Starting /dee2/code/volunteer_pipeline.sh SRR1979263 current disk space = 1543107174400 free memory = 1603861948 SRR1979263 SRAfilesize f5e2ae85e241fcb86ec1da6a97eb29f0 SRR1979263.sra SRR1979263.sra file validated SRR1979263 is paired end SRR1979263 is conventional basespace SRR1979263 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1979263_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.679 34.0 31.0 34.0 31.0 34.0 2 32.834 34.0 31.0 34.0 31.0 34.0 3 32.91175 34.0 31.0 34.0 31.0 34.0 4 36.41 37.0 37.0 37.0 35.0 37.0 5 36.20525 37.0 37.0 37.0 35.0 37.0 6 36.26425 37.0 37.0 37.0 35.0 37.0 7 36.24675 37.0 37.0 37.0 35.0 37.0 8 36.20125 37.0 37.0 37.0 35.0 37.0 9 38.1065 39.0 39.0 39.0 37.0 39.0 10-11 38.043499999999995 39.0 38.5 39.0 36.0 39.0 12-13 38.006375000000006 39.0 38.5 39.0 35.0 39.0 14-15 39.692750000000004 41.0 40.0 41.0 37.0 41.0 16-17 39.6475 41.0 40.0 41.0 37.0 41.0 18-19 39.442375 41.0 39.5 41.0 36.5 41.0 20-21 39.223625 41.0 39.0 41.0 36.0 41.0 22-23 39.351749999999996 41.0 39.0 41.0 36.5 41.0 24-25 39.38075 41.0 39.0 41.0 36.5 41.0 26-27 38.921125 40.0 39.0 41.0 35.5 41.0 28-29 38.93875 40.0 38.5 41.0 35.5 41.0 30-31 38.900625000000005 40.0 38.0 41.0 35.0 41.0 32-33 38.756375000000006 40.0 38.0 41.0 35.0 41.0 34-35 38.672 40.0 38.0 41.0 35.0 41.0 36-37 38.34175 40.0 38.0 41.0 34.0 41.0 38-39 37.9875 40.0 37.0 41.0 33.0 41.0 40-41 37.954875 40.0 37.0 41.0 33.0 41.0 42-43 37.765 40.0 37.0 41.0 33.0 41.0 44-45 37.356624999999994 40.0 36.0 41.0 32.0 41.0 46-47 37.32575 40.0 36.0 41.0 32.0 41.0 48-49 37.24025 40.0 36.0 41.0 32.0 41.0 50-51 37.082499999999996 39.5 35.0 41.0 31.5 41.0 52-53 36.734125 39.0 35.0 41.0 31.0 41.0 54-55 36.40175 38.5 35.0 41.0 30.5 41.0 56-57 36.142875000000004 38.0 35.0 40.0 30.0 41.0 58-59 35.969375 38.0 35.0 40.0 30.0 41.0 60-61 36.10225 38.0 35.0 40.5 31.0 41.0 62-63 35.991875 37.5 35.0 40.0 31.0 41.0 64-65 35.629125 37.0 35.0 40.0 30.0 41.0 66-67 35.241625 36.5 34.0 39.5 30.0 41.0 68-69 34.895250000000004 36.0 34.0 39.0 29.5 41.0 70-71 34.585750000000004 35.5 34.0 39.0 29.0 41.0 72-73 34.093625 35.0 34.0 37.5 29.0 40.0 74-75 33.627875 35.0 33.5 37.0 28.0 39.0 76-77 32.438125 34.5 31.5 36.0 26.0 39.0 78-79 33.040625 35.0 33.0 36.0 27.0 39.0 80-81 32.890875 35.0 33.0 36.0 27.0 37.0 82-83 32.576750000000004 35.0 33.0 35.5 26.5 37.0 84-85 32.2855 35.0 33.0 35.0 26.0 37.0 86-87 32.079875 35.0 33.0 35.0 25.5 36.0 88-89 31.7335 35.0 32.5 35.0 25.0 36.0 90-91 31.501125000000002 35.0 33.0 35.0 24.0 36.0 92-93 31.243499999999997 35.0 32.0 35.0 24.0 35.5 94-95 31.15 35.0 32.0 35.0 23.5 35.0 96-97 30.794874999999998 35.0 32.0 35.0 21.5 35.0 98-99 30.465249999999997 35.0 32.0 35.0 18.5 35.0 100-101 29.639125 34.5 30.5 35.0 9.5 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 3.0 10 5.0 11 8.0 12 5.0 13 6.0 14 5.0 15 8.0 16 14.0 17 14.0 18 12.0 19 10.0 20 8.0 21 10.0 22 19.0 23 18.0 24 19.0 25 26.0 26 29.0 27 27.0 28 27.0 29 47.0 30 59.0 31 93.0 32 113.0 33 140.0 34 229.0 35 333.0 36 543.0 37 855.0 38 1078.0 39 234.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.349999999999998 15.275 13.55 46.825 2 24.4 21.675 35.85 18.075 3 22.2 26.75 26.150000000000002 24.9 4 24.05 31.775 20.424999999999997 23.75 5 27.325 32.675 20.5 19.5 6 19.2 35.625 22.625 22.55 7 19.425 17.325 40.400000000000006 22.85 8 20.38519259629815 20.83541770885443 28.83941970985493 29.939969984992498 9 21.816362271703778 20.815611708781585 30.773079809857396 26.594946209657245 10-11 25.0 30.562499999999996 20.5625 23.875 12-13 21.512500000000003 24.275 28.962500000000002 25.25 14-15 22.5 25.324999999999996 27.075 25.1 16-17 23.925 24.975 26.075 25.025 18-19 23.4375 25.95 25.2375 25.374999999999996 20-21 22.787499999999998 26.3625 25.412499999999998 25.4375 22-23 23.75 26.137500000000003 25.7875 24.325 24-25 23.2875 26.687499999999996 26.55 23.474999999999998 26-27 23.5125 25.55 25.937500000000004 25.0 28-29 23.1125 26.150000000000002 26.3 24.4375 30-31 23.2375 25.587500000000002 26.6 24.575 32-33 23.125 26.55 25.75 24.575 34-35 24.125 25.424999999999997 26.025 24.425 36-37 23.1 26.637499999999996 25.5375 24.725 38-39 24.125 26.5 26.05 23.325000000000003 40-41 23.4125 26.5125 25.937500000000004 24.1375 42-43 23.7875 25.912499999999998 26.737499999999997 23.5625 44-45 23.4625 26.737499999999997 25.8625 23.9375 46-47 23.7375 26.375 25.974999999999998 23.9125 48-49 23.425 25.8125 25.85 24.9125 50-51 23.2875 26.9625 26.1 23.65 52-53 24.05 25.4875 25.7125 24.75 54-55 23.9 25.8125 25.75 24.5375 56-57 23.275000000000002 26.7625 25.75 24.212500000000002 58-59 24.2 26.637499999999996 25.9875 23.175 60-61 23.6625 25.912499999999998 26.337500000000002 24.087500000000002 62-63 23.8625 26.05 26.0625 24.025 64-65 24.075 26.8375 25.0125 24.075 66-67 23.1125 25.7 26.9625 24.224999999999998 68-69 23.6375 26.775 26.0125 23.575 70-71 24.1125 26.6 25.887500000000003 23.400000000000002 72-73 23.599999999999998 25.75 26.450000000000003 24.2 74-75 23.9875 26.2625 26.0625 23.6875 76-77 24.349999999999998 26.5625 25.6 23.4875 78-79 23.35 25.4375 27.075 24.1375 80-81 24.337500000000002 25.8 26.125 23.7375 82-83 23.9 26.75 25.5 23.849999999999998 84-85 24.6125 26.125 25.85 23.4125 86-87 23.849999999999998 26.525 25.424999999999997 24.2 88-89 24.593648412103025 25.406351587896975 25.95648912228057 24.043510877719427 90-91 24.431107776944234 25.418854713678417 25.55638909727432 24.593648412103025 92-93 24.118529632408105 25.618904726181547 26.094023505876468 24.168542135533883 94-95 24.5 25.95 25.4375 24.1125 96-97 24.1125 26.1125 25.55 24.224999999999998 98-99 23.3875 25.7375 26.150000000000002 24.725 100-101 25.087500000000002 26.25 25.2625 23.400000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 1.5 18 2.5 19 2.0 20 4.5 21 7.5 22 7.0 23 10.0 24 15.0 25 16.0 26 20.0 27 28.5 28 32.5 29 35.5 30 40.5 31 47.0 32 50.5 33 54.5 34 71.0 35 85.0 36 94.5 37 98.5 38 102.5 39 119.5 40 133.0 41 131.0 42 142.5 43 155.5 44 148.0 45 143.5 46 146.5 47 138.0 48 126.5 49 132.5 50 117.0 51 100.5 52 102.0 53 97.5 54 83.5 55 71.0 56 67.0 57 66.5 58 60.0 59 64.0 60 74.5 61 66.0 62 59.0 63 58.5 64 52.5 65 57.0 66 64.0 67 55.5 68 45.5 69 43.0 70 46.0 71 41.0 72 28.5 73 21.5 74 23.0 75 21.5 76 15.0 77 13.0 78 14.5 79 12.0 80 9.5 81 4.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.05 9 0.075 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.025 90-91 0.025 92-93 0.025 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84966173891256 99.625 2 0.10022550739163118 0.2 3 0.025056376847907794 0.075 4 0.025056376847907794 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.0875 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR1979263 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1979263_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.42175 33.0 31.0 34.0 31.0 34.0 2 32.5775 34.0 31.0 34.0 31.0 34.0 3 32.60375 34.0 31.0 34.0 31.0 34.0 4 36.03975 37.0 37.0 37.0 35.0 37.0 5 36.012 37.0 37.0 37.0 35.0 37.0 6 36.03525 37.0 37.0 37.0 35.0 37.0 7 35.99225 37.0 37.0 37.0 35.0 37.0 8 35.935 37.0 37.0 37.0 35.0 37.0 9 37.57875 39.0 38.0 39.0 35.0 39.0 10-11 37.520375 39.0 38.0 39.0 35.0 39.0 12-13 37.609375 39.0 38.0 39.0 35.0 39.0 14-15 39.122625 41.0 39.0 41.0 36.0 41.0 16-17 38.941874999999996 41.0 39.0 41.0 36.0 41.0 18-19 38.88375 41.0 39.0 41.0 35.5 41.0 20-21 38.84975 41.0 39.0 41.0 35.5 41.0 22-23 38.812125 41.0 39.0 41.0 35.0 41.0 24-25 38.78675 41.0 39.0 41.0 35.0 41.0 26-27 38.52975 40.0 38.0 41.0 34.5 41.0 28-29 38.472 40.0 38.0 41.0 34.5 41.0 30-31 38.304 40.0 38.0 41.0 34.0 41.0 32-33 38.145875000000004 40.0 38.0 41.0 33.5 41.0 34-35 38.011624999999995 40.0 38.0 41.0 33.0 41.0 36-37 37.5685 40.0 37.0 41.0 32.5 41.0 38-39 37.52375 40.0 37.0 41.0 33.0 41.0 40-41 37.222375 40.0 36.5 41.0 31.5 41.0 42-43 36.447500000000005 39.0 35.0 41.0 29.5 41.0 44-45 35.972750000000005 38.5 34.5 40.5 28.0 41.0 46-47 36.644375 39.0 35.0 41.0 30.5 41.0 48-49 36.323 39.0 35.0 41.0 30.0 41.0 50-51 35.709 38.5 34.0 40.0 29.0 40.5 52-53 35.456375 38.0 34.0 40.0 28.0 41.0 54-55 35.846875 38.5 35.0 41.0 29.5 41.0 56-57 35.661 38.0 35.0 41.0 28.5 41.0 58-59 35.248875 38.0 34.0 40.0 27.5 41.0 60-61 34.85925 37.5 33.5 40.0 26.5 41.0 62-63 34.260125 37.0 33.0 40.0 26.0 41.0 64-65 34.0925 36.0 33.0 39.5 26.0 41.0 66-67 33.730375 36.0 33.0 39.0 25.0 41.0 68-69 33.578 35.0 33.0 39.0 25.5 41.0 70-71 33.389624999999995 35.0 33.0 39.0 25.5 40.5 72-73 32.97 35.0 33.0 37.5 24.0 40.0 74-75 32.843374999999995 35.0 33.0 37.0 25.0 39.0 76-77 32.638000000000005 35.0 33.0 37.0 25.0 39.0 78-79 32.104749999999996 35.0 33.0 36.0 24.0 39.0 80-81 31.336375 35.0 32.0 36.0 20.0 37.0 82-83 31.06675 35.0 32.0 35.0 19.5 37.0 84-85 30.772624999999998 35.0 31.5 35.0 18.0 36.5 86-87 30.602625 35.0 31.0 35.0 17.5 36.0 88-89 30.497500000000002 35.0 31.0 35.0 18.0 36.0 90-91 30.29875 35.0 31.0 35.0 14.0 36.0 92-93 29.74525 34.0 30.0 35.0 8.5 35.5 94-95 29.6845 34.0 30.0 35.0 4.5 35.0 96-97 29.397125 34.0 30.0 35.0 2.0 35.0 98-99 29.149625 34.0 30.0 35.0 2.0 35.0 100-101 28.213875 33.5 28.5 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 3.0 4 5.0 5 4.0 6 3.0 7 6.0 8 6.0 9 7.0 10 5.0 11 9.0 12 15.0 13 7.0 14 10.0 15 17.0 16 11.0 17 10.0 18 11.0 19 15.0 20 19.0 21 20.0 22 15.0 23 26.0 24 32.0 25 33.0 26 26.0 27 46.0 28 44.0 29 57.0 30 87.0 31 110.0 32 117.0 33 183.0 34 217.0 35 369.0 36 490.0 37 812.0 38 951.0 39 188.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.81190595297649 14.607303651825912 13.081540770385192 48.49924962481241 2 22.980745186296573 22.080520130032507 34.78369592398099 20.155038759689923 3 22.3 27.675 24.675 25.35 4 25.63140785196299 30.15753938484621 19.004751187796952 25.206301575393848 5 26.538269134567283 33.79189594797399 20.485242621310658 19.18459229614807 6 19.575 36.625 23.525 20.275000000000002 7 17.849999999999998 16.2 40.050000000000004 25.900000000000002 8 19.225 21.25 27.975 31.55 9 20.7 21.0 31.775 26.525 10-11 24.6875 28.9375 21.2 25.174999999999997 12-13 22.4375 24.3 27.437499999999996 25.825 14-15 23.1375 25.45 27.125 24.2875 16-17 24.762500000000003 25.5125 25.174999999999997 24.55 18-19 23.790473809226153 26.64083010376297 25.415676959619955 24.153019127390923 20-21 23.45 25.5625 26.4625 24.525 22-23 23.1 26.325 25.6125 24.962500000000002 24-25 24.0625 26.887499999999996 24.725 24.325 26-27 23.825 26.474999999999998 25.2 24.5 28-29 24.3125 25.7875 25.35 24.55 30-31 25.0375 26.25 24.8 23.9125 32-33 23.599999999999998 26.1 26.0625 24.2375 34-35 24.125 25.2625 26.400000000000002 24.212500000000002 36-37 23.3875 25.650000000000002 26.4125 24.55 38-39 23.525 26.55 25.674999999999997 24.25 40-41 22.175 25.724999999999998 27.1 25.0 42-43 23.9 26.387500000000003 25.7875 23.925 44-45 24.1375 25.912499999999998 26.087500000000002 23.8625 46-47 23.45 25.687500000000004 26.187500000000004 24.675 48-49 24.15 26.0625 25.412499999999998 24.375 50-51 23.9875 25.924999999999997 25.874999999999996 24.212500000000002 52-53 23.875 26.700000000000003 25.0 24.425 54-55 24.8 26.25 25.575 23.375 56-57 23.3125 25.974999999999998 26.05 24.6625 58-59 24.253031628953618 25.90323790473809 25.778222277784725 24.065508188523566 60-61 23.1625 26.85 25.8625 24.125 62-63 23.93730407523511 26.20689655172414 25.830721003134798 24.025078369905955 64-65 23.82149591451917 25.380263984915146 26.561910747957256 24.236329352608422 66-67 23.33710549478184 26.19137432415441 26.845215641896143 23.62630453916761 68-69 23.48570708978718 26.042060193930233 25.99168870419343 24.480544012089158 70-71 23.66574793284891 25.88323728388875 25.645201703833624 24.805813079428717 72-73 23.23661830915458 26.17558779389695 25.48774387193597 25.100050025012504 74-75 23.80297537192149 26.415801975246904 26.02825353169146 23.75296912114014 76-77 23.82802707445475 26.309852093256453 25.858611180747054 24.00350965154174 78-79 23.208663896234732 26.709482432942956 25.739831255509383 24.342022415312933 80-81 24.37697659709045 25.54079696394687 26.35041113219481 23.731815306767867 82-83 24.31645569620253 26.253164556962027 25.78481012658228 23.645569620253166 84-85 23.52643561851758 26.068808499873512 26.38502403238047 24.019731849228435 86-87 24.087406846027537 26.019957054439814 26.095743337122645 23.796892762410003 88-89 23.825164224355735 26.035876705406768 25.70742799393633 24.431531076301162 90-91 24.171934260429836 25.81542351453856 26.194690265486724 23.81795195954488 92-93 23.338368580060422 26.62386706948641 26.095166163141993 23.94259818731118 94-95 24.5171808377226 25.64584900928016 26.197642337597195 23.639327815400048 96-97 24.246215438508695 26.285499812335793 25.922682347053673 23.54560240210184 98-99 24.4375 26.7125 25.5125 23.3375 100-101 24.712500000000002 25.224999999999998 26.1 23.962500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 2.0 16 3.0 17 3.0 18 3.5 19 5.5 20 6.5 21 6.0 22 9.5 23 13.0 24 16.0 25 15.0 26 17.5 27 26.0 28 27.5 29 28.5 30 37.0 31 41.5 32 50.5 33 64.0 34 76.5 35 82.5 36 77.0 37 98.0 38 110.5 39 118.5 40 128.0 41 136.0 42 147.5 43 146.5 44 144.5 45 139.0 46 146.5 47 150.5 48 143.0 49 127.0 50 111.0 51 109.5 52 108.5 53 91.5 54 85.0 55 82.0 56 67.5 57 61.5 58 57.0 59 59.5 60 67.5 61 62.0 62 62.5 63 61.5 64 50.0 65 46.5 66 49.0 67 57.0 68 53.5 69 42.0 70 34.0 71 36.5 72 37.0 73 29.0 74 29.0 75 24.0 76 16.5 77 14.0 78 13.0 79 11.5 80 5.5 81 4.0 82 5.5 83 3.5 84 1.0 85 1.0 86 1.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.025 3 0.0 4 0.025 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0125 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0125 60-61 0.0 62-63 0.3125 64-65 0.5625 66-67 0.5875 68-69 0.7374999999999999 70-71 0.22499999999999998 72-73 0.05 74-75 0.0125 76-77 0.27499999999999997 78-79 0.7374999999999999 80-81 1.1875 82-83 1.25 84-85 1.175 86-87 1.0375 88-89 1.05 90-91 1.125 92-93 0.7000000000000001 94-95 0.325 96-97 0.08750000000000001 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.0875 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra Read 356775 spots for SRR1979263.sra Written 356775 spots for SRR1979263.sra Read 356767 spots for SRR1979263.sra Written 356767 spots for SRR1979263.sra SRR ids: ['SRR1979263.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8v63onyp SRR1979263.sra spots: 7135348 blocks: [[1, 356767], [356768, 713534], [713535, 1070301], [1070302, 1427068], [1427069, 1783835], [1783836, 2140602], [2140603, 2497369], [2497370, 2854136], [2854137, 3210903], [3210904, 3567670], [3567671, 3924437], [3924438, 4281204], [4281205, 4637971], [4637972, 4994738], [4994739, 5351505], [5351506, 5708272], [5708273, 6065039], [6065040, 6421806], [6421807, 6778573], [6778574, 7135348]] SRR1979263 file size 1946446 SRR1979263 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1979263 SRR1979263_1.fastq SRR1979263_2.fastq Input file: SRR1979263_1.fastq Paired file: SRR1979263_2.fastq trimmed: SRR1979263-trimmed-pair1.fastq, SRR1979263-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:53:19 2024 >> started Sat Dec 7 11:53:26 2024 >> done (6.507s) 7135348 read pairs processed; of these: 25925 ( 0.36%) short read pairs filtered out after trimming by size control 30807 ( 0.43%) empty read pairs filtered out after trimming by size control 7078616 (99.20%) read pairs available; of these: 1533677 (21.67%) trimmed read pairs available after processing 5544939 (78.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 40 0.00% 19 59 0.00% 20 75 0.00% 21 110 0.00% 22 134 0.00% 23 223 0.00% 24 265 0.00% 25 325 0.00% 26 407 0.01% 27 542 0.01% 28 651 0.01% 29 752 0.01% 30 814 0.01% 31 975 0.01% 32 1031 0.01% 33 1251 0.02% 34 1390 0.02% 35 1410 0.02% 36 1549 0.02% 37 1662 0.02% 38 1838 0.03% 39 1931 0.03% 40 1971 0.03% 41 2131 0.03% 42 2197 0.03% 43 2351 0.03% 44 2361 0.03% 45 2540 0.04% 46 2756 0.04% 47 2745 0.04% 48 2840 0.04% 49 3014 0.04% 50 3169 0.04% 51 3465 0.05% 52 3545 0.05% 53 3798 0.05% 54 3932 0.06% 55 4165 0.06% 56 4451 0.06% 57 4820 0.07% 58 5094 0.07% 59 5918 0.08% 60 7426 0.10% 61 7803 0.11% 62 8733 0.12% 63 9253 0.13% 64 9843 0.14% 65 10552 0.15% 66 11061 0.16% 67 11619 0.16% 68 12599 0.18% 69 13445 0.19% 70 14287 0.20% 71 15028 0.21% 72 15324 0.22% 73 16279 0.23% 74 16885 0.24% 75 17917 0.25% 76 16955 0.24% 77 19079 0.27% 78 20094 0.28% 79 20464 0.29% 80 20786 0.29% 81 20895 0.30% 82 20831 0.29% 83 21488 0.30% 84 21715 0.31% 85 21953 0.31% 86 23629 0.33% 87 26253 0.37% 88 28738 0.41% 89 32195 0.45% 90 33340 0.47% 91 35418 0.50% 92 39122 0.55% 93 43831 0.62% 94 50447 0.71% 95 59236 0.84% 96 70711 1.00% 97 91817 1.30% 98 123049 1.74% 99 166082 2.35% 100 222798 3.15% 101 5544939 78.33% 7078616 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=28 prefix-density=0.08 prefix-fanout=2.6 sequence=AAGATCCAGGACAAGGAGGGCAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=341.95 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=25.0 sequence=CGCCGCCGCCGA criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=25 prefix-density=0.08 prefix-fanout=2.6 sequence=AAGATCCAGGACAAGGAGGGCAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=323.77 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=24.9 sequence=CGCCGCCGCCGA SRR1979263 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:54:12 Started mapping on | Dec 07 11:54:12 Finished on | Dec 07 11:57:51 Mapping speed, Million of reads per hour | 116.36 Number of input reads | 7078616 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 5102338 Uniquely mapped reads % | 72.08% Average mapped length | 195.08 Number of splices: Total | 3074428 Number of splices: Annotated (sjdb) | 2920175 Number of splices: GT/AG | 3034622 Number of splices: GC/AG | 35378 Number of splices: AT/AC | 1957 Number of splices: Non-canonical | 2471 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.48 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 46339 % of reads mapped to multiple loci | 0.65% Number of reads mapped to too many loci | 3015 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 26.92% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1938382 1938382 1938382 N_multimapping 46339 46339 46339 N_noFeature 165180 2587602 2591929 N_ambiguous 99480 5993 6160 UnstrandedReadsAssigned:4837678 PositiveStrandReadsAssigned:2508743 NegativeStrandReadsAssigned:2504249 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR1979263 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR1979263-trimmed-pair1.fastq SRR1979263-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,078,616 reads, 4,991,276 reads pseudoaligned [quant] estimated average fragment length: 208.241 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52973 SRR1979263.ke.tsv 35125 SRR1979263.se.tsv 88098 total ==> SRR1979263.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 729.069 0 0 PNS24247 1044 836.759 32.5129 11.8179 PNS24249 1928 1720.76 85.728 15.1527 PNS24246 1044 836.759 32.5129 11.8179 PNS24248 1044 836.759 32.5129 11.8179 PNS24244 1471 1263.76 53.7334 12.932 PNS24243 293 88.5282 13 44.663 KQK14069 1603 1395.76 226.379 49.3301 KQK14071 474 268.801 8.47218 9.58631 ==> SRR1979263.se.tsv <== BRADI_1g14170v3 249 BRADI_1g53295v3 23 BRADI_1g59795v3 39 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 81 BRADI_1g74790v3 53 BRADI_1g09890v3 0 BRADI_1g77505v3 34 BRADI_1g48960v3 0 SRR1979263 completed mapping pipeline successfully