Starting /dee2/code/volunteer_pipeline.sh SRR19784171 current disk space = 1551110926336 free memory = 1359634124 SRR19784171 SRAfilesize 0ba2877c27db85ae0abb58774d49e712 SRR19784171.sra SRR19784171.sra file validated SRR19784171 is paired end SRR19784171 is conventional basespace SRR19784171 read1 length is 37-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR19784171_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 37-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.24475 32.0 32.0 32.0 32.0 32.0 2 31.45325 32.0 32.0 32.0 32.0 32.0 3 31.5475 32.0 32.0 32.0 32.0 32.0 4 31.494 32.0 32.0 32.0 32.0 32.0 5 31.59725 32.0 32.0 32.0 32.0 32.0 6 34.8305 36.0 36.0 36.0 36.0 36.0 7 34.98775 36.0 36.0 36.0 32.0 36.0 8 35.02225 36.0 36.0 36.0 32.0 36.0 9 34.948 36.0 36.0 36.0 32.0 36.0 10-11 34.882875 36.0 36.0 36.0 32.0 36.0 12-13 34.933875 36.0 36.0 36.0 32.0 36.0 14-15 34.923375 36.0 36.0 36.0 32.0 36.0 16-17 34.935625 36.0 36.0 36.0 32.0 36.0 18-19 34.849000000000004 36.0 36.0 36.0 32.0 36.0 20-21 34.924625 36.0 36.0 36.0 32.0 36.0 22-23 34.826625 36.0 36.0 36.0 32.0 36.0 24-25 34.828500000000005 36.0 36.0 36.0 32.0 36.0 26-27 34.747125 36.0 36.0 36.0 32.0 36.0 28-29 34.648624999999996 36.0 36.0 36.0 32.0 36.0 30-31 34.628 36.0 36.0 36.0 32.0 36.0 32-33 34.48350000000001 36.0 36.0 36.0 32.0 36.0 34-35 34.494875 36.0 36.0 36.0 32.0 36.0 36-37 34.492625000000004 36.0 36.0 36.0 32.0 36.0 38-39 34.44236059014754 36.0 36.0 36.0 32.0 36.0 40-41 34.47211802950738 36.0 36.0 36.0 32.0 36.0 42-43 34.411227806951736 36.0 36.0 36.0 32.0 36.0 44-45 34.46161540385096 36.0 36.0 36.0 32.0 36.0 46-47 34.20767691922981 36.0 36.0 36.0 32.0 36.0 48-49 34.24443610902726 36.0 36.0 36.0 32.0 36.0 50-51 34.31945486371593 36.0 36.0 36.0 32.0 36.0 52-53 34.33983495873969 36.0 36.0 36.0 32.0 36.0 54-55 34.339459864966244 36.0 36.0 36.0 32.0 36.0 56-57 34.216594991880314 36.0 36.0 36.0 32.0 36.0 58-59 34.25581686264698 36.0 36.0 36.0 32.0 36.0 60-61 34.12922191643733 36.0 36.0 36.0 32.0 36.0 62-63 34.16351315426495 36.0 36.0 36.0 32.0 36.0 64-65 34.17280240420736 36.0 36.0 36.0 32.0 36.0 66-67 34.13223498817254 36.0 36.0 36.0 32.0 36.0 68-69 33.94594140293302 36.0 36.0 36.0 29.5 36.0 70-71 34.00202259653754 36.0 36.0 36.0 32.0 36.0 72-73 33.952011835687486 36.0 36.0 36.0 32.0 36.0 74-75 33.86083678796253 36.0 36.0 36.0 29.5 36.0 76 33.914924825815916 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 2.0 21 6.0 22 12.0 23 10.0 24 20.0 25 24.0 26 35.0 27 27.0 28 47.0 29 66.0 30 115.0 31 140.0 32 199.0 33 280.0 34 651.0 35 2365.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.65 9.575 10.975 46.800000000000004 2 19.93496748374187 15.032516258129064 32.51625812906453 32.51625812906453 3 24.65 17.349999999999998 18.2 39.800000000000004 4 29.2 25.324999999999996 16.875 28.599999999999998 5 26.724999999999998 27.925 22.3 23.05 6 23.366834170854272 31.532663316582916 22.763819095477388 22.336683417085425 7 20.549999999999997 21.5 36.575 21.375 8 21.125 24.325 27.750000000000004 26.8 9 23.075000000000003 21.775 31.7 23.45 10-11 24.0375 30.162499999999998 22.225 23.575 12-13 23.5875 23.225 26.3 26.887499999999996 14-15 23.8875 24.55 26.05 25.5125 16-17 23.9375 24.9375 26.0 25.124999999999996 18-19 23.974999999999998 25.5375 24.75 25.7375 20-21 24.2375 26.025 24.9875 24.75 22-23 24.5125 25.0125 25.25 25.224999999999998 24-25 24.337500000000002 25.5375 23.35 26.775 26-27 23.377922240280036 26.015751968996128 24.37804725590699 26.22827853481685 28-29 24.925 25.837500000000002 24.125 25.112499999999997 30-31 24.275 25.4 23.775 26.55 32-33 24.474999999999998 25.3125 24.337500000000002 25.874999999999996 34-35 25.074999999999996 25.6125 23.5375 25.775 36-37 24.753094136767096 26.128266033254157 22.727840980122515 26.390798849856235 38-39 24.706176544136035 25.918979744936234 23.53088272068017 25.84396099024756 40-41 24.543635908977244 25.85646411602901 23.093273318329583 26.506626656664167 42-43 25.243810952738183 25.756439109777446 23.418354588647162 25.581395348837212 44-45 24.193548387096776 26.069017254313575 22.980745186296573 26.756689172293076 46-47 23.830957739434858 25.85646411602901 23.55588897224306 26.756689172293076 48-49 24.953095684803 25.7661038148843 22.789243277048154 26.49155722326454 50-51 24.0090033762661 26.49743653870201 23.858947105164436 25.63461297986745 52-53 24.943735933983497 25.381345336334082 22.568142035508878 27.106776694173547 54-55 24.281070267566893 25.98149537384346 23.018254563640912 26.71917979494874 56-57 25.012506253126567 25.67533766883442 23.36168084042021 25.950475237618807 58-59 24.59344508381286 25.544158118588946 23.54265699274456 26.319739804853644 60-61 24.68101075806855 26.194645984488368 23.317488116087066 25.806855141356017 62-63 24.439994994368664 26.417219371793266 23.476410962332626 25.666374671505444 64-65 24.73077886301027 25.85775106436263 23.140495867768596 26.270974204858504 66-67 24.68037102030584 25.36976685886187 23.364251692153424 26.58561042867887 68-69 24.35077154685736 26.320411491657257 22.744950445364445 26.583866516120942 70-71 25.235404896421848 25.48650345260515 23.4526051475204 25.825486503452606 72-73 25.352822580645164 25.99546370967742 22.694052419354836 25.95766129032258 74-75 25.498481447246796 23.874290241647962 23.768651789251287 26.858576521853955 76 27.75944261092776 0.0 33.88338833883388 38.357169050238355 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 66.0 1 35.0 2 3.0 3 3.0 4 4.0 5 4.0 6 3.0 7 2.0 8 2.0 9 4.0 10 11.5 11 17.0 12 17.0 13 10.0 14 4.5 15 3.5 16 1.0 17 1.5 18 2.5 19 5.0 20 5.0 21 4.5 22 5.0 23 3.0 24 2.5 25 3.5 26 4.0 27 8.5 28 9.5 29 5.5 30 9.5 31 19.0 32 24.5 33 24.0 34 31.0 35 45.0 36 61.0 37 86.0 38 110.5 39 116.0 40 119.0 41 147.5 42 174.5 43 200.5 44 216.0 45 198.0 46 193.0 47 187.5 48 175.0 49 157.5 50 135.5 51 139.5 52 144.0 53 143.5 54 143.0 55 124.0 56 113.0 57 110.0 58 106.5 59 109.5 60 110.0 61 111.0 62 104.0 63 98.0 64 96.5 65 91.0 66 88.0 67 89.0 68 89.5 69 90.0 70 77.5 71 65.0 72 64.5 73 58.5 74 44.0 75 40.0 76 41.0 77 34.0 78 22.5 79 14.0 80 15.0 81 10.5 82 4.0 83 3.0 84 3.0 85 2.5 86 2.5 87 3.0 88 1.5 89 1.0 90 1.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.5 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0125 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.037509377344336084 50-51 0.012503125781445362 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.012512512512512512 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.013203063110641669 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 37 1.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 2.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 2.0 63 2.0 64 0.0 65 3.0 66 2.0 67 1.0 68 3.0 69 1.0 70 1.0 71 4.0 72 20.0 73 58.0 74 226.0 75 947.0 76 2727.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.84233261339092 88.75 2 2.9697624190064795 5.5 3 0.6749460043196545 1.875 4 0.18898488120950324 0.7000000000000001 5 0.13498920086393087 0.625 6 0.10799136069114472 0.6 7 0.02699784017278618 0.17500000000000002 8 0.02699784017278618 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.02699784017278618 1.575 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 63 1.575 No Hit CTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCT 8 0.2 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 7 0.17500000000000002 No Hit GCTTAATAGTACATCCCAATAAAGGACGACCATACTTGTTCAACTTATCT 6 0.15 No Hit CCCAGACATACGCAATGCTTTAGCTAATACACGGAAATGCATACCATGAT 6 0.15 No Hit CCCAGGAACAGGCTCGATGTGATAGCATCGTCCTTTGTAACGATCAAGAC 6 0.15 No Hit CAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGG 6 0.15 No Hit TTCTAACTTACCTACTACTGTACCGGCGTGGATATGATCTCCCCCAGACA 5 0.125 No Hit AGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCC 5 0.125 No Hit CCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTATA 5 0.125 No Hit CTTTTATCTAATAAATGCGCCCCTCCCAGAAGTCGGGGTTTGTTGCACGT 5 0.125 No Hit CTTGGAAAGTTTTTGAATAAGTAGGGGGAATTCGTAGATCCTCCAGACGTAGAGCACGTAGGGCTTTGAAACCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR19784171 read2 length is 37-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR19784171_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 37-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.433 32.0 32.0 32.0 32.0 32.0 2 30.31625 32.0 32.0 32.0 21.0 32.0 3 30.3665 32.0 32.0 32.0 21.0 32.0 4 30.23075 32.0 32.0 32.0 21.0 32.0 5 30.385 32.0 32.0 32.0 21.0 32.0 6 33.41 36.0 36.0 36.0 21.0 36.0 7 33.5925 36.0 36.0 36.0 21.0 36.0 8 33.2145 36.0 36.0 36.0 21.0 36.0 9 33.5445 36.0 36.0 36.0 21.0 36.0 10-11 33.378625 36.0 36.0 36.0 17.5 36.0 12-13 33.24625 36.0 36.0 36.0 21.0 36.0 14-15 33.442875 36.0 36.0 36.0 24.0 36.0 16-17 33.224625 36.0 36.0 36.0 21.0 36.0 18-19 33.143874999999994 36.0 36.0 36.0 21.0 36.0 20-21 33.398250000000004 36.0 36.0 36.0 24.0 36.0 22-23 33.656875 36.0 36.0 36.0 32.0 36.0 24-25 33.442625 36.0 36.0 36.0 21.0 36.0 26-27 33.43825 36.0 36.0 36.0 21.0 36.0 28-29 33.216 36.0 36.0 36.0 21.0 36.0 30-31 33.423875 36.0 36.0 36.0 27.0 36.0 32-33 33.290875 36.0 36.0 36.0 21.0 36.0 34-35 33.2045 36.0 36.0 36.0 21.0 36.0 36-37 33.23725 36.0 36.0 36.0 17.5 36.0 38-39 33.44273568392098 36.0 36.0 36.0 21.0 36.0 40-41 33.223930982745685 36.0 36.0 36.0 21.0 36.0 42-43 33.256564141035255 36.0 36.0 36.0 17.5 36.0 44-45 33.345086271567894 36.0 36.0 36.0 17.5 36.0 46-47 33.26506626656664 36.0 36.0 36.0 17.5 36.0 48-49 33.183045761440354 36.0 36.0 36.0 17.5 36.0 50-51 33.30807701925481 36.0 36.0 36.0 17.5 36.0 52-53 33.15191297824456 36.0 36.0 36.0 14.0 36.0 54-55 33.203925981495374 36.0 36.0 36.0 17.5 36.0 56-57 33.332914351930484 36.0 36.0 36.0 21.0 36.0 58-59 33.13372529397048 36.0 36.0 36.0 17.5 36.0 60-61 33.07505629221916 36.0 36.0 36.0 17.5 36.0 62-63 33.07121245189211 36.0 36.0 36.0 14.0 36.0 64-65 33.00851985714479 36.0 36.0 36.0 14.0 36.0 66-67 32.98921186762468 36.0 36.0 36.0 14.0 36.0 68-69 32.82005324561146 36.0 36.0 36.0 14.0 36.0 70-71 32.9469189023562 36.0 36.0 36.0 14.0 36.0 72-73 32.807437167929514 36.0 36.0 36.0 14.0 36.0 74-75 32.934214301477525 36.0 36.0 36.0 14.0 36.0 76 32.7163280662152 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 28.0 15 22.0 16 15.0 17 8.0 18 15.0 19 21.0 20 25.0 21 27.0 22 29.0 23 29.0 24 39.0 25 47.0 26 47.0 27 62.0 28 103.0 29 109.0 30 131.0 31 159.0 32 216.0 33 327.0 34 618.0 35 1923.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.58686387565806 14.690398596139383 13.562296314865883 40.160441213336675 2 23.150000000000002 23.45 28.625 24.775 3 24.956239059764943 25.481370342585645 21.355338834708675 28.207051762940733 4 28.525 29.799999999999997 16.475 25.2 5 28.249999999999996 29.275000000000002 19.525000000000002 22.95 6 23.5 33.35 19.525000000000002 23.625 7 22.45 18.3 32.775 26.474999999999998 8 23.411705852926463 23.21160580290145 22.63631815907954 30.740370185092548 9 25.5 22.325 24.45 27.725 10-11 26.065758219777475 27.990998874859358 19.602450306288286 26.340792599074884 12-13 26.9125 22.3875 23.4625 27.237499999999997 14-15 25.25 24.9125 24.5 25.337500000000002 16-17 26.68918918918919 23.485985985985984 24.086586586586588 25.738238238238235 18-19 25.941684394944314 25.31598047803779 22.71305218370667 26.029282943311227 20-21 26.431607901975497 24.44361090272568 23.88097024256064 25.243810952738183 22-23 26.4625 24.224999999999998 23.525 25.7875 24-25 25.765720715089387 24.90311288911114 24.05300662582823 25.278159769971246 26-27 25.50343964978111 25.278298936835526 23.802376485303313 25.41588492808005 28-29 26.023794614902947 24.846587351283656 22.95554164057608 26.17407639323732 30-31 25.715714464308036 25.26565820727591 23.65295661957745 25.365670708838607 32-33 25.8125 25.05 23.575 25.5625 34-35 26.0375 26.3125 22.7375 24.9125 36-37 25.528191023877984 25.428178522315285 23.102887860982623 25.9407425928241 38-39 26.113613613613612 25.38788788788789 23.91141141141141 24.587087087087088 40-41 26.307884856070086 24.918648310387987 22.415519399249064 26.357947434292868 42-43 26.3243581715717 25.96117720726362 22.542266750156543 25.17219787100814 44-45 26.332249186890166 24.88116087065299 23.079809857393045 25.706780085063798 46-47 25.5220707765412 26.28485682130799 22.308365637113916 25.884706765036892 48-49 25.043826696719258 25.219133483596295 23.340846481342346 26.3961933383421 50-51 25.52871980978601 25.378550869728443 23.126016768864975 25.966712551620574 52-53 25.881470367591895 24.668667166791696 23.23080770192548 26.219054763690924 54-55 26.569142285571395 25.618904726181547 21.955488872218055 25.85646411602901 56-57 24.92808005003127 26.7667292057536 22.28893058161351 26.01626016260163 58-59 25.735754539762052 24.921728240450847 23.218534752661242 26.123982467125863 60-61 26.507836990595614 25.41692789968652 22.858934169278996 25.216300940438874 62-63 26.686694204531232 25.610214044310926 22.44335961947678 25.259732131681062 64-65 26.38697557921102 24.671258609893552 23.343769567939887 25.59799624295554 66-67 25.764794383149447 25.689568706118354 23.696088264794383 24.849548645937812 68-69 25.561551010164386 25.58664826201531 24.156104906512738 24.695695821307567 70-71 26.78751258811682 25.74269889224572 22.129909365558913 25.33987915407855 72-73 25.448798988621995 25.49936788874842 23.249051833122632 25.802781289506953 74-75 27.0 23.200000000000003 23.173333333333336 26.626666666666665 76 29.38299473288187 0.0 34.04815650865312 36.56884875846501 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 29.0 1 24.5 2 14.0 3 7.5 4 7.0 5 7.5 6 8.0 7 11.5 8 15.0 9 15.5 10 15.0 11 12.0 12 10.0 13 10.0 14 6.0 15 1.5 16 1.5 17 1.5 18 3.5 19 4.0 20 2.5 21 3.5 22 4.5 23 3.5 24 2.0 25 2.0 26 3.5 27 5.5 28 7.5 29 7.0 30 10.5 31 13.5 32 14.0 33 18.5 34 30.0 35 60.0 36 80.5 37 87.5 38 96.5 39 112.0 40 126.0 41 131.5 42 136.0 43 157.0 44 177.0 45 160.0 46 152.0 47 166.5 48 166.5 49 169.0 50 173.5 51 148.0 52 124.0 53 120.5 54 117.5 55 120.0 56 127.5 57 125.5 58 127.0 59 127.5 60 119.0 61 117.5 62 118.5 63 110.0 64 104.5 65 103.5 66 102.5 67 104.5 68 104.0 69 91.5 70 80.5 71 78.0 72 67.0 73 59.0 74 57.0 75 53.0 76 43.0 77 34.5 78 26.5 79 18.0 80 15.0 81 11.0 82 6.5 83 4.0 84 3.5 85 6.5 86 6.5 87 3.5 88 3.0 89 3.0 90 2.0 91 0.5 92 0.0 93 1.0 94 1.5 95 1.5 96 2.0 97 1.5 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.05 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.1 18-19 0.11249999999999999 20-21 0.025 22-23 0.0 24-25 0.0125 26-27 0.0625 28-29 0.1875 30-31 0.0125 32-33 0.0 34-35 0.0 36-37 0.0125 38-39 0.07501875468867217 40-41 0.1000250062515629 42-43 0.1625406351587897 44-45 0.05001250312578145 46-47 0.012503125781445362 48-49 0.15003750937734434 50-51 0.08752188047011752 52-53 0.0 54-55 0.0 56-57 0.01250625312656328 58-59 0.11258443832874655 60-61 0.2376782586940205 62-63 0.03753753753753754 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.16337815759708432 72-73 0.15147689977278464 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 37 1.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 2.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 2.0 63 2.0 64 1.0 65 3.0 66 2.0 67 1.0 68 3.0 69 1.0 70 7.0 71 5.0 72 18.0 73 61.0 74 282.0 75 951.0 76 2658.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.22591712852996 91.14999999999999 2 2.7447875428873054 5.2 3 0.6334125098970704 1.7999999999999998 4 0.2111375032990235 0.8 5 0.13196093956188967 0.625 6 0.026392187912377938 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026392187912377938 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 11 0.27499999999999997 No Hit CTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAACGAGTA 6 0.15 No Hit CTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCA 5 0.125 No Hit GTTATTGTGAGAATTCTTAATTCAAGAGTTGTAAGGAGGGACTTATGTCA 5 0.125 No Hit GTAAGTTAGAAGGGGAACGCGAAATCACTTTAGGTTTTGTTGATTTATTGCGCGACGATTTTATTGAAAA 5 0.125 No Hit CCGACGCCACGCAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTAC 5 0.125 No Hit GTGAAATCAAGGGGCATTACTTGAATGCAACTGCGGGTACATGTGAAGAAATGATGAAGAGAGCTGTTTTTGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845823 spots for SRR19784171.sra Written 1845823 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra Read 1845816 spots for SRR19784171.sra Written 1845816 spots for SRR19784171.sra SRR ids: ['SRR19784171.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8aghuvw4 SRR19784171.sra spots: 36916327 blocks: [[1, 1845816], [1845817, 3691632], [3691633, 5537448], [5537449, 7383264], [7383265, 9229080], [9229081, 11074896], [11074897, 12920712], [12920713, 14766528], [14766529, 16612344], [16612345, 18458160], [18458161, 20303976], [20303977, 22149792], [22149793, 23995608], [23995609, 25841424], [25841425, 27687240], [27687241, 29533056], [29533057, 31378872], [31378873, 33224688], [33224689, 35070504], [35070505, 36916327]] SRR19784171 file size 7041656 SRR19784171 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR19784171 SRR19784171_1.fastq SRR19784171_2.fastq Input file: SRR19784171_1.fastq Paired file: SRR19784171_2.fastq trimmed: SRR19784171-trimmed-pair1.fastq, SRR19784171-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:13:07 2024 >> started Fri Dec 6 13:13:53 2024 >> done (45.950s) 36916327 read pairs processed; of these: 5 ( 0.00%) short read pairs filtered out after trimming by size control 11905 ( 0.03%) empty read pairs filtered out after trimming by size control 36904417 (99.97%) read pairs available; of these: 137627 ( 0.37%) trimmed read pairs available after processing 36766790 (99.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 3 0.00% 21 8 0.00% 22 37 0.00% 23 57 0.00% 24 103 0.00% 25 142 0.00% 26 148 0.00% 27 198 0.00% 28 213 0.00% 29 292 0.00% 30 391 0.00% 31 996 0.00% 32 1126 0.00% 33 467 0.00% 34 1449 0.00% 35 919 0.00% 36 969 0.00% 37 1119 0.00% 38 1164 0.00% 39 1335 0.00% 40 1401 0.00% 41 1453 0.00% 42 1582 0.00% 43 1716 0.00% 44 1841 0.00% 45 1926 0.01% 46 2034 0.01% 47 2364 0.01% 48 2446 0.01% 49 2776 0.01% 50 2987 0.01% 51 3371 0.01% 52 3754 0.01% 53 4095 0.01% 54 4525 0.01% 55 4880 0.01% 56 5216 0.01% 57 5580 0.02% 58 6341 0.02% 59 6976 0.02% 60 7606 0.02% 61 8347 0.02% 62 9488 0.03% 63 10225 0.03% 64 11240 0.03% 65 12341 0.03% 66 13186 0.04% 67 14485 0.04% 68 15989 0.04% 69 17673 0.05% 70 23082 0.06% 71 27466 0.07% 72 54918 0.15% 73 300454 0.81% 74 2463903 6.68% 75 16728745 45.33% 76 17106867 46.35% 36904417 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=25 prefix-density=0.56 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=103.27 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=15.8 sequence=CCGCCGCCGAGGAG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=29 prefix-density=0.38 prefix-fanout=2.2 sequence=CTCAAGTCCACCGCCGGCCTCCCCGTCGCCAGCCGCCGCTCCTCCAACAGCCTCGGCAGCGT criterion=fanout-score sequence-density=0.14 sequence-density-rank=11 fanout-score=158.14 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=20.8 sequence=GCCGCCGCCGCC SRR19784171 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:14:37 Started mapping on | Dec 06 13:14:38 Finished on | Dec 06 13:17:42 Mapping speed, Million of reads per hour | 722.04 Number of input reads | 36904417 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 27125256 Uniquely mapped reads % | 73.50% Average mapped length | 150.45 Number of splices: Total | 10050973 Number of splices: Annotated (sjdb) | 9563437 Number of splices: GT/AG | 9911910 Number of splices: GC/AG | 121637 Number of splices: AT/AC | 3089 Number of splices: Non-canonical | 14337 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 1.76 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 5258582 % of reads mapped to multiple loci | 14.25% Number of reads mapped to too many loci | 804421 % of reads mapped to too many loci | 2.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.27% % of reads unmapped: other | 4.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4520583 4520583 4520583 N_multimapping 5258582 5258582 5258582 N_noFeature 1091507 26126415 1633144 N_ambiguous 601366 3637 150862 UnstrandedReadsAssigned:25432383 PositiveStrandReadsAssigned:995204 NegativeStrandReadsAssigned:25341250 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR19784171 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR19784171-trimmed-pair1.fastq SRR19784171-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,904,417 reads, 30,250,631 reads pseudoaligned [quant] estimated average fragment length: 157.585 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52973 SRR19784171.ke.tsv 35125 SRR19784171.se.tsv 88098 total ==> SRR19784171.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 779.521 0 0 PNS24247 1044 887.415 51.8535 2.6537 PNS24249 1928 1771.42 327.536 8.39729 PNS24246 1044 887.415 51.8535 2.6537 PNS24248 1044 887.415 51.8535 2.6537 PNS24244 1471 1314.42 43.9032 1.51692 PNS24243 293 142.652 0 0 KQK14069 1603 1446.42 26673.3 837.499 KQK14071 474 318.445 3336 475.765 ==> SRR19784171.se.tsv <== BRADI_1g14170v3 31337 BRADI_1g53295v3 30 BRADI_1g59795v3 616 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 284 BRADI_1g74790v3 689 BRADI_1g09890v3 0 BRADI_1g77505v3 353 BRADI_1g48960v3 0 SRR19784171 completed mapping pipeline successfully