Starting /dee2/code/volunteer_pipeline.sh SRR21853409 current disk space = 1550674624512 free memory = 1599838132 SRR21853409 SRAfilesize 2fafe2f04ea6b3c7c85fee8722312e52 SRR21853409.sra SRR21853409.sra file validated SRR21853409 is single end SRR21853409 is conventional basespace SRR21853409 read1 length is 96-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853409_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 96-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.4145 37.0 37.0 37.0 37.0 37.0 2 35.7355 37.0 37.0 37.0 37.0 37.0 3 35.9105 37.0 37.0 37.0 37.0 37.0 4 35.857 37.0 37.0 37.0 37.0 37.0 5 35.925 37.0 37.0 37.0 37.0 37.0 6 35.986 37.0 37.0 37.0 37.0 37.0 7 35.9095 37.0 37.0 37.0 37.0 37.0 8 35.9435 37.0 37.0 37.0 37.0 37.0 9 35.8865 37.0 37.0 37.0 37.0 37.0 10-11 36.03175 37.0 37.0 37.0 37.0 37.0 12-13 36.02575 37.0 37.0 37.0 37.0 37.0 14-15 35.8835 37.0 37.0 37.0 37.0 37.0 16-17 35.98075 37.0 37.0 37.0 37.0 37.0 18-19 35.97825 37.0 37.0 37.0 37.0 37.0 20-21 35.83075 37.0 37.0 37.0 37.0 37.0 22-23 35.883250000000004 37.0 37.0 37.0 37.0 37.0 24-25 35.86225 37.0 37.0 37.0 37.0 37.0 26-27 35.679 37.0 37.0 37.0 37.0 37.0 28-29 35.7315 37.0 37.0 37.0 37.0 37.0 30-31 35.609750000000005 37.0 37.0 37.0 37.0 37.0 32-33 35.6035 37.0 37.0 37.0 37.0 37.0 34-35 35.660250000000005 37.0 37.0 37.0 37.0 37.0 36-37 35.73075 37.0 37.0 37.0 37.0 37.0 38-39 35.77275 37.0 37.0 37.0 37.0 37.0 40-41 35.716499999999996 37.0 37.0 37.0 37.0 37.0 42-43 35.758 37.0 37.0 37.0 37.0 37.0 44-45 35.659 37.0 37.0 37.0 37.0 37.0 46-47 35.70625 37.0 37.0 37.0 37.0 37.0 48-49 35.61275 37.0 37.0 37.0 37.0 37.0 50-51 35.609750000000005 37.0 37.0 37.0 37.0 37.0 52-53 35.5095 37.0 37.0 37.0 37.0 37.0 54-55 35.6805 37.0 37.0 37.0 37.0 37.0 56-57 35.495 37.0 37.0 37.0 37.0 37.0 58-59 35.570750000000004 37.0 37.0 37.0 37.0 37.0 60-61 35.61275 37.0 37.0 37.0 37.0 37.0 62-63 35.6835 37.0 37.0 37.0 37.0 37.0 64-65 35.67925 37.0 37.0 37.0 37.0 37.0 66-67 35.6415 37.0 37.0 37.0 37.0 37.0 68-69 35.59075 37.0 37.0 37.0 37.0 37.0 70-71 35.59925 37.0 37.0 37.0 37.0 37.0 72-73 35.699250000000006 37.0 37.0 37.0 37.0 37.0 74-75 35.48275 37.0 37.0 37.0 37.0 37.0 76-77 35.555499999999995 37.0 37.0 37.0 37.0 37.0 78-79 35.526250000000005 37.0 37.0 37.0 37.0 37.0 80-81 35.518 37.0 37.0 37.0 37.0 37.0 82-83 35.52375 37.0 37.0 37.0 37.0 37.0 84-85 35.592 37.0 37.0 37.0 37.0 37.0 86-87 35.55325 37.0 37.0 37.0 37.0 37.0 88-89 35.483000000000004 37.0 37.0 37.0 37.0 37.0 90-91 35.513000000000005 37.0 37.0 37.0 37.0 37.0 92-93 35.525 37.0 37.0 37.0 37.0 37.0 94-95 35.54375 37.0 37.0 37.0 37.0 37.0 96-97 35.35650388082123 37.0 37.0 37.0 37.0 37.0 98-99 35.512637568633686 37.0 37.0 37.0 37.0 37.0 100-101 35.254682280523966 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 1.0 24 3.0 25 9.0 26 10.0 27 22.0 28 29.0 29 50.0 30 78.0 31 93.0 32 111.0 33 167.0 34 242.0 35 469.0 36 2084.0 37 628.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.549999999999997 12.45 18.825 40.175 2 24.575 19.7 30.675 25.05 3 26.474999999999998 23.65 24.075 25.8 4 26.125 28.775000000000002 20.599999999999998 24.5 5 28.249999999999996 29.4 21.6 20.75 6 21.925 33.2 20.974999999999998 23.9 7 19.85 16.925 38.65 24.575 8 22.55 20.65 25.900000000000002 30.9 9 24.125 20.349999999999998 27.825 27.700000000000003 10-11 26.025 27.962500000000002 20.625 25.387500000000003 12-13 23.925 21.6625 26.875 27.537499999999998 14-15 24.4375 23.7375 26.35 25.474999999999998 16-17 24.0625 24.2625 25.275 26.400000000000002 18-19 24.85 24.7875 24.0625 26.3 20-21 24.525 25.0125 23.974999999999998 26.487500000000004 22-23 24.6875 24.375 24.337500000000002 26.6 24-25 24.637500000000003 26.337500000000002 23.5625 25.4625 26-27 24.212500000000002 25.2375 23.8625 26.687499999999996 28-29 24.825 24.6875 24.1375 26.35 30-31 24.75 25.025 23.8625 26.3625 32-33 24.2 24.4 24.587500000000002 26.8125 34-35 25.650000000000002 23.95 24.5 25.900000000000002 36-37 24.2 24.1125 25.35 26.337500000000002 38-39 25.9875 24.725 23.5375 25.75 40-41 24.762500000000003 25.3 24.087500000000002 25.85 42-43 26.0625 24.349999999999998 24.4875 25.1 44-45 24.6 24.025 25.0625 26.3125 46-47 25.05 24.275 24.4 26.275 48-49 25.2875 24.125 24.425 26.1625 50-51 24.1375 25.0 24.224999999999998 26.637499999999996 52-53 25.124999999999996 24.4375 24.462500000000002 25.974999999999998 54-55 25.7625 24.9375 23.875 25.424999999999997 56-57 24.474999999999998 23.6125 24.9875 26.924999999999997 58-59 25.224999999999998 24.3125 23.724999999999998 26.737499999999997 60-61 25.3 24.2875 24.3875 26.025 62-63 25.3 24.775 23.7625 26.1625 64-65 24.775 24.0375 24.75 26.437500000000004 66-67 24.725 23.7125 25.2625 26.3 68-69 24.625 24.9375 23.9875 26.450000000000003 70-71 26.087500000000002 24.212500000000002 24.2 25.5 72-73 24.175 24.9875 24.3625 26.474999999999998 74-75 25.4 24.3875 23.4375 26.775 76-77 25.2 25.1 23.8375 25.8625 78-79 24.875 24.925 23.7125 26.487500000000004 80-81 24.85 24.625 24.5625 25.9625 82-83 24.5125 23.8125 24.5625 27.1125 84-85 25.575 24.349999999999998 24.1375 25.937500000000004 86-87 24.212500000000002 24.25 24.5125 27.025 88-89 25.85 24.0375 24.65 25.4625 90-91 25.575 24.8125 24.4875 25.124999999999996 92-93 26.325 23.5 23.575 26.6 94-95 25.2375 24.375 24.099999999999998 26.2875 96-97 24.943707780835627 24.418313735301474 24.580935701776333 26.057042782086565 98-99 25.802766848584845 23.175529889579895 24.86356136565554 26.15814189617972 100-101 25.356750823271128 10.835816214520936 30.453191155715853 33.35424180649208 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 1.0 3 1.5 4 1.0 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 2.0 25 2.5 26 2.0 27 3.5 28 7.0 29 10.5 30 13.5 31 13.5 32 15.0 33 18.5 34 25.5 35 41.0 36 50.5 37 60.0 38 70.0 39 88.0 40 113.0 41 131.0 42 138.0 43 149.0 44 169.0 45 177.5 46 178.5 47 172.0 48 156.0 49 152.0 50 152.5 51 132.5 52 115.5 53 107.5 54 93.0 55 93.5 56 96.5 57 92.5 58 91.5 59 77.5 60 69.5 61 74.0 62 68.0 63 59.5 64 60.0 65 65.5 66 67.5 67 64.0 68 64.0 69 59.0 70 51.0 71 45.0 72 39.0 73 40.0 74 35.5 75 22.0 76 22.0 77 25.5 78 19.0 79 13.5 80 8.0 81 3.0 82 2.5 83 2.0 84 1.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 96 6.0 97 17.0 98 75.0 99 264.0 100 899.0 101 2739.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.20955483170466 84.925 2 7.057546145494029 13.0 3 0.6786102062975028 1.875 4 0.05428881650380022 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381889 spots for SRR21853409.sra Written 381889 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra Read 381883 spots for SRR21853409.sra Written 381883 spots for SRR21853409.sra SRR ids: ['SRR21853409.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e1737gwd SRR21853409.sra spots: 7637666 blocks: [[1, 381883], [381884, 763766], [763767, 1145649], [1145650, 1527532], [1527533, 1909415], [1909416, 2291298], [2291299, 2673181], [2673182, 3055064], [3055065, 3436947], [3436948, 3818830], [3818831, 4200713], [4200714, 4582596], [4582597, 4964479], [4964480, 5346362], [5346363, 5728245], [5728246, 6110128], [6110129, 6492011], [6492012, 6873894], [6873895, 7255777], [7255778, 7637666]] SRR21853409 file size 2053529 SRR21853409 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853409 SRR21853409_1.fastq Input file: SRR21853409_1.fastq trimmed: SRR21853409-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:04:55 2024 >> started Fri Dec 6 14:05:00 2024 >> done (5.492s) 7637666 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 5684 ( 0.07%) empty reads filtered out after trimming by size control 7631979 (99.93%) reads available; of these: 282 ( 0.00%) trimmed reads available after processing 7631697 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 0 0.00% 27 1 0.00% 28 0 0.00% 29 1 0.00% 30 1 0.00% 31 7 0.00% 32 4 0.00% 33 7 0.00% 34 4 0.00% 35 14 0.00% 36 11 0.00% 37 7 0.00% 38 12 0.00% 39 6 0.00% 40 13 0.00% 41 9 0.00% 42 19 0.00% 43 14 0.00% 44 12 0.00% 45 15 0.00% 46 13 0.00% 47 13 0.00% 48 19 0.00% 49 17 0.00% 50 15 0.00% 51 16 0.00% 52 21 0.00% 53 18 0.00% 54 19 0.00% 55 16 0.00% 56 18 0.00% 57 23 0.00% 58 19 0.00% 59 21 0.00% 60 17 0.00% 61 25 0.00% 62 30 0.00% 63 21 0.00% 64 17 0.00% 65 31 0.00% 66 16 0.00% 67 14 0.00% 68 17 0.00% 69 23 0.00% 70 26 0.00% 71 27 0.00% 72 26 0.00% 73 23 0.00% 74 24 0.00% 75 33 0.00% 76 19 0.00% 77 35 0.00% 78 28 0.00% 79 37 0.00% 80 30 0.00% 81 35 0.00% 82 34 0.00% 83 46 0.00% 84 39 0.00% 85 46 0.00% 86 37 0.00% 87 63 0.00% 88 55 0.00% 89 77 0.00% 90 100 0.00% 91 302 0.00% 92 93 0.00% 93 134 0.00% 94 445 0.01% 95 1823 0.02% 96 10411 0.14% 97 36100 0.47% 98 140010 1.83% 99 509265 6.67% 100 1733437 22.71% 101 5198500 68.11% 7631979 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=200.50 fanout-score-rank=12 prefix-density=0.86 prefix-fanout=24.3 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=352.52 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=24.3 sequence=CGCCGCCGCCGG Started job on | Dec 06 14:05:19 Started mapping on | Dec 06 14:05:19 Finished on | Dec 06 14:05:37 Mapping speed, Million of reads per hour | 1526.40 Number of input reads | 7631979 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 6941026 Uniquely mapped reads % | 90.95% Average mapped length | 100.26 Number of splices: Total | 2342987 Number of splices: Annotated (sjdb) | 2213820 Number of splices: GT/AG | 2311609 Number of splices: GC/AG | 26106 Number of splices: AT/AC | 1422 Number of splices: Non-canonical | 3850 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 2.26 Insertion rate per base | 0.01% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 214970 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 185124 % of reads mapped to too many loci | 2.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.47% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 475983 475983 475983 N_multimapping 214970 214970 214970 N_noFeature 313385 3652109 3507943 N_ambiguous 107427 6631 7356 UnstrandedReadsAssigned:6520214 PositiveStrandReadsAssigned:3282286 NegativeStrandReadsAssigned:3425727 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853409 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853409-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,631,979 reads, 6,721,462 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,027 rounds 52973 SRR21853409.ke.tsv 35125 SRR21853409.se.tsv 88098 total ==> SRR21853409.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 30.4943 8.29077 PNS24249 1928 1829 113.676 15.9684 PNS24246 1044 945 30.4943 8.29077 PNS24248 1044 945 30.4943 8.29077 PNS24244 1471 1372 10.8413 2.03018 PNS24243 293 194 6 7.94616 KQK14069 1603 1504 2741.85 468.385 KQK14071 474 375 303.537 207.964 ==> SRR21853409.se.tsv <== BRADI_1g14170v3 3350 BRADI_1g53295v3 43 BRADI_1g59795v3 190 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 103 BRADI_1g74790v3 71 BRADI_1g09890v3 0 BRADI_1g77505v3 119 BRADI_1g48960v3 0 SRR21853409 completed mapping pipeline successfully