Starting /dee2/code/volunteer_pipeline.sh SRR1979262 current disk space = 1542968889344 free memory = 1597755684 SRR1979262 SRAfilesize 653beb298ed38d30c6fe1af35c96b059 SRR1979262.sra SRR1979262.sra file validated SRR1979262 is paired end SRR1979262 is conventional basespace SRR1979262 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1979262_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81275 34.0 31.0 34.0 31.0 34.0 2 32.9155 34.0 31.0 34.0 31.0 34.0 3 33.0 34.0 31.0 34.0 31.0 34.0 4 36.42175 37.0 37.0 37.0 35.0 37.0 5 36.27575 37.0 37.0 37.0 35.0 37.0 6 36.3775 37.0 37.0 37.0 35.0 37.0 7 36.289 37.0 37.0 37.0 35.0 37.0 8 36.316 37.0 37.0 37.0 35.0 37.0 9 38.252 39.0 39.0 39.0 37.0 39.0 10-11 38.124875 39.0 39.0 39.0 37.0 39.0 12-13 38.0945 39.0 38.5 39.0 36.0 39.0 14-15 39.738749999999996 41.0 40.0 41.0 37.0 41.0 16-17 39.6875 41.0 40.0 41.0 37.0 41.0 18-19 39.508125 41.0 39.5 41.0 36.5 41.0 20-21 39.32125 41.0 39.0 41.0 36.0 41.0 22-23 39.322874999999996 41.0 39.0 41.0 36.5 41.0 24-25 39.358000000000004 41.0 39.0 41.0 36.0 41.0 26-27 39.00875 40.0 39.0 41.0 35.5 41.0 28-29 39.04475 40.0 38.5 41.0 35.5 41.0 30-31 38.964375000000004 40.0 38.5 41.0 35.0 41.0 32-33 38.767250000000004 40.0 38.0 41.0 35.0 41.0 34-35 38.573375 40.0 38.0 41.0 34.5 41.0 36-37 38.3 40.0 38.0 41.0 34.0 41.0 38-39 37.956 40.0 37.5 41.0 33.0 41.0 40-41 37.8445 40.0 37.0 41.0 33.0 41.0 42-43 37.639125 40.0 37.0 41.0 33.0 41.0 44-45 37.210499999999996 40.0 36.0 41.0 31.5 41.0 46-47 37.291375 40.0 35.5 41.0 32.0 41.0 48-49 37.162000000000006 40.0 35.0 41.0 31.0 41.0 50-51 36.966375 39.0 35.0 41.0 31.0 41.0 52-53 36.6725 39.0 35.0 41.0 31.0 41.0 54-55 36.271125 39.0 35.0 41.0 30.5 41.0 56-57 35.98675 38.0 34.0 40.0 30.0 41.0 58-59 35.93925 38.0 34.5 40.0 30.0 41.0 60-61 35.968875 38.0 35.0 40.0 30.0 41.0 62-63 35.84225 37.0 35.0 40.0 30.5 41.0 64-65 35.650375 37.0 35.0 40.0 31.0 41.0 66-67 35.25925 36.0 34.0 39.5 30.0 41.0 68-69 35.02675 36.0 34.0 39.0 30.0 41.0 70-71 34.569 35.0 34.0 39.0 29.5 41.0 72-73 34.115625 35.0 34.0 37.5 29.0 40.0 74-75 33.7035 35.0 34.0 37.0 29.0 39.0 76-77 32.4645 34.5 31.5 36.0 26.5 39.0 78-79 33.235375 35.0 33.0 36.0 28.5 38.5 80-81 33.14925 35.0 33.5 36.0 29.0 37.0 82-83 32.783125 35.0 33.0 35.0 27.5 37.0 84-85 32.41175 35.0 33.0 35.0 26.5 36.5 86-87 32.292249999999996 35.0 33.0 35.0 27.0 36.0 88-89 32.03375 35.0 33.0 35.0 26.5 36.0 90-91 31.718625 35.0 33.0 35.0 25.0 36.0 92-93 31.40075 35.0 32.5 35.0 24.5 35.5 94-95 31.288125 35.0 33.0 35.0 24.0 35.0 96-97 30.956375 35.0 32.0 35.0 23.0 35.0 98-99 30.654249999999998 35.0 32.0 35.0 20.0 35.0 100-101 29.618375 34.5 30.5 35.0 8.5 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 2.0 9 2.0 10 2.0 11 7.0 12 8.0 13 9.0 14 10.0 15 6.0 16 1.0 17 10.0 18 8.0 19 11.0 20 13.0 21 10.0 22 12.0 23 19.0 24 18.0 25 27.0 26 26.0 27 30.0 28 32.0 29 59.0 30 56.0 31 75.0 32 117.0 33 135.0 34 232.0 35 355.0 36 556.0 37 882.0 38 1036.0 39 231.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.925 13.750000000000002 14.075 49.25 2 22.85 21.05 36.95 19.15 3 22.225 25.775 25.650000000000002 26.35 4 26.575 30.275000000000002 18.675 24.474999999999998 5 27.725 32.65 19.775000000000002 19.85 6 19.900000000000002 35.15 22.325 22.625 7 18.55 16.1 41.475 23.875 8 21.330332583145786 21.655413853463365 26.85671417854464 30.15753938484621 9 21.66624968726545 20.040030022516888 30.497873405053788 27.795846885163872 10-11 25.7125 29.575000000000003 20.0875 24.625 12-13 22.5875 22.7125 28.249999999999996 26.450000000000003 14-15 24.1625 24.6875 26.5125 24.637500000000003 16-17 24.675 25.275 25.5625 24.4875 18-19 23.8375 25.474999999999998 25.0625 25.624999999999996 20-21 23.1125 26.575 25.624999999999996 24.6875 22-23 23.8375 25.662499999999998 25.174999999999997 25.324999999999996 24-25 23.7 25.2 25.687500000000004 25.412499999999998 26-27 24.212500000000002 26.5375 25.3 23.95 28-29 23.4875 25.9875 25.837500000000002 24.6875 30-31 22.7 26.174999999999997 25.775 25.35 32-33 22.8625 26.174999999999997 25.900000000000002 25.0625 34-35 23.799999999999997 25.724999999999998 24.975 25.5 36-37 24.2375 25.374999999999996 25.75 24.637500000000003 38-39 24.349999999999998 25.8125 25.087500000000002 24.75 40-41 24.7375 25.3125 24.375 25.575 42-43 23.974999999999998 26.0 26.150000000000002 23.875 44-45 24.4 25.5125 26.174999999999997 23.9125 46-47 24.4125 25.8 25.3125 24.474999999999998 48-49 24.15 25.912499999999998 25.1875 24.75 50-51 23.377922240280036 26.26578322290286 25.84073009126141 24.515564445555693 52-53 24.840605075634453 26.22827853481685 24.66558319789974 24.265533191648956 54-55 24.72809101137642 24.85310663832979 25.753219152394045 24.66558319789974 56-57 24.315539442430303 25.51568946118265 26.040755094386796 24.128016002000248 58-59 24.112056028014006 25.912956478239117 24.64982491245623 25.325162581290645 60-61 24.028003500437556 25.50318789848731 26.078259782472806 24.390548818602326 62-63 23.825 25.525 25.4875 25.162499999999998 64-65 24.675 25.412499999999998 25.15 24.762500000000003 66-67 24.031007751937985 25.168792198049513 26.03150787696924 24.76869217304326 68-69 24.46555819477435 25.778222277784725 26.403300412551566 23.35291911488936 70-71 24.4125 24.8625 26.4625 24.2625 72-73 23.9875 26.087500000000002 25.0625 24.8625 74-75 23.925 26.1125 25.912499999999998 24.05 76-77 24.9375 25.362499999999997 25.2125 24.4875 78-79 24.275 26.0125 25.95 23.7625 80-81 24.3125 26.375 25.0375 24.275 82-83 24.087500000000002 25.1 26.2625 24.55 84-85 24.175 25.85 25.162499999999998 24.8125 86-87 24.75 25.7 26.125 23.425 88-89 24.8906113264158 25.003125390673837 25.928241030128767 24.1780222527816 90-91 23.577947243405426 25.603200400050007 26.253281660207527 24.56557069633704 92-93 24.94061757719715 25.478184773096636 25.84073009126141 23.740467558444806 94-95 25.0375 25.474999999999998 25.474999999999998 24.0125 96-97 24.1780222527816 25.315664458057256 25.61570196274534 24.8906113264158 98-99 24.7 26.237500000000004 26.224999999999998 22.8375 100-101 24.0375 25.9875 25.0 24.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 1.0 15 1.0 16 2.0 17 4.5 18 4.0 19 3.0 20 5.5 21 5.0 22 4.5 23 9.5 24 12.5 25 13.0 26 15.5 27 19.5 28 21.5 29 23.0 30 37.5 31 49.0 32 45.5 33 49.5 34 61.5 35 69.0 36 76.0 37 90.5 38 98.5 39 104.5 40 115.0 41 121.5 42 138.0 43 155.5 44 166.0 45 161.0 46 147.0 47 145.5 48 137.0 49 126.0 50 121.0 51 120.0 52 109.5 53 89.0 54 92.0 55 88.5 56 63.0 57 59.5 58 69.0 59 72.0 60 69.0 61 59.5 62 62.5 63 61.5 64 53.5 65 60.5 66 62.0 67 54.0 68 52.5 69 53.5 70 48.5 71 44.0 72 36.5 73 33.0 74 31.0 75 22.0 76 18.0 77 14.5 78 10.0 79 8.0 80 6.5 81 3.5 82 4.5 83 3.5 84 0.5 85 1.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.075 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0125 52-53 0.0125 54-55 0.0125 56-57 0.0125 58-59 0.05 60-61 0.0125 62-63 0.0 64-65 0.0 66-67 0.025 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.0125 92-93 0.0125 94-95 0.0 96-97 0.0125 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR1979262 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1979262_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.55725 33.0 31.0 34.0 31.0 34.0 2 32.6925 34.0 31.0 34.0 31.0 34.0 3 32.78975 34.0 31.0 34.0 31.0 34.0 4 36.21375 37.0 37.0 37.0 35.0 37.0 5 36.202 37.0 37.0 37.0 35.0 37.0 6 36.166 37.0 37.0 37.0 35.0 37.0 7 36.16425 37.0 37.0 37.0 35.0 37.0 8 36.1955 37.0 37.0 37.0 35.0 37.0 9 37.82125 39.0 38.0 39.0 35.0 39.0 10-11 37.807625 39.0 38.0 39.0 35.0 39.0 12-13 37.894125 39.0 38.0 39.0 35.0 39.0 14-15 39.373999999999995 41.0 39.5 41.0 37.0 41.0 16-17 39.30475 41.0 39.0 41.0 36.0 41.0 18-19 39.270125 41.0 39.0 41.0 36.0 41.0 20-21 39.224875 41.0 39.0 41.0 36.0 41.0 22-23 39.12525 41.0 39.0 41.0 36.0 41.0 24-25 39.041875000000005 41.0 39.0 41.0 36.0 41.0 26-27 38.839875 41.0 39.0 41.0 35.0 41.0 28-29 38.839625 40.5 39.0 41.0 35.0 41.0 30-31 38.67225 40.0 38.0 41.0 35.0 41.0 32-33 38.432625 40.0 38.0 41.0 34.0 41.0 34-35 38.226375 40.0 38.0 41.0 33.5 41.0 36-37 37.830375000000004 40.0 38.0 41.0 33.0 41.0 38-39 37.735 40.0 37.5 41.0 33.0 41.0 40-41 37.568625 40.0 37.0 41.0 32.5 41.0 42-43 36.892375 39.0 36.0 41.0 31.0 41.0 44-45 36.208 39.0 34.5 41.0 28.5 41.0 46-47 37.011875 39.0 35.5 41.0 31.0 41.0 48-49 36.714124999999996 39.0 35.0 41.0 31.0 41.0 50-51 35.89025 38.5 34.5 40.0 29.5 40.5 52-53 35.728624999999994 38.0 34.5 40.0 29.5 41.0 54-55 36.172250000000005 39.0 35.0 41.0 30.0 41.0 56-57 36.02625 38.0 35.0 41.0 30.0 41.0 58-59 35.624750000000006 38.0 34.5 40.0 28.5 41.0 60-61 35.262875 37.5 34.0 40.0 28.0 41.0 62-63 34.677 37.0 34.0 40.0 26.0 41.0 64-65 34.463499999999996 36.0 33.0 40.0 26.0 41.0 66-67 34.16575 35.5 33.0 39.0 26.0 41.0 68-69 33.926625 35.0 33.0 39.0 26.0 41.0 70-71 33.878375 35.0 33.0 39.0 26.0 41.0 72-73 33.486625000000004 35.0 33.0 37.5 26.0 40.0 74-75 33.193125 35.0 33.0 37.0 26.5 39.5 76-77 33.0805 35.0 33.0 37.0 27.0 39.0 78-79 32.601749999999996 35.0 33.0 36.0 26.0 39.0 80-81 31.87425 35.0 32.0 36.0 24.0 37.0 82-83 31.727874999999997 35.0 32.0 35.5 23.5 37.0 84-85 31.46975 35.0 32.0 35.0 23.5 37.0 86-87 31.208624999999998 35.0 32.0 35.0 23.0 36.0 88-89 30.9805 35.0 32.0 35.0 20.5 36.0 90-91 30.787625 35.0 32.0 35.0 20.0 36.0 92-93 30.270875 34.5 31.0 35.0 16.5 35.0 94-95 30.166625 34.0 31.0 35.0 16.0 35.0 96-97 29.910625 34.0 31.0 35.0 6.5 35.0 98-99 29.57675 34.0 31.0 35.0 2.0 35.0 100-101 28.524124999999998 33.5 29.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 3.0 5 1.0 6 4.0 7 2.0 8 7.0 9 2.0 10 9.0 11 12.0 12 4.0 13 6.0 14 5.0 15 8.0 16 12.0 17 8.0 18 12.0 19 21.0 20 15.0 21 16.0 22 17.0 23 17.0 24 18.0 25 30.0 26 34.0 27 38.0 28 49.0 29 51.0 30 64.0 31 108.0 32 136.0 33 170.0 34 227.0 35 357.0 36 545.0 37 825.0 38 945.0 39 213.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.08654327163582 13.681840920460232 12.581290645322662 50.65032516258129 2 23.23661830915458 21.48574287143572 36.51825912956478 18.75937968984492 3 22.655663915978995 25.6064016004001 26.6816704176044 25.056264066016503 4 25.737868934467233 29.914957478739368 19.034517258629315 25.312656328164078 5 25.91943957968476 32.749562171628725 21.94145609206905 19.389542156617463 6 19.654913728432106 35.15878969742436 21.880470117529384 23.305826456614152 7 19.125 15.950000000000001 40.699999999999996 24.224999999999998 8 20.9 20.775 27.125 31.2 9 19.25 21.525 31.674999999999997 27.55 10-11 25.275 29.362500000000004 21.0375 24.325 12-13 23.175 23.7875 27.187499999999996 25.85 14-15 23.07788473559195 25.29066133266658 26.765845730716343 24.86560820102513 16-17 24.449724862431214 25.087543771885944 25.200100050025014 25.26263131565783 18-19 24.20907840440165 25.23446292359635 25.397023883956482 25.159434788045516 20-21 24.02150806552457 26.147305239464803 25.5220707765412 24.309115918469427 22-23 23.962500000000002 26.325 25.5375 24.175 24-25 23.980995248812203 26.006501625406354 26.094023505876468 23.918479619904975 26-27 23.82143303738902 26.372389646117295 25.35950981618107 24.446667500312618 28-29 24.603075384423054 24.8906113264158 26.078259782472806 24.428053506688336 30-31 23.893473368342086 25.49387346836709 26.019004751187797 24.593648412103025 32-33 23.5375 26.724999999999998 26.125 23.6125 34-35 24.349999999999998 24.6625 26.087500000000002 24.9 36-37 23.85298162270284 26.115764470558823 25.203150393799223 24.82810351293912 38-39 24.575 25.5125 26.3 23.6125 40-41 24.0625 25.825 25.7 24.4125 42-43 24.6125 25.2125 26.1125 24.0625 44-45 24.474999999999998 25.912499999999998 26.4625 23.150000000000002 46-47 24.875 26.0 25.074999999999996 24.05 48-49 24.762500000000003 25.674999999999997 25.474999999999998 24.087500000000002 50-51 24.5375 25.837500000000002 26.150000000000002 23.474999999999998 52-53 24.95 24.725 25.387500000000003 24.9375 54-55 23.7125 25.674999999999997 25.137500000000003 25.474999999999998 56-57 24.637500000000003 25.624999999999996 25.8125 23.925 58-59 25.087500000000002 24.875 25.7875 24.25 60-61 23.7 25.0 26.174999999999997 25.124999999999996 62-63 23.16263928884437 26.41792913484412 26.192562914736445 24.22686866157506 64-65 25.018811136192625 25.821419613744673 25.21946325558064 23.940305994482067 66-67 23.36847389558233 26.20481927710843 25.953815261044177 24.47289156626506 68-69 24.679728711379052 25.998492840994725 25.784978648580758 23.536799799045465 70-71 24.301990734944283 25.07825215975961 25.954676349067235 24.66508075622887 72-73 24.58114528632158 24.93123280820205 25.64391097774444 24.843710927731934 74-75 23.8125 27.487499999999997 25.35 23.35 76-77 24.27391086629945 25.963945918878316 24.261392088132197 25.500751126690034 78-79 24.723756906077348 25.3264691109995 25.41436464088398 24.535409342039177 80-81 24.009060022650054 26.299232414747703 25.87139801182836 23.820309550773878 82-83 24.35494021397105 25.903083700440526 24.380113278791693 25.361862806796726 84-85 24.084099206848798 25.909605942339166 25.00314742540602 25.00314742540602 86-87 24.101081216997734 25.584611516218253 25.898918783002262 24.415388483781744 88-89 24.60377358490566 25.08176100628931 25.572327044025155 24.742138364779876 90-91 23.82330732443997 25.723634533098416 25.660709791089857 24.79234835137176 92-93 23.904582548650346 25.83804143126177 25.24795982423101 25.009416195856875 94-95 24.931129476584022 25.0313047833709 26.170798898071624 23.86676684197345 96-97 23.78986866791745 25.553470919324578 25.8036272670419 24.853033145716072 98-99 23.6125 26.075 25.6125 24.7 100-101 24.587500000000002 25.9625 25.7625 23.6875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 2.0 18 6.5 19 7.5 20 5.0 21 3.5 22 5.5 23 10.5 24 14.5 25 15.5 26 16.0 27 18.5 28 23.5 29 29.5 30 40.0 31 44.0 32 40.0 33 54.0 34 65.0 35 74.0 36 85.0 37 83.5 38 96.5 39 118.5 40 124.5 41 134.0 42 139.5 43 131.0 44 131.5 45 146.0 46 148.0 47 150.5 48 144.0 49 131.5 50 130.5 51 111.0 52 96.5 53 98.0 54 93.0 55 74.5 56 70.5 57 67.0 58 62.0 59 71.0 60 76.0 61 74.5 62 71.5 63 66.5 64 56.5 65 54.0 66 63.0 67 61.0 68 51.5 69 49.5 70 40.5 71 36.0 72 39.5 73 27.5 74 16.0 75 20.0 76 22.0 77 18.5 78 12.0 79 7.5 80 7.0 81 4.0 82 2.0 83 1.0 84 1.0 85 1.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.025 4 0.05 5 0.075 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0125 16-17 0.05 18-19 0.0375 20-21 0.0375 22-23 0.0 24-25 0.025 26-27 0.0375 28-29 0.0125 30-31 0.025 32-33 0.0 34-35 0.0 36-37 0.0125 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.1625 64-65 0.325 66-67 0.4 68-69 0.475 70-71 0.1625 72-73 0.025 74-75 0.0 76-77 0.15 78-79 0.44999999999999996 80-81 0.6625 82-83 0.6875 84-85 0.7125 86-87 0.575 88-89 0.625 90-91 0.675 92-93 0.43750000000000006 94-95 0.17500000000000002 96-97 0.0625 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307262 spots for SRR1979262.sra Written 307262 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra Read 307259 spots for SRR1979262.sra Written 307259 spots for SRR1979262.sra SRR ids: ['SRR1979262.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0ssf9hsu SRR1979262.sra spots: 6145183 blocks: [[1, 307259], [307260, 614518], [614519, 921777], [921778, 1229036], [1229037, 1536295], [1536296, 1843554], [1843555, 2150813], [2150814, 2458072], [2458073, 2765331], [2765332, 3072590], [3072591, 3379849], [3379850, 3687108], [3687109, 3994367], [3994368, 4301626], [4301627, 4608885], [4608886, 4916144], [4916145, 5223403], [5223404, 5530662], [5530663, 5837921], [5837922, 6145183]] SRR1979262 file size 1676192 SRR1979262 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1979262 SRR1979262_1.fastq SRR1979262_2.fastq Input file: SRR1979262_1.fastq Paired file: SRR1979262_2.fastq trimmed: SRR1979262-trimmed-pair1.fastq, SRR1979262-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:45:11 2024 >> started Sat Dec 7 11:45:17 2024 >> done (6.542s) 6145183 read pairs processed; of these: 18677 ( 0.30%) short read pairs filtered out after trimming by size control 14205 ( 0.23%) empty read pairs filtered out after trimming by size control 6112301 (99.46%) read pairs available; of these: 1292754 (21.15%) trimmed read pairs available after processing 4819547 (78.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 24 0.00% 20 52 0.00% 21 97 0.00% 22 117 0.00% 23 155 0.00% 24 241 0.00% 25 280 0.00% 26 379 0.01% 27 440 0.01% 28 555 0.01% 29 625 0.01% 30 733 0.01% 31 859 0.01% 32 932 0.02% 33 1032 0.02% 34 1163 0.02% 35 1181 0.02% 36 1359 0.02% 37 1419 0.02% 38 1437 0.02% 39 1534 0.03% 40 1629 0.03% 41 1823 0.03% 42 1812 0.03% 43 1942 0.03% 44 1957 0.03% 45 2076 0.03% 46 2150 0.04% 47 2288 0.04% 48 2431 0.04% 49 2427 0.04% 50 2606 0.04% 51 2705 0.04% 52 2884 0.05% 53 3038 0.05% 54 3238 0.05% 55 3241 0.05% 56 3552 0.06% 57 3858 0.06% 58 4078 0.07% 59 4894 0.08% 60 5609 0.09% 61 6128 0.10% 62 6845 0.11% 63 7490 0.12% 64 8015 0.13% 65 8505 0.14% 66 8972 0.15% 67 9431 0.15% 68 10289 0.17% 69 10961 0.18% 70 11505 0.19% 71 12314 0.20% 72 13064 0.21% 73 13228 0.22% 74 14018 0.23% 75 14875 0.24% 76 13795 0.23% 77 15653 0.26% 78 16841 0.28% 79 16872 0.28% 80 16958 0.28% 81 17578 0.29% 82 17252 0.28% 83 17489 0.29% 84 17904 0.29% 85 18472 0.30% 86 19725 0.32% 87 21861 0.36% 88 23879 0.39% 89 26437 0.43% 90 27444 0.45% 91 29544 0.48% 92 32518 0.53% 93 36794 0.60% 94 42199 0.69% 95 49778 0.81% 96 59277 0.97% 97 78381 1.28% 98 105226 1.72% 99 144002 2.36% 100 196363 3.21% 101 4819547 78.85% 6112301 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=161.60 fanout-score-rank=16 prefix-density=0.61 prefix-fanout=21.5 sequence=CCGCCGCCGCCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=364.54 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=26.0 sequence=CGCCGCCGCCGA criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=161.01 fanout-score-rank=18 prefix-density=0.61 prefix-fanout=21.4 sequence=CCGCCGCCGCCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=372.79 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=26.4 sequence=CGCCGCCGCCGA SRR1979262 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:45:57 Started mapping on | Dec 07 11:45:57 Finished on | Dec 07 11:48:54 Mapping speed, Million of reads per hour | 124.32 Number of input reads | 6112301 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 4762785 Uniquely mapped reads % | 77.92% Average mapped length | 195.49 Number of splices: Total | 2859770 Number of splices: Annotated (sjdb) | 2716469 Number of splices: GT/AG | 2820177 Number of splices: GC/AG | 35293 Number of splices: AT/AC | 1938 Number of splices: Non-canonical | 2362 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.47 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 42833 % of reads mapped to multiple loci | 0.70% Number of reads mapped to too many loci | 2527 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 21.06% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1312389 1312389 1312389 N_multimapping 42833 42833 42833 N_noFeature 151872 2414327 2417847 N_ambiguous 91151 4640 4623 UnstrandedReadsAssigned:4519762 PositiveStrandReadsAssigned:2343818 NegativeStrandReadsAssigned:2340315 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR1979262 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR1979262-trimmed-pair1.fastq SRR1979262-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,112,301 reads, 4,649,699 reads pseudoaligned [quant] estimated average fragment length: 179.604 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52973 SRR1979262.ke.tsv 35125 SRR1979262.se.tsv 88098 total ==> SRR1979262.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 757.611 0 0 PNS24247 1044 865.396 25.0938 9.27871 PNS24249 1928 1749.4 59.8774 10.9524 PNS24246 1044 865.396 25.0938 9.27871 PNS24248 1044 865.396 25.0938 9.27871 PNS24244 1471 1292.4 42.8411 10.6072 PNS24243 293 116.519 4 10.9849 KQK14069 1603 1424.4 167.792 37.6943 KQK14071 474 297.04 0 0 ==> SRR1979262.se.tsv <== BRADI_1g14170v3 172 BRADI_1g53295v3 11 BRADI_1g59795v3 22 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 59 BRADI_1g74790v3 28 BRADI_1g09890v3 0 BRADI_1g77505v3 29 BRADI_1g48960v3 0 SRR1979262 completed mapping pipeline successfully