Starting /dee2/code/volunteer_pipeline.sh SRR1979261 current disk space = 1543037755392 free memory = 1606537112 SRR1979261 SRAfilesize afdd663ecd9888bc2a1dee877c628a16 SRR1979261.sra SRR1979261.sra file validated SRR1979261 is paired end SRR1979261 is conventional basespace SRR1979261 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1979261_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79 34.0 31.0 34.0 31.0 34.0 2 32.85925 34.0 31.0 34.0 31.0 34.0 3 32.96975 34.0 31.0 34.0 31.0 34.0 4 36.39425 37.0 37.0 37.0 35.0 37.0 5 36.2685 37.0 37.0 37.0 35.0 37.0 6 36.3485 37.0 37.0 37.0 35.0 37.0 7 36.34025 37.0 37.0 37.0 35.0 37.0 8 36.28125 37.0 37.0 37.0 35.0 37.0 9 38.19425 39.0 39.0 39.0 37.0 39.0 10-11 38.150999999999996 39.0 39.0 39.0 37.0 39.0 12-13 38.0775 39.0 39.0 39.0 36.0 39.0 14-15 39.700500000000005 41.0 40.0 41.0 37.0 41.0 16-17 39.679 41.0 40.0 41.0 37.0 41.0 18-19 39.482375000000005 41.0 39.5 41.0 36.5 41.0 20-21 39.397999999999996 41.0 39.5 41.0 36.5 41.0 22-23 39.396625 41.0 39.0 41.0 36.5 41.0 24-25 39.327875 41.0 39.0 41.0 36.0 41.0 26-27 39.05 40.5 39.0 41.0 35.5 41.0 28-29 39.063125 40.5 39.0 41.0 35.5 41.0 30-31 38.949875 40.0 38.0 41.0 35.0 41.0 32-33 38.923 40.0 38.0 41.0 35.0 41.0 34-35 38.737125 40.0 38.0 41.0 34.5 41.0 36-37 38.417249999999996 40.0 38.0 41.0 34.0 41.0 38-39 38.03575 40.0 37.5 41.0 33.0 41.0 40-41 38.013 40.0 37.5 41.0 33.0 41.0 42-43 37.875625 40.0 37.0 41.0 33.0 41.0 44-45 37.495374999999996 40.0 36.5 41.0 32.0 41.0 46-47 37.50875 40.0 36.0 41.0 32.5 41.0 48-49 37.411249999999995 40.0 36.0 41.0 32.5 41.0 50-51 37.298125 40.0 36.0 41.0 32.5 41.0 52-53 36.992000000000004 39.5 35.0 41.0 31.0 41.0 54-55 36.64675 39.0 35.0 41.0 31.0 41.0 56-57 36.389 38.5 35.0 41.0 30.5 41.0 58-59 36.21275 38.5 35.0 40.5 30.5 41.0 60-61 36.320625 38.0 35.0 41.0 31.0 41.0 62-63 36.152375 37.5 35.0 41.0 31.0 41.0 64-65 35.8965 37.0 35.0 40.0 31.0 41.0 66-67 35.474125 36.5 35.0 40.0 30.5 41.0 68-69 35.161 36.0 34.5 39.0 30.0 41.0 70-71 34.74825 35.5 34.0 39.0 29.5 41.0 72-73 34.269125 35.0 34.0 38.5 29.0 40.5 74-75 33.890375 35.0 34.0 37.0 28.5 39.5 76-77 32.71975 34.5 32.0 36.0 26.5 39.0 78-79 33.349375 35.0 33.5 36.0 28.5 39.0 80-81 33.224375 35.0 34.0 36.0 29.0 37.5 82-83 32.951 35.0 33.0 36.0 28.0 37.0 84-85 32.592625 35.0 33.0 35.0 27.0 37.0 86-87 32.497625 35.0 33.0 35.0 27.0 36.0 88-89 32.144625 35.0 33.0 35.0 26.5 36.0 90-91 31.840375 35.0 33.0 35.0 25.0 36.0 92-93 31.6335 35.0 32.5 35.0 24.5 36.0 94-95 31.587375 35.0 33.0 35.0 25.0 35.0 96-97 31.292 35.0 32.0 35.0 24.0 35.0 98-99 31.023 35.0 32.0 35.0 23.0 35.0 100-101 29.990125 34.5 30.5 35.0 11.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 3.0 9 0.0 10 5.0 11 5.0 12 2.0 13 9.0 14 7.0 15 8.0 16 7.0 17 7.0 18 13.0 19 13.0 20 7.0 21 14.0 22 7.0 23 13.0 24 12.0 25 13.0 26 25.0 27 34.0 28 28.0 29 54.0 30 58.0 31 92.0 32 101.0 33 142.0 34 236.0 35 306.0 36 549.0 37 872.0 38 1066.0 39 290.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.400000000000002 16.0 14.2 46.400000000000006 2 23.474999999999998 22.0 36.6 17.925 3 20.974999999999998 27.200000000000003 26.450000000000003 25.374999999999996 4 23.474999999999998 33.575 20.549999999999997 22.400000000000002 5 23.925 33.775 22.275 20.025000000000002 6 19.15 35.875 23.849999999999998 21.125 7 18.625 15.775 41.25 24.349999999999998 8 19.554888722180543 22.980745186296573 27.60690172543136 29.857464366091524 9 20.345345345345343 22.74774774774775 31.156156156156158 25.75075075075075 10-11 24.1125 31.5 21.0125 23.375 12-13 21.9625 25.05 26.9625 26.025 14-15 22.35 25.687500000000004 28.249999999999996 23.7125 16-17 24.087500000000002 25.724999999999998 25.4375 24.75 18-19 22.7125 26.987499999999997 25.424999999999997 24.875 20-21 22.8375 27.05 25.8625 24.25 22-23 24.15 26.35 26.1125 23.3875 24-25 22.2 27.250000000000004 26.575 23.974999999999998 26-27 23.9375 26.450000000000003 26.5875 23.025000000000002 28-29 22.875 26.650000000000002 26.650000000000002 23.825 30-31 22.8625 27.187499999999996 25.687500000000004 24.2625 32-33 22.912499999999998 27.400000000000002 25.900000000000002 23.7875 34-35 23.200000000000003 26.8375 25.924999999999997 24.0375 36-37 23.549999999999997 26.5375 26.450000000000003 23.4625 38-39 23.6625 26.6 26.1 23.6375 40-41 23.5875 26.8 25.5125 24.099999999999998 42-43 23.3625 26.674999999999997 26.8625 23.1 44-45 23.849999999999998 27.175 25.825 23.150000000000002 46-47 23.3625 26.737499999999997 25.874999999999996 24.025 48-49 23.3875 27.025 26.387500000000003 23.200000000000003 50-51 24.175 26.875 25.424999999999997 23.525 52-53 22.31807951987997 27.206801700425103 26.219054763690924 24.256064016004 54-55 22.900000000000002 27.200000000000003 26.224999999999998 23.674999999999997 56-57 22.355588897224308 26.76919229807452 26.506626656664167 24.36859214803701 58-59 23.06153076538269 26.43821910955478 25.987993996998497 24.512256128064035 60-61 23.875 26.224999999999998 26.237500000000004 23.6625 62-63 23.8125 26.8375 25.424999999999997 23.925 64-65 24.1375 26.5 26.575 22.787499999999998 66-67 22.933600100037513 26.334875578341876 27.64786795048143 23.083656371139178 68-69 23.425 26.674999999999997 25.974999999999998 23.925 70-71 23.6125 27.187499999999996 26.200000000000003 23.0 72-73 23.3375 26.400000000000002 26.625 23.6375 74-75 23.65 26.924999999999997 26.6 22.825 76-77 23.8125 26.6 26.075 23.5125 78-79 23.525 26.687499999999996 26.150000000000002 23.6375 80-81 23.75 27.187499999999996 25.912499999999998 23.150000000000002 82-83 22.8 25.9625 26.575 24.6625 84-85 23.474999999999998 26.075 26.987499999999997 23.4625 86-87 23.2375 27.3125 26.450000000000003 23.0 88-89 23.47793474184273 26.578322290286287 25.640705088136016 24.30303787973497 90-91 23.80297537192149 26.303287910988875 25.66570821352669 24.228028503562946 92-93 23.252906613326665 26.303287910988875 27.728466058257283 22.715339417427177 94-95 23.7125 26.0 26.85 23.4375 96-97 24.1375 26.2125 26.450000000000003 23.200000000000003 98-99 23.674999999999997 26.05 26.4125 23.8625 100-101 24.375 26.237500000000004 26.2875 23.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 1.0 18 3.0 19 3.5 20 7.0 21 8.5 22 6.0 23 8.0 24 11.5 25 18.0 26 29.0 27 32.0 28 36.5 29 50.5 30 55.0 31 56.5 32 66.5 33 76.0 34 81.5 35 83.0 36 96.0 37 105.5 38 115.0 39 136.5 40 135.0 41 135.0 42 138.5 43 135.0 44 141.5 45 146.0 46 139.5 47 133.0 48 126.5 49 115.5 50 111.0 51 111.0 52 100.5 53 91.0 54 83.0 55 72.0 56 72.0 57 64.5 58 54.0 59 54.0 60 59.5 61 57.0 62 51.5 63 49.5 64 53.5 65 54.5 66 47.5 67 54.0 68 54.0 69 42.0 70 35.5 71 33.5 72 32.0 73 23.0 74 16.0 75 16.0 76 16.0 77 15.0 78 11.5 79 9.5 80 8.0 81 4.0 82 1.0 83 1.0 84 2.0 85 2.0 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.1 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.025 54-55 0.0 56-57 0.025 58-59 0.05 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0375 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.0125 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.0875 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0125 86-87 0.175 0.0 0.0 0.0 0.025 88-89 0.175 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR1979261 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1979261_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.518 33.0 31.0 34.0 31.0 34.0 2 32.69825 34.0 31.0 34.0 31.0 34.0 3 32.823 34.0 31.0 34.0 31.0 34.0 4 36.234 37.0 37.0 37.0 35.0 37.0 5 36.16125 37.0 37.0 37.0 35.0 37.0 6 36.19975 37.0 37.0 37.0 35.0 37.0 7 36.156 37.0 37.0 37.0 35.0 37.0 8 36.17275 37.0 37.0 37.0 35.0 37.0 9 37.6905 39.0 38.0 39.0 35.0 39.0 10-11 37.8035 39.0 38.0 39.0 35.0 39.0 12-13 37.842125 39.0 38.5 39.0 35.0 39.0 14-15 39.4045 41.0 40.0 41.0 36.5 41.0 16-17 39.256875 41.0 39.0 41.0 36.0 41.0 18-19 39.230875 41.0 39.0 41.0 36.0 41.0 20-21 39.283375 41.0 39.0 41.0 36.0 41.0 22-23 39.106624999999994 41.0 39.0 41.0 36.0 41.0 24-25 39.035125 41.0 39.0 41.0 36.0 41.0 26-27 38.809875000000005 41.0 39.0 41.0 35.0 41.0 28-29 38.797125 40.5 39.0 41.0 35.0 41.0 30-31 38.597750000000005 40.0 38.0 41.0 35.0 41.0 32-33 38.5035 40.0 38.0 41.0 34.5 41.0 34-35 38.381874999999994 40.0 38.0 41.0 34.0 41.0 36-37 38.0955 40.0 38.0 41.0 33.0 41.0 38-39 37.988 40.0 38.0 41.0 33.0 41.0 40-41 37.71062499999999 40.0 37.5 41.0 33.0 41.0 42-43 36.95325 40.0 36.0 41.0 31.0 41.0 44-45 36.415875 39.0 35.5 41.0 29.0 41.0 46-47 37.1305 40.0 36.0 41.0 31.5 41.0 48-49 36.869375000000005 40.0 35.0 41.0 31.0 41.0 50-51 36.16675 38.5 34.5 40.5 30.5 40.5 52-53 35.99275 38.5 34.5 40.0 29.5 41.0 54-55 36.481624999999994 39.0 35.0 41.0 31.0 41.0 56-57 36.189875 39.0 35.0 41.0 30.0 41.0 58-59 35.804125 38.0 34.5 40.5 29.5 41.0 60-61 35.437125 37.5 34.0 40.5 28.0 41.0 62-63 34.814875 37.0 34.0 40.0 26.5 41.0 64-65 34.742125 36.5 34.0 40.0 27.0 41.0 66-67 34.50575 36.0 33.5 39.5 27.0 41.0 68-69 34.236374999999995 36.0 33.5 39.0 27.0 41.0 70-71 33.999 35.0 33.5 39.0 26.0 41.0 72-73 33.583625 35.0 33.0 38.0 26.0 40.5 74-75 33.300375 35.0 33.0 37.0 25.5 39.5 76-77 33.09025 35.0 33.0 37.0 26.5 39.0 78-79 32.745875 35.0 33.0 36.0 26.0 39.0 80-81 32.01575 35.0 32.5 36.0 24.0 37.5 82-83 31.915999999999997 35.0 32.5 36.0 24.0 37.0 84-85 31.533375 35.0 32.0 35.0 23.5 37.0 86-87 31.424 35.0 32.0 35.0 24.0 36.0 88-89 31.1245 35.0 32.0 35.0 21.5 36.0 90-91 31.046375 35.0 32.0 35.0 21.0 36.0 92-93 30.542125 34.5 31.5 35.0 19.0 35.5 94-95 30.355375000000002 34.5 31.0 35.0 17.5 35.0 96-97 30.15 34.0 31.0 35.0 13.5 35.0 98-99 29.881749999999997 34.0 31.0 35.0 2.0 35.0 100-101 28.969 34.0 30.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 0.0 5 5.0 6 1.0 7 4.0 8 5.0 9 3.0 10 7.0 11 4.0 12 7.0 13 14.0 14 11.0 15 15.0 16 4.0 17 8.0 18 9.0 19 14.0 20 10.0 21 14.0 22 21.0 23 16.0 24 21.0 25 32.0 26 30.0 27 33.0 28 53.0 29 51.0 30 69.0 31 101.0 32 109.0 33 148.0 34 228.0 35 348.0 36 529.0 37 860.0 38 947.0 39 260.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.611805902951478 15.482741370685343 14.232116058029016 46.673336668334166 2 23.28664332166083 22.436218109054526 35.89294647323662 18.384192096048025 3 21.98599299649825 26.688344172086044 26.338169084542272 24.987493746873437 4 24.81240620310155 32.191095547773884 19.18459229614807 23.81190595297649 5 26.1195896922692 33.87540655491619 21.341005754315738 18.663997998498875 6 19.13456728364182 36.39319659829915 22.936468234117058 21.53576788394197 7 18.65 16.5 41.0 23.849999999999998 8 20.349999999999998 22.650000000000002 28.249999999999996 28.749999999999996 9 19.975 21.65 32.65 25.724999999999998 10-11 24.15 29.675 21.9625 24.212500000000002 12-13 21.987499999999997 24.3 28.012500000000003 25.7 14-15 22.527815976997125 25.653206650831358 26.990873859232405 24.82810351293912 16-17 24.19959979989995 25.63781890945473 25.437718859429715 24.72486243121561 18-19 23.461730865432717 27.326163081540773 25.325162581290645 23.88694347173587 20-21 23.08654327163582 27.03851925962982 26.575787893946973 23.299149574787396 22-23 22.3625 27.175 26.5875 23.875 24-25 22.811405702851424 26.425712856428213 26.900950475237618 23.861930965482742 26-27 22.136068034017008 27.37618809404702 27.138569284642323 23.349174587293646 28-29 23.64045505688211 25.815726965870734 26.578322290286287 23.96549568696087 30-31 23.074037018509255 26.688344172086044 26.075537768884445 24.16208104052026 32-33 22.8 26.6125 27.950000000000003 22.6375 34-35 23.125 26.2625 26.787499999999998 23.825 36-37 23.275000000000002 26.575 26.025 24.125 38-39 22.8 26.950000000000003 26.525 23.724999999999998 40-41 23.7125 26.525 25.912499999999998 23.849999999999998 42-43 24.099999999999998 26.187500000000004 27.1625 22.55 44-45 22.5625 27.55 26.224999999999998 23.6625 46-47 24.375 25.674999999999997 26.55 23.400000000000002 48-49 23.4625 25.9875 27.1625 23.3875 50-51 22.925 26.875 26.224999999999998 23.974999999999998 52-53 23.8125 26.087500000000002 26.4125 23.6875 54-55 23.775 25.937500000000004 26.950000000000003 23.3375 56-57 22.8375 26.9625 26.125 24.075 58-59 23.140392549068633 26.665833229153645 26.24078009751219 23.952994124265533 60-61 22.85 26.437500000000004 26.737499999999997 23.974999999999998 62-63 22.710760365777276 26.118000751597144 27.834147563572593 23.337091319052988 64-65 23.564803208824266 26.52293807971923 26.096766106793684 23.815492604662822 66-67 23.742631380910574 26.188385802082024 26.66499435595134 23.403988461056063 68-69 23.767097502823443 27.130129250847034 26.577989710126744 22.524783536202786 70-71 22.895791583166332 27.354709418837675 26.640781563126254 23.10871743486974 72-73 22.918229557389346 27.11927981995499 25.693923480870218 24.268567141785446 74-75 23.265408176022003 26.62832854106763 27.00337542192774 23.102887860982623 76-77 22.948766128022047 26.61906551421771 27.12013027683828 23.31203808092196 78-79 24.28804416008029 25.95659264835027 26.14477480868147 23.61058838288797 80-81 23.196783111334508 27.444081427494343 25.860769037446595 23.498366423724555 82-83 23.8340666247643 27.228158390949087 26.059082338152106 22.878692646134507 84-85 23.560472718129244 26.46467186321348 26.690973095297966 23.283882323359318 86-87 22.39387088671188 27.631248430042703 26.463200200954535 23.51168048229088 88-89 22.763819095477388 25.829145728643216 27.763819095477388 23.64321608040201 90-91 23.03921568627451 26.533433886375065 26.923076923076923 23.504273504273502 92-93 23.648224814954208 26.245138627524778 26.5462300840547 23.560406473466315 94-95 23.650256795690844 27.18276337216585 26.10547413253163 23.061505699611676 96-97 23.71121121121121 26.13863863863864 25.7007007007007 24.44944944944945 98-99 23.4625 26.5125 26.987499999999997 23.0375 100-101 23.9375 26.224999999999998 26.150000000000002 23.6875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.5 13 1.0 14 1.0 15 1.5 16 3.0 17 5.0 18 4.5 19 4.0 20 4.0 21 6.5 22 9.5 23 11.5 24 18.5 25 26.5 26 25.5 27 31.5 28 39.0 29 49.0 30 57.0 31 57.5 32 72.0 33 80.5 34 84.5 35 92.5 36 90.5 37 105.0 38 122.0 39 121.0 40 134.5 41 138.0 42 139.0 43 147.0 44 147.5 45 147.0 46 136.0 47 126.5 48 120.0 49 113.0 50 103.5 51 98.0 52 89.0 53 78.0 54 77.0 55 79.5 56 69.5 57 56.0 58 58.5 59 58.0 60 52.5 61 49.5 62 47.5 63 45.5 64 52.5 65 59.0 66 52.5 67 50.0 68 50.0 69 41.5 70 34.0 71 29.0 72 33.5 73 33.0 74 22.5 75 25.5 76 23.5 77 14.5 78 11.5 79 9.0 80 5.5 81 5.0 82 5.0 83 1.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.05 5 0.075 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0125 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.0 24-25 0.05 26-27 0.05 28-29 0.0125 30-31 0.05 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0125 60-61 0.0 62-63 0.21250000000000002 64-65 0.27499999999999997 66-67 0.3375 68-69 0.3875 70-71 0.2 72-73 0.025 74-75 0.0125 76-77 0.21250000000000002 78-79 0.36250000000000004 80-81 0.525 82-83 0.5625 84-85 0.575 86-87 0.475 88-89 0.5 90-91 0.5499999999999999 92-93 0.36250000000000004 94-95 0.21250000000000002 96-97 0.1 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.0625 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262507 spots for SRR1979261.sra Written 262507 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra Read 262489 spots for SRR1979261.sra Written 262489 spots for SRR1979261.sra SRR ids: ['SRR1979261.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n7lxupne SRR1979261.sra spots: 5249798 blocks: [[1, 262489], [262490, 524978], [524979, 787467], [787468, 1049956], [1049957, 1312445], [1312446, 1574934], [1574935, 1837423], [1837424, 2099912], [2099913, 2362401], [2362402, 2624890], [2624891, 2887379], [2887380, 3149868], [3149869, 3412357], [3412358, 3674846], [3674847, 3937335], [3937336, 4199824], [4199825, 4462313], [4462314, 4724802], [4724803, 4987291], [4987292, 5249798]] SRR1979261 file size 1431808 SRR1979261 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1979261 SRR1979261_1.fastq SRR1979261_2.fastq Input file: SRR1979261_1.fastq Paired file: SRR1979261_2.fastq trimmed: SRR1979261-trimmed-pair1.fastq, SRR1979261-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:37:00 2024 >> started Sat Dec 7 11:37:05 2024 >> done (4.850s) 5249798 read pairs processed; of these: 16055 ( 0.31%) short read pairs filtered out after trimming by size control 27937 ( 0.53%) empty read pairs filtered out after trimming by size control 5205806 (99.16%) read pairs available; of these: 1066699 (20.49%) trimmed read pairs available after processing 4139107 (79.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 34 0.00% 19 44 0.00% 20 50 0.00% 21 88 0.00% 22 109 0.00% 23 141 0.00% 24 164 0.00% 25 229 0.00% 26 294 0.01% 27 354 0.01% 28 379 0.01% 29 466 0.01% 30 553 0.01% 31 626 0.01% 32 712 0.01% 33 807 0.02% 34 857 0.02% 35 988 0.02% 36 979 0.02% 37 1015 0.02% 38 1158 0.02% 39 1251 0.02% 40 1233 0.02% 41 1328 0.03% 42 1458 0.03% 43 1514 0.03% 44 1631 0.03% 45 1651 0.03% 46 1743 0.03% 47 1797 0.03% 48 1893 0.04% 49 1971 0.04% 50 2108 0.04% 51 2156 0.04% 52 2335 0.04% 53 2471 0.05% 54 2645 0.05% 55 2688 0.05% 56 2893 0.06% 57 2954 0.06% 58 3196 0.06% 59 3969 0.08% 60 4752 0.09% 61 5243 0.10% 62 5758 0.11% 63 6248 0.12% 64 6667 0.13% 65 7164 0.14% 66 7498 0.14% 67 8101 0.16% 68 8555 0.16% 69 8996 0.17% 70 9690 0.19% 71 10351 0.20% 72 10598 0.20% 73 11274 0.22% 74 11888 0.23% 75 12233 0.23% 76 11652 0.22% 77 13179 0.25% 78 13884 0.27% 79 13914 0.27% 80 14333 0.28% 81 14313 0.27% 82 14340 0.28% 83 14482 0.28% 84 15177 0.29% 85 15517 0.30% 86 16511 0.32% 87 18312 0.35% 88 19716 0.38% 89 22137 0.43% 90 22853 0.44% 91 24564 0.47% 92 26773 0.51% 93 30407 0.58% 94 35011 0.67% 95 41185 0.79% 96 49388 0.95% 97 64310 1.24% 98 86166 1.66% 99 118229 2.27% 100 160398 3.08% 101 4139107 79.51% 5205806 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=27 prefix-density=0.24 prefix-fanout=1.0 sequence=TACTCCAGAGGATACGAACGTGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=336.14 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=25.1 sequence=CGCCGCCGCCGA criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=28 prefix-density=0.23 prefix-fanout=1.0 sequence=TACTCCAGAGGATACGAACGTGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=296.63 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=24.3 sequence=CGCCGCCGCCGT SRR1979261 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:39:24 Started mapping on | Dec 07 11:39:24 Finished on | Dec 07 11:42:36 Mapping speed, Million of reads per hour | 97.61 Number of input reads | 5205806 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 3461610 Uniquely mapped reads % | 66.50% Average mapped length | 195.31 Number of splices: Total | 2046253 Number of splices: Annotated (sjdb) | 1941620 Number of splices: GT/AG | 2019472 Number of splices: GC/AG | 23813 Number of splices: AT/AC | 1305 Number of splices: Non-canonical | 1663 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.47 Insertion rate per base | 0.00% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 29218 % of reads mapped to multiple loci | 0.56% Number of reads mapped to too many loci | 2054 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 32.54% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1718991 1718991 1718991 N_multimapping 29218 29218 29218 N_noFeature 118677 1760134 1760306 N_ambiguous 67142 3867 3948 UnstrandedReadsAssigned:3275791 PositiveStrandReadsAssigned:1697609 NegativeStrandReadsAssigned:1697356 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR1979261 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR1979261-trimmed-pair1.fastq SRR1979261-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,205,806 reads, 3,370,200 reads pseudoaligned [quant] estimated average fragment length: 186.389 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,021 rounds 52973 SRR1979261.ke.tsv 35125 SRR1979261.se.tsv 88098 total ==> SRR1979261.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 750.853 0 0 PNS24247 1044 858.611 24.6997 12.9425 PNS24249 1928 1742.61 57.0637 14.7327 PNS24246 1044 858.611 24.6997 12.9425 PNS24248 1044 858.611 24.6997 12.9425 PNS24244 1471 1285.61 25.8373 9.04188 PNS24243 293 109.849 8 32.7654 KQK14069 1603 1417.61 66.9315 21.242 KQK14071 474 290.343 6.06848 9.40351 ==> SRR1979261.se.tsv <== BRADI_1g14170v3 73 BRADI_1g53295v3 13 BRADI_1g59795v3 15 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 18 BRADI_1g74790v3 32 BRADI_1g09890v3 0 BRADI_1g77505v3 16 BRADI_1g48960v3 0 SRR1979261 completed mapping pipeline successfully