 36.0 36.0 36.0 27.0 36.0 42-43 33.48968457834121 36.0 36.0 36.0 27.0 36.0 44-45 33.53953953953954 36.0 36.0 36.0 24.0 36.0 46-47 33.51551551551552 36.0 36.0 36.0 24.0 36.0 48-49 33.37362362362362 36.0 36.0 36.0 21.0 36.0 50-51 33.50613113113113 36.0 36.0 36.0 24.0 36.0 52-53 33.45626931687633 36.0 36.0 36.0 21.0 36.0 54-55 33.42248935637365 36.0 36.0 36.0 21.0 36.0 56-57 33.355497119959935 36.0 36.0 36.0 21.0 36.0 58-59 33.36493839795795 36.0 36.0 36.0 21.0 36.0 60-61 33.326528056112224 36.0 36.0 36.0 17.5 36.0 62-63 33.25904970175882 36.0 36.0 36.0 21.0 36.0 64-65 33.33496572477344 36.0 36.0 36.0 21.0 36.0 66-67 33.27923610857667 36.0 36.0 36.0 17.5 36.0 68-69 33.01054122158803 36.0 36.0 36.0 14.0 36.0 70-71 33.08547161754062 36.0 36.0 36.0 21.0 36.0 72-73 32.987315240411306 36.0 36.0 36.0 14.0 36.0 74-75 33.22802135489473 36.0 36.0 36.0 21.0 36.0 76 32.8944817300522 36.0 36.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 11.0 15 11.0 16 17.0 17 16.0 18 18.0 19 9.0 20 17.0 21 26.0 22 29.0 23 29.0 24 28.0 25 47.0 26 37.0 27 67.0 28 73.0 29 113.0 30 120.0 31 166.0 32 239.0 33 339.0 34 672.0 35 1915.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.98995983935743 15.210843373493976 13.253012048192772 36.54618473895582 2 24.575 24.7 27.025 23.7 3 24.825 25.6 21.15 28.425 4 28.499999999999996 28.000000000000004 16.875 26.625 5 27.775 29.175 19.425 23.625 6 25.025 33.0 19.15 22.825 7 24.2 18.6 31.15 26.05 8 24.706176544136035 22.605651412853213 23.305826456614152 29.382345586396596 9 26.3 22.325 24.575 26.8 10-11 26.1125 28.462500000000002 19.5875 25.837500000000002 12-13 27.200000000000003 22.662499999999998 22.25 27.8875 14-15 25.2375 24.775 24.5375 25.45 16-17 26.31776637035182 24.001502441467384 23.06247652435207 26.618254663828722 18-19 26.345431789737173 24.09261576971214 23.704630788485606 25.857321652065078 20-21 27.306826706676667 23.380845211302827 23.830957739434858 25.481370342585645 22-23 26.325 23.45 23.0875 27.1375 24-25 25.50318789848731 24.953119139892486 23.31541442680335 26.22827853481685 26-27 26.28814407203602 25.337668834417208 22.786393196598297 25.587793896948476 28-29 26.795337761624268 23.77490913648327 22.734678531144255 26.69507457074821 30-31 26.35329416177022 25.440680085010626 22.415301912739093 25.790723840480062 32-33 26.70667666916729 25.156289072268066 22.768192048012004 25.36884221055264 34-35 27.33183295823956 23.755938984746187 22.9057264316079 26.006501625406354 36-37 26.4599224709266 24.471676878829562 23.62135800925347 25.447042640990368 38-39 25.985730379271498 25.172111653523594 22.906496432594817 25.935661534610087 40-41 26.22684026039059 23.660490736104155 23.42263395092639 26.69003505257887 42-43 25.626880641925776 24.32296890672016 23.08174523570712 26.96840521564694 44-45 27.29208416833667 24.148296593186373 23.49699398797595 25.062625250501004 46-47 25.74145914153423 25.12826930296584 23.000875985483667 26.129395570016268 48-49 25.49216300940439 25.141065830721004 23.87460815047022 25.49216300940439 50-51 26.76938494300388 25.00313165476638 22.735813603908305 25.491669798321432 52-53 26.545682102628287 23.867334167709636 23.69211514392991 25.894868585732166 54-55 26.72176308539945 24.61808164287503 23.040320560981716 25.6198347107438 56-57 26.86286787726988 25.059486537257357 23.105823418910457 24.971822166562305 58-59 26.223951795129302 24.71754958573939 22.721566658297764 26.336931960833542 60-61 26.65829145728643 25.28894472361809 22.964824120603016 25.087939698492463 62-63 26.9717868338558 25.55485893416928 22.369905956112852 25.103448275862068 64-65 27.10866023311192 24.326356686301544 22.772277227722775 25.79270585286377 66-67 25.15991471215352 25.486015301643043 23.128057193026464 26.226012793176974 68-69 25.929181315921646 25.489703666499246 22.903063787041688 25.67805123053742 70-71 26.33832976445396 25.758911701725655 22.685476760297266 25.217281773523116 72-73 26.102382159148508 24.885960466294982 23.378104409528635 25.633552965027878 74-75 27.009345794392527 22.336448598130843 23.190921228304408 27.463284379172233 76 28.747203579418347 0.0 32.96047725577927 38.292319164802386 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 19.0 1 15.5 2 7.5 3 4.5 4 6.0 5 4.0 6 4.0 7 5.5 8 5.0 9 7.5 10 7.5 11 5.5 12 6.0 13 6.5 14 4.5 15 1.5 16 1.0 17 1.0 18 2.5 19 2.0 20 0.0 21 0.0 22 1.5 23 3.0 24 4.0 25 5.0 26 4.5 27 5.0 28 6.0 29 5.5 30 7.5 31 11.5 32 18.5 33 26.0 34 35.5 35 48.5 36 59.5 37 70.0 38 87.0 39 100.5 40 117.5 41 160.5 42 180.0 43 173.5 44 183.5 45 183.5 46 180.0 47 183.0 48 180.0 49 177.0 50 176.0 51 172.0 52 162.0 53 149.5 54 141.5 55 130.0 56 124.5 57 127.5 58 132.5 59 125.0 60 105.5 61 104.0 62 101.5 63 92.5 64 89.5 65 96.5 66 104.0 67 102.0 68 96.0 69 92.0 70 86.5 71 83.5 72 76.5 73 61.0 74 49.0 75 42.0 76 39.5 77 31.5 78 24.5 79 24.5 80 20.5 81 15.5 82 11.0 83 8.0 84 6.5 85 4.0 86 3.5 87 4.0 88 2.5 89 1.5 90 2.0 91 3.0 92 4.0 93 2.0 94 0.0 95 0.5 96 1.0 97 1.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.1625 18-19 0.125 20-21 0.025 22-23 0.0 24-25 0.0125 26-27 0.05 28-29 0.2625 30-31 0.0125 32-33 0.025 34-35 0.025 36-37 0.012503125781445362 38-39 0.11252813203300824 40-41 0.12503125781445362 42-43 0.23764853033145716 44-45 0.10010010010010009 46-47 0.012512512512512512 48-49 0.21271271271271272 50-51 0.11261261261261261 52-53 0.012514078338130395 54-55 0.0 56-57 0.012521913348359628 58-59 0.2379461490294302 60-61 0.30060120240480964 62-63 0.10021295252411375 64-65 0.012531328320802004 66-67 0.0 68-69 0.012554927809165096 70-71 0.23875345564212114 72-73 0.2275600505689001 74-75 0.013349352556401014 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 1.0 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 2.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 2.0 65 1.0 66 3.0 67 2.0 68 1.0 69 1.0 70 4.0 71 10.0 72 24.0 73 65.0 74 265.0 75 931.0 76 2682.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03894790085988 97.89999999999999 2 0.834597875569044 1.6500000000000001 3 0.07587253414264036 0.22499999999999998 4 0.025290844714213456 0.1 5 0.025290844714213456 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGAAAGTTGGGGGCTCGAAGACGATCAGATACCGTCCTAGTCTCAACCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978477 spots for SRR18888532.sra Written 1978477 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra Read 1978461 spots for SRR18888532.sra Written 1978461 spots for SRR18888532.sra SRR ids: ['SRR18888532.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iw3zgrrz SRR18888532.sra spots: 39569236 blocks: [[1, 1978461], [1978462, 3956922], [3956923, 5935383], [5935384, 7913844], [7913845, 9892305], [9892306, 11870766], [11870767, 13849227], [13849228, 15827688], [15827689, 17806149], [17806150, 19784610], [19784611, 21763071], [21763072, 23741532], [23741533, 25719993], [25719994, 27698454], [27698455, 29676915], [29676916, 31655376], [31655377, 33633837], [33633838, 35612298], [35612299, 37590759], [37590760, 39569236]] SRR18888532 file size 7546650 SRR18888532 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18888532 SRR18888532_1.fastq SRR18888532_2.fastq Input file: SRR18888532_1.fastq Paired file: SRR18888532_2.fastq trimmed: SRR18888532-trimmed-pair1.fastq, SRR18888532-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:20:48 2024 >> started Tue Dec 10 05:21:28 2024 >> done (40.481s) 39569236 read pairs processed; of these: 4 ( 0.00%) short read pairs filtered out after trimming by size control 41871 ( 0.11%) empty read pairs filtered out after trimming by size control 39527361 (99.89%) read pairs available; of these: 58666 ( 0.15%) trimmed read pairs available after processing 39468695 (99.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 5 0.00% 20 7 0.00% 21 11 0.00% 22 37 0.00% 23 69 0.00% 24 106 0.00% 25 166 0.00% 26 195 0.00% 27 194 0.00% 28 290 0.00% 29 359 0.00% 30 386 0.00% 31 1189 0.00% 32 1297 0.00% 33 579 0.00% 34 1685 0.00% 35 998 0.00% 36 1090 0.00% 37 1226 0.00% 38 1252 0.00% 39 1389 0.00% 40 1625 0.00% 41 1733 0.00% 42 1856 0.00% 43 2004 0.01% 44 2105 0.01% 45 2251 0.01% 46 2266 0.01% 47 2703 0.01% 48 2817 0.01% 49 3308 0.01% 50 3474 0.01% 51 3864 0.01% 52 4246 0.01% 53 4624 0.01% 54 4918 0.01% 55 5331 0.01% 56 5771 0.01% 57 6007 0.02% 58 6632 0.02% 59 7283 0.02% 60 8124 0.02% 61 8825 0.02% 62 9621 0.02% 63 10449 0.03% 64 11566 0.03% 65 12758 0.03% 66 13690 0.03% 67 14828 0.04% 68 15764 0.04% 69 17741 0.04% 70 22699 0.06% 71 27726 0.07% 72 47544 0.12% 73 318533 0.81% 74 2790811 7.06% 75 17724013 44.84% 76 18385321 46.51% 39527361 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=8.05 fanout-score-rank=22 prefix-density=0.26 prefix-fanout=4.7 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=299.99 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=16.3 sequence=GCGGCGGCGGAGG criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=134.13 fanout-score-rank=17 prefix-density=1.46 prefix-fanout=19.8 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=431.81 fanout-score-rank=1 prefix-density=1.30 prefix-fanout=21.7 sequence=GCCGCCGCCATG SRR18888532 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:22:03 Started mapping on | Dec 10 05:22:04 Finished on | Dec 10 05:24:41 Mapping speed, Million of reads per hour | 906.36 Number of input reads | 39527361 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 32330421 Uniquely mapped reads % | 81.79% Average mapped length | 150.37 Number of splices: Total | 14049873 Number of splices: Annotated (sjdb) | 13346451 Number of splices: GT/AG | 13862050 Number of splices: GC/AG | 159294 Number of splices: AT/AC | 9597 Number of splices: Non-canonical | 18932 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 1.78 Insertion rate per base | 0.01% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1789062 % of reads mapped to multiple loci | 4.53% Number of reads mapped to too many loci | 1168817 % of reads mapped to too many loci | 2.96% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.08% % of reads unmapped: other | 6.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5407880 5407880 5407880 N_multimapping 1789062 1789062 1789062 N_noFeature 1009365 31205602 1678443 N_ambiguous 615117 5466 171235 UnstrandedReadsAssigned:30705939 PositiveStrandReadsAssigned:1119353 NegativeStrandReadsAssigned:30480743 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR18888532 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18888532-trimmed-pair1.fastq SRR18888532-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,527,361 reads, 32,142,373 reads pseudoaligned [quant] estimated average fragment length: 156.796 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR18888532.ke.tsv 35125 SRR18888532.se.tsv 88098 total ==> SRR18888532.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 780.255 0 0 PNS24247 1044 888.204 52.3572 2.68363 PNS24249 1928 1772.2 481.554 12.3706 PNS24246 1044 888.204 52.3572 2.68363 PNS24248 1044 888.204 52.3572 2.68363 PNS24244 1471 1315.2 80.3739 2.78215 PNS24243 293 142.084 0 0 KQK14069 1603 1447.2 814.428 25.6202 KQK14071 474 319.221 234.134 33.3913 ==> SRR18888532.se.tsv <== BRADI_1g14170v3 1308 BRADI_1g53295v3 26 BRADI_1g59795v3 538 BRADI_1g07683v3 0 BRADI_1g00485v3 95 BRADI_1g20270v3 4243 BRADI_1g74790v3 93 BRADI_1g09890v3 0 BRADI_1g77505v3 689 BRADI_1g48960v3 1 SRR18888532 completed mapping pipeline successfully