Starting /dee2/code/volunteer_pipeline.sh SRR19784173 current disk space = 1551028535296 free memory = 1379507108 SRR19784173 SRAfilesize e7cc30c73e3db7bb179d7552f5a8971c SRR19784173.sra SRR19784173.sra file validated SRR19784173 is paired end SRR19784173 is conventional basespace SRR19784173 read1 length is 40-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR19784173_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 40-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.459 32.0 32.0 32.0 32.0 32.0 2 31.38525 32.0 32.0 32.0 32.0 32.0 3 31.48025 32.0 32.0 32.0 32.0 32.0 4 31.59875 32.0 32.0 32.0 32.0 32.0 5 31.63525 32.0 32.0 32.0 32.0 32.0 6 34.61425 36.0 36.0 36.0 32.0 36.0 7 35.01875 36.0 36.0 36.0 36.0 36.0 8 35.03025 36.0 36.0 36.0 36.0 36.0 9 35.0105 36.0 36.0 36.0 32.0 36.0 10-11 34.963625 36.0 36.0 36.0 32.0 36.0 12-13 34.973 36.0 36.0 36.0 34.0 36.0 14-15 34.916375 36.0 36.0 36.0 32.0 36.0 16-17 34.976625 36.0 36.0 36.0 32.0 36.0 18-19 34.910875000000004 36.0 36.0 36.0 32.0 36.0 20-21 34.939 36.0 36.0 36.0 32.0 36.0 22-23 34.932125 36.0 36.0 36.0 32.0 36.0 24-25 34.780875 36.0 36.0 36.0 32.0 36.0 26-27 34.833625 36.0 36.0 36.0 32.0 36.0 28-29 34.74975 36.0 36.0 36.0 32.0 36.0 30-31 34.765249999999995 36.0 36.0 36.0 32.0 36.0 32-33 34.65 36.0 36.0 36.0 32.0 36.0 34-35 34.68025 36.0 36.0 36.0 32.0 36.0 36-37 34.662625 36.0 36.0 36.0 32.0 36.0 38-39 34.60025 36.0 36.0 36.0 32.0 36.0 40-41 34.64407817579395 36.0 36.0 36.0 32.0 36.0 42-43 34.622405601400345 36.0 36.0 36.0 32.0 36.0 44-45 34.62963950076114 36.0 36.0 36.0 32.0 36.0 46-47 34.66962722041531 36.0 36.0 36.0 32.0 36.0 48-49 34.52983728409261 36.0 36.0 36.0 32.0 36.0 50-51 34.6918648310388 36.0 36.0 36.0 32.0 36.0 52-53 34.56947921882824 36.0 36.0 36.0 32.0 36.0 54-55 34.517781116954666 36.0 36.0 36.0 32.0 36.0 56-57 34.50714285714286 36.0 36.0 36.0 32.0 36.0 58-59 34.47943831494483 36.0 36.0 36.0 32.0 36.0 60-61 34.41337022741452 36.0 36.0 36.0 32.0 36.0 62-63 34.49234629861982 36.0 36.0 36.0 32.0 36.0 64-65 34.558204750844354 36.0 36.0 36.0 32.0 36.0 66-67 34.47939180698668 36.0 36.0 36.0 32.0 36.0 68-69 34.49875712269288 36.0 36.0 36.0 32.0 36.0 70-71 34.38060326411706 36.0 36.0 36.0 32.0 36.0 72-73 34.281377941258455 36.0 36.0 36.0 32.0 36.0 74-75 34.255431941022195 36.0 36.0 36.0 32.0 36.0 76 33.92151988636363 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 2.0 22 6.0 23 7.0 24 14.0 25 14.0 26 17.0 27 28.0 28 30.0 29 62.0 30 104.0 31 104.0 32 208.0 33 289.0 34 663.0 35 2449.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.475 7.775 10.875 43.875 2 22.641981486114584 11.983987990993244 30.09757317988491 35.27645734300726 3 22.625 14.124999999999998 19.875 43.375 4 29.975 20.25 17.925 31.85 5 30.049999999999997 24.925 20.349999999999998 24.675 6 26.586102719033235 28.826787512588115 21.87814702920443 22.70896273917422 7 20.825 22.25 35.225 21.7 8 23.549999999999997 21.6 28.075 26.775 9 22.85 20.150000000000002 32.475 24.525 10-11 25.55 27.400000000000002 22.8125 24.2375 12-13 25.775 22.3125 24.575 27.3375 14-15 24.478059757469683 23.71546443305413 25.84073009126141 25.965745718214777 16-17 25.174999999999997 23.325000000000003 25.6125 25.887500000000003 18-19 26.150000000000002 22.825 24.825 26.200000000000003 20-21 25.112499999999997 23.275000000000002 26.137500000000003 25.474999999999998 22-23 25.637500000000003 22.6375 24.3875 27.3375 24-25 26.05 22.875 23.3875 27.6875 26-27 24.06851712928232 24.58114528632158 24.668667166791696 26.6816704176044 28-29 26.85671417854464 23.980995248812203 22.980745186296573 26.18154538634659 30-31 25.75 23.425 23.200000000000003 27.625 32-33 25.3125 23.3375 25.5 25.85 34-35 26.8375 23.0 24.4375 25.724999999999998 36-37 25.772164561710643 23.583843941478055 23.49631111666875 27.147680380142553 38-39 25.0 25.0 23.5125 26.487500000000004 40-41 26.128266033254157 23.015376922115262 23.740467558444806 27.11588948618577 42-43 25.818954738684667 23.36834208552138 24.256064016004 26.556639159789945 44-45 25.453408380237647 23.402126328955596 23.352095059412132 27.79237023139462 46-47 26.144608456342254 23.605203902927197 23.05479109331999 27.195396547410557 48-49 25.2442996742671 23.978952643447755 23.390127787521926 27.38661989476322 50-51 25.309800976342473 24.08311428213794 23.13180623357116 27.47527850794843 52-53 26.602403605408114 24.32398597896845 22.54631947921883 26.527290936404608 54-55 24.467818682694716 24.254946155772604 23.40345604808415 27.87377911344853 56-57 26.2531328320802 23.897243107769423 23.483709273182956 26.36591478696742 58-59 26.00626959247649 23.29780564263323 23.00940438871473 27.68652037617555 60-61 24.927863505206375 23.522770041400076 24.07477104503826 27.47459540835529 62-63 25.561551010164386 22.58752666583009 24.871376584264024 26.9795457397415 64-65 26.57289966093181 23.18221775712671 23.558960190882832 26.685922391058646 66-67 25.49635586830862 23.08368936918824 23.8879115355617 27.532043226941443 68-69 26.62811164194116 23.10787025396027 23.14558712597435 27.118430978124213 70-71 26.856279889252455 24.037251447269067 23.055625471935564 26.050843191542917 72-73 26.46017699115044 22.996207332490517 23.173198482932996 27.370417193426043 74-75 26.769558275678552 20.596061734965406 24.228312932410855 28.406067056945183 76 31.56960227272727 0.0 31.036931818181817 37.393465909090914 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 9.0 1 5.0 2 0.5 3 0.5 4 1.0 5 1.0 6 1.5 7 2.0 8 2.0 9 4.0 10 8.0 11 10.5 12 11.0 13 6.5 14 2.0 15 1.0 16 0.5 17 1.0 18 2.0 19 2.5 20 2.5 21 5.0 22 6.0 23 4.5 24 3.5 25 2.5 26 2.5 27 3.0 28 3.5 29 4.0 30 4.5 31 11.0 32 17.0 33 15.5 34 20.5 35 39.0 36 56.0 37 64.0 38 85.0 39 97.5 40 97.5 41 124.0 42 153.5 43 168.5 44 177.5 45 194.5 46 209.0 47 201.5 48 183.5 49 174.0 50 181.0 51 163.0 52 137.5 53 145.0 54 153.5 55 153.0 56 158.0 57 162.0 58 157.5 59 136.0 60 112.0 61 123.0 62 134.5 63 112.0 64 103.0 65 113.5 66 105.0 67 95.5 68 86.5 69 88.5 70 84.0 71 64.5 72 68.5 73 70.0 74 55.0 75 42.5 76 37.5 77 31.5 78 19.0 79 10.5 80 8.5 81 5.5 82 5.0 83 5.0 84 5.0 85 3.0 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.7000000000000001 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0125 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.025 28-29 0.025 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0375 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.11262670504317357 50-51 0.012515644555694618 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.012537612838515547 60-61 0.0 62-63 0.012547051442910915 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.013303179459890914 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40 1.0 41 0.0 42 0.0 43 1.0 44 1.0 45 0.0 46 0.0 47 1.0 48 1.0 49 0.0 50 0.0 51 1.0 52 0.0 53 1.0 54 0.0 55 3.0 56 0.0 57 2.0 58 0.0 59 2.0 60 1.0 61 0.0 62 0.0 63 2.0 64 3.0 65 1.0 66 0.0 67 0.0 68 4.0 69 1.0 70 2.0 71 8.0 72 18.0 73 64.0 74 247.0 75 819.0 76 2816.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.35445757250268 88.775 2 3.1149301825993554 5.800000000000001 3 0.8592910848549946 2.4 4 0.37593984962406013 1.4000000000000001 5 0.1611170784103115 0.75 6 0.08055853920515575 0.44999999999999996 7 0.0 0.0 8 0.02685284640171858 0.2 9 0.02685284640171858 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 9 0.22499999999999998 No Hit CAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGG 8 0.2 No Hit CCAGGAACAGGCTCGATGTGATAGCATCGTCCTTTGTAACGATCAAGACT 6 0.15 No Hit GTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAG 6 0.15 No Hit CCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTATA 6 0.15 No Hit GTCCATGTACCAGTAGAAGATTCGGCAGCTACTGCAGCCCCTGCTTCTTCGGGCGGAACCCCAGGTTGAGGAGAT 5 0.125 No Hit CCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCC 5 0.125 No Hit CCCAATTTTGGCTTAATAGTACATCCCAATAAAGGACGACCATACTTGTT 5 0.125 No Hit CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA 5 0.125 No Hit CCCCAGTTAAGTAGTCATGCATTACAATAGGAACACCTAATTCTCTCGCA 5 0.125 No Hit CATGAATCATCGGATCAGCGAGCAAAGCCCGCGTCAGCCTTTTATCTAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR19784173 read2 length is 40-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR19784173_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 40-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.6185 32.0 32.0 32.0 32.0 32.0 2 30.6325 32.0 32.0 32.0 32.0 32.0 3 30.56125 32.0 32.0 32.0 32.0 32.0 4 30.5935 32.0 32.0 32.0 32.0 32.0 5 30.50225 32.0 32.0 32.0 32.0 32.0 6 33.818 36.0 36.0 36.0 32.0 36.0 7 33.977 36.0 36.0 36.0 32.0 36.0 8 33.688 36.0 36.0 36.0 27.0 36.0 9 34.02075 36.0 36.0 36.0 32.0 36.0 10-11 33.841375 36.0 36.0 36.0 32.0 36.0 12-13 33.684125 36.0 36.0 36.0 29.5 36.0 14-15 33.756 36.0 36.0 36.0 29.5 36.0 16-17 33.602125 36.0 36.0 36.0 29.5 36.0 18-19 33.562375 36.0 36.0 36.0 29.5 36.0 20-21 33.732625 36.0 36.0 36.0 29.5 36.0 22-23 33.994 36.0 36.0 36.0 32.0 36.0 24-25 33.709375 36.0 36.0 36.0 32.0 36.0 26-27 33.724375 36.0 36.0 36.0 29.5 36.0 28-29 33.566875 36.0 36.0 36.0 29.5 36.0 30-31 33.63825 36.0 36.0 36.0 27.0 36.0 32-33 33.49425 36.0 36.0 36.0 27.0 36.0 34-35 33.712125 36.0 36.0 36.0 27.0 36.0 36-37 33.6135 36.0 36.0 36.0 27.0 36.0 38-39 33.637375 36.0 36.0 36.0 27.0 36.0 40-41 33.63207336209052 36.0 36.0 36.0 27.0 36.0 42-43 33.505001250312574 36.0 36.0 36.0 24.0 36.0 44-45 33.61790915472748 36.0 36.0 36.0 26.5 36.0 46-47 33.58744058043533 36.0 36.0 36.0 24.0 36.0 48-49 33.55274940146654 36.0 36.0 36.0 27.0 36.0 50-51 33.5063829787234 36.0 36.0 36.0 24.0 36.0 52-53 33.638958437656484 36.0 36.0 36.0 27.0 36.0 54-55 33.67655897821187 36.0 36.0 36.0 27.0 36.0 56-57 33.70827067669173 36.0 36.0 36.0 24.0 36.0 58-59 33.37600300902708 36.0 36.0 36.0 21.0 36.0 60-61 33.29032019848642 36.0 36.0 36.0 21.0 36.0 62-63 33.5228356336261 36.0 36.0 36.0 21.0 36.0 64-65 33.39254958573939 36.0 36.0 36.0 21.0 36.0 66-67 33.31138477004272 36.0 36.0 36.0 21.0 36.0 68-69 33.1469259208328 36.0 36.0 36.0 21.0 36.0 70-71 33.101984535062584 36.0 36.0 36.0 21.0 36.0 72-73 33.195403941847296 36.0 36.0 36.0 21.0 36.0 74-75 33.3247443400567 36.0 36.0 36.0 21.0 36.0 76 32.84887108521486 36.0 36.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 5.0 15 11.0 16 9.0 17 17.0 18 16.0 19 10.0 20 20.0 21 19.0 22 13.0 23 28.0 24 32.0 25 50.0 26 42.0 27 71.0 28 83.0 29 106.0 30 107.0 31 174.0 32 235.0 33 316.0 34 704.0 35 1932.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.30583501006036 14.71327967806841 13.103621730382295 37.87726358148893 2 25.7 22.0 26.125 26.174999999999997 3 24.85 25.374999999999996 20.849999999999998 28.925 4 29.25 27.625 17.224999999999998 25.900000000000002 5 30.375000000000004 28.275 18.5 22.85 6 24.7 33.675 19.375 22.25 7 24.8 18.725 29.975 26.5 8 26.601601601601605 21.846846846846844 22.12212212212212 29.429429429429426 9 25.174999999999997 21.375 25.224999999999998 28.225 10-11 27.994498624656167 27.91947986996749 18.392098024506126 25.693923480870218 12-13 28.7 22.3375 21.875 27.0875 14-15 26.625 24.5125 23.2625 25.6 16-17 27.55511022044088 23.233967935871743 21.9313627254509 27.279559118236474 18-19 27.456140350877195 23.546365914786968 21.904761904761905 27.092731829573935 20-21 27.276138069034516 23.986993496748372 21.335667833916958 27.40120060030015 22-23 27.075 23.6125 22.9625 26.35 24-25 26.281570392598148 24.681170292573142 22.593148287071767 26.44411102775694 26-27 27.070302727045288 24.718538904178132 22.466850137603203 25.74430823117338 28-29 27.055869428750785 23.84180790960452 22.146892655367232 26.955430006277464 30-31 25.85646411602901 25.156289072268066 22.83070767691923 26.156539134783696 32-33 26.25 24.4375 22.0625 27.250000000000004 34-35 27.1375 24.575 21.987499999999997 26.3 36-37 26.644161040260066 24.431107776944234 22.74318579644911 26.18154538634659 38-39 27.240861291937907 24.399098647971957 21.782674011016525 26.577366049073607 40-41 27.183857626268953 24.10076450683043 22.070434891590423 26.644942975310187 42-43 27.387975398518886 24.312790259821764 22.99485377180871 25.304380569850633 44-45 27.843186372745492 23.597194388777556 22.332164328657313 26.22745490981964 46-47 28.19069069069069 24.64964964964965 20.57057057057057 26.58908908908909 48-49 26.5393314903242 24.754963558683084 21.713998492083437 26.991706458909277 50-51 27.229399222375516 24.206697604414902 21.51009657594381 27.053806597265773 52-53 27.548209366391184 24.229902329075884 22.176308539944902 26.045579764588027 54-55 27.460555972952665 24.868519909842224 21.124467818682692 26.546456298522415 56-57 27.400350965154175 24.492353973426926 21.27099523690148 26.836299824517422 58-59 26.716981132075475 24.553459119496857 21.974842767295595 26.754716981132077 60-61 26.64651807077194 24.644251353733786 23.09532804432691 25.61390253116736 62-63 28.671943711521546 23.30694810905893 22.000251287850233 26.020856891569295 64-65 27.396055771887955 23.828664740610474 21.906795628689864 26.868483858811707 66-67 27.45664739884393 24.604171902488062 21.538074893189243 26.401105805478764 68-69 26.571931589537222 26.131790744466798 21.856136820925553 25.440140845070424 70-71 27.16361339229311 24.333543903979784 21.869867340492736 26.63297536323436 72-73 26.084191784306242 24.710670227648478 22.955614905252446 26.249523082792827 74-75 27.888606239121707 21.140714955147946 23.430178069353328 27.540500736377027 76 32.22869628550619 0.0 31.39111434814275 36.380189366351054 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 9.0 1 8.5 2 6.0 3 4.5 4 5.0 5 4.5 6 3.5 7 4.5 8 6.0 9 5.5 10 4.5 11 3.5 12 2.5 13 3.5 14 3.5 15 2.5 16 2.5 17 1.5 18 3.0 19 3.0 20 1.5 21 1.5 22 0.5 23 1.0 24 3.0 25 3.0 26 2.5 27 2.5 28 5.0 29 7.0 30 7.0 31 11.5 32 17.5 33 19.0 34 28.0 35 52.5 36 70.0 37 74.0 38 93.5 39 102.5 40 99.5 41 122.0 42 137.5 43 140.0 44 151.5 45 156.5 46 150.0 47 163.0 48 165.5 49 154.0 50 151.0 51 131.5 52 131.5 53 139.5 54 133.0 55 138.0 56 141.5 57 146.5 58 154.0 59 146.0 60 137.5 61 134.0 62 130.5 63 122.0 64 118.5 65 116.5 66 106.0 67 103.5 68 107.0 69 96.0 70 77.0 71 75.5 72 82.5 73 75.0 74 61.0 75 55.5 76 47.5 77 36.5 78 25.5 79 20.0 80 19.0 81 15.0 82 12.0 83 11.5 84 9.0 85 4.0 86 2.0 87 3.0 88 3.5 89 3.0 90 1.0 91 0.5 92 1.0 93 1.0 94 1.0 95 0.5 96 0.0 97 0.5 98 1.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.1 9 0.0 10-11 0.025 12-13 0.0 14-15 0.0 16-17 0.2 18-19 0.25 20-21 0.05 22-23 0.0 24-25 0.025 26-27 0.075 28-29 0.43750000000000006 30-31 0.025 32-33 0.0 34-35 0.0 36-37 0.025 38-39 0.15 40-41 0.25003125390673836 42-43 0.3875968992248062 44-45 0.13758599124452783 46-47 0.02501876407305479 48-49 0.4129645851583031 50-51 0.2127659574468085 52-53 0.025037556334501748 54-55 0.0 56-57 0.02506265664160401 58-59 0.3259779338014042 60-61 0.37636432066240116 62-63 0.13801756587202008 64-65 0.02511616225040814 66-67 0.0 68-69 0.025144581342720643 70-71 0.33996474439687735 72-73 0.32957282291798706 74-75 0.013386880856760375 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40 1.0 41 0.0 42 0.0 43 1.0 44 1.0 45 0.0 46 0.0 47 1.0 48 1.0 49 0.0 50 0.0 51 1.0 52 0.0 53 1.0 54 0.0 55 3.0 56 0.0 57 2.0 58 0.0 59 2.0 60 1.0 61 0.0 62 0.0 63 2.0 64 3.0 65 1.0 66 0.0 67 0.0 68 4.0 69 1.0 70 6.0 71 10.0 72 27.0 73 68.0 74 256.0 75 861.0 76 2746.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.35839664658108 91.95 2 2.803248624574273 5.35 3 0.5763688760806917 1.6500000000000001 4 0.20958868221116062 0.8 5 0.052397170552790154 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAGGATCTACGAATTCCCCCTACTTATTCAAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTGGAAAG 5 0.125 No Hit ATTTTATTGAAAAAGATCGTGCTCGCGGTATCTTTTTCACTCAGGACTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852547 spots for SRR19784173.sra Written 1852547 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra Read 1852544 spots for SRR19784173.sra Written 1852544 spots for SRR19784173.sra SRR ids: ['SRR19784173.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ocvwla3h SRR19784173.sra spots: 37050883 blocks: [[1, 1852544], [1852545, 3705088], [3705089, 5557632], [5557633, 7410176], [7410177, 9262720], [9262721, 11115264], [11115265, 12967808], [12967809, 14820352], [14820353, 16672896], [16672897, 18525440], [18525441, 20377984], [20377985, 22230528], [22230529, 24083072], [24083073, 25935616], [25935617, 27788160], [27788161, 29640704], [29640705, 31493248], [31493249, 33345792], [33345793, 35198336], [35198337, 37050883]] SRR19784173 file size 7066615 SRR19784173 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR19784173 SRR19784173_1.fastq SRR19784173_2.fastq Input file: SRR19784173_1.fastq Paired file: SRR19784173_2.fastq trimmed: SRR19784173-trimmed-pair1.fastq, SRR19784173-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:18:47 2024 >> started Fri Dec 6 13:19:20 2024 >> done (33.168s) 37050883 read pairs processed; of these: 6 ( 0.00%) short read pairs filtered out after trimming by size control 32027 ( 0.09%) empty read pairs filtered out after trimming by size control 37018850 (99.91%) read pairs available; of these: 35760 ( 0.10%) trimmed read pairs available after processing 36983090 (99.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 3 0.00% 21 3 0.00% 22 36 0.00% 23 44 0.00% 24 69 0.00% 25 107 0.00% 26 132 0.00% 27 187 0.00% 28 202 0.00% 29 267 0.00% 30 340 0.00% 31 951 0.00% 32 1158 0.00% 33 490 0.00% 34 1495 0.00% 35 897 0.00% 36 965 0.00% 37 1059 0.00% 38 1188 0.00% 39 1240 0.00% 40 1430 0.00% 41 1520 0.00% 42 1763 0.00% 43 1857 0.01% 44 1908 0.01% 45 2116 0.01% 46 2205 0.01% 47 2446 0.01% 48 2654 0.01% 49 2956 0.01% 50 3150 0.01% 51 3661 0.01% 52 4018 0.01% 53 4417 0.01% 54 4881 0.01% 55 5191 0.01% 56 5698 0.02% 57 6112 0.02% 58 6737 0.02% 59 7369 0.02% 60 7967 0.02% 61 8763 0.02% 62 10037 0.03% 63 11217 0.03% 64 12204 0.03% 65 13130 0.04% 66 14241 0.04% 67 15927 0.04% 68 16953 0.05% 69 18539 0.05% 70 24823 0.07% 71 28720 0.08% 72 51702 0.14% 73 290788 0.79% 74 2338920 6.32% 75 16196350 43.75% 76 17875641 48.29% 37018850 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=22 prefix-density=0.52 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.18 sequence-density-rank=10 fanout-score=53.25 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=12.0 sequence=CCGCCGCCGAGGAG criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=17 prefix-density=0.41 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCAC criterion=fanout-score sequence-density=0.14 sequence-density-rank=23 fanout-score=144.92 fanout-score-rank=1 prefix-density=1.21 prefix-fanout=16.9 sequence=GCCGCCGCCACCCT SRR19784173 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:20:11 Started mapping on | Dec 06 13:20:12 Finished on | Dec 06 13:22:24 Mapping speed, Million of reads per hour | 1009.61 Number of input reads | 37018850 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 26308572 Uniquely mapped reads % | 71.07% Average mapped length | 150.46 Number of splices: Total | 9842899 Number of splices: Annotated (sjdb) | 9405180 Number of splices: GT/AG | 9700365 Number of splices: GC/AG | 128332 Number of splices: AT/AC | 2460 Number of splices: Non-canonical | 11742 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 1.85 Insertion rate per base | 0.00% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 5334002 % of reads mapped to multiple loci | 14.41% Number of reads mapped to too many loci | 1333164 % of reads mapped to too many loci | 3.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.88% % of reads unmapped: other | 8.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5376279 5376279 5376279 N_multimapping 5334002 5334002 5334002 N_noFeature 872778 25198778 1568782 N_ambiguous 543264 3567 136207 UnstrandedReadsAssigned:24892530 PositiveStrandReadsAssigned:1106227 NegativeStrandReadsAssigned:24603583 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR19784173 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR19784173-trimmed-pair1.fastq SRR19784173-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,018,850 reads, 29,106,060 reads pseudoaligned [quant] estimated average fragment length: 155.201 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,253 rounds 52973 SRR19784173.ke.tsv 35125 SRR19784173.se.tsv 88098 total ==> SRR19784173.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 781.85 0 0 PNS24247 1044 889.799 28.8782 1.49965 PNS24249 1928 1773.8 181.062 4.71665 PNS24246 1044 889.799 28.8782 1.49965 PNS24248 1044 889.799 28.8782 1.49965 PNS24244 1471 1316.8 43.3038 1.51956 PNS24243 293 143.61 0 0 KQK14069 1603 1448.8 9610.51 306.514 KQK14071 474 320.65 1528.51 220.266 ==> SRR19784173.se.tsv <== BRADI_1g14170v3 11651 BRADI_1g53295v3 16 BRADI_1g59795v3 420 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 161 BRADI_1g74790v3 231 BRADI_1g09890v3 0 BRADI_1g77505v3 217 BRADI_1g48960v3 0 SRR19784173 completed mapping pipeline successfully