Starting /dee2/code/volunteer_pipeline.sh SRR21853410 current disk space = 1550675460096 free memory = 1598039220 SRR21853410 SRAfilesize d8bcc8e357830f8bbb749641224f5cc7 SRR21853410.sra SRR21853410.sra file validated SRR21853410 is single end SRR21853410 is conventional basespace SRR21853410 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853410_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.13825 37.0 37.0 37.0 25.0 37.0 2 34.84875 37.0 37.0 37.0 25.0 37.0 3 35.35675 37.0 37.0 37.0 37.0 37.0 4 35.56975 37.0 37.0 37.0 37.0 37.0 5 35.70775 37.0 37.0 37.0 37.0 37.0 6 35.63625 37.0 37.0 37.0 37.0 37.0 7 35.57725 37.0 37.0 37.0 37.0 37.0 8 35.77375 37.0 37.0 37.0 37.0 37.0 9 35.65525 37.0 37.0 37.0 37.0 37.0 10-11 35.66075 37.0 37.0 37.0 37.0 37.0 12-13 35.64025 37.0 37.0 37.0 37.0 37.0 14-15 35.65675 37.0 37.0 37.0 37.0 37.0 16-17 35.67475 37.0 37.0 37.0 37.0 37.0 18-19 35.693 37.0 37.0 37.0 37.0 37.0 20-21 35.6445 37.0 37.0 37.0 37.0 37.0 22-23 35.588750000000005 37.0 37.0 37.0 37.0 37.0 24-25 35.643 37.0 37.0 37.0 37.0 37.0 26-27 35.40025 37.0 37.0 37.0 37.0 37.0 28-29 35.532 37.0 37.0 37.0 37.0 37.0 30-31 35.27575 37.0 37.0 37.0 37.0 37.0 32-33 35.509249999999994 37.0 37.0 37.0 37.0 37.0 34-35 35.48725 37.0 37.0 37.0 37.0 37.0 36-37 35.41885471367842 37.0 37.0 37.0 37.0 37.0 38-39 35.356589147286826 37.0 37.0 37.0 31.0 37.0 40-41 35.25031257814454 37.0 37.0 37.0 31.0 37.0 42-43 35.430654624636645 37.0 37.0 37.0 37.0 37.0 44-45 35.36568284142071 37.0 37.0 37.0 37.0 37.0 46-47 35.26263131565783 37.0 37.0 37.0 31.0 37.0 48-49 35.32116058029014 37.0 37.0 37.0 37.0 37.0 50-51 35.30665332666334 37.0 37.0 37.0 31.0 37.0 52-53 35.329914957478735 37.0 37.0 37.0 37.0 37.0 54-55 35.239119559779894 37.0 37.0 37.0 37.0 37.0 56-57 35.29089544772386 37.0 37.0 37.0 31.0 37.0 58-59 35.24112056028014 37.0 37.0 37.0 31.0 37.0 60-61 35.25912956478239 37.0 37.0 37.0 31.0 37.0 62-63 35.25637818909455 37.0 37.0 37.0 31.0 37.0 64-65 35.13806903451726 37.0 37.0 37.0 25.0 37.0 66-67 35.27588794397199 37.0 37.0 37.0 31.0 37.0 68-69 35.1855927963982 37.0 37.0 37.0 25.0 37.0 70-71 35.12006003001501 37.0 37.0 37.0 25.0 37.0 72-73 35.152576288144076 37.0 37.0 37.0 25.0 37.0 74-75 35.096548274137064 37.0 37.0 37.0 25.0 37.0 76-77 35.17908954477239 37.0 37.0 37.0 31.0 37.0 78-79 35.18934467233617 37.0 37.0 37.0 25.0 37.0 80-81 35.156578289144576 37.0 37.0 37.0 31.0 37.0 82-83 35.055777888944476 37.0 37.0 37.0 25.0 37.0 84-85 35.10830415207604 37.0 37.0 37.0 25.0 37.0 86-87 35.17583791895947 37.0 37.0 37.0 31.0 37.0 88-89 35.15032516258129 37.0 37.0 37.0 25.0 37.0 90-91 35.08354177088545 37.0 37.0 37.0 25.0 37.0 92-93 34.99949962471854 37.0 37.0 37.0 25.0 37.0 94-95 35.03827870903177 37.0 37.0 37.0 25.0 37.0 96-97 35.01451733617857 37.0 37.0 37.0 25.0 37.0 98-99 35.003441554957575 37.0 37.0 37.0 25.0 37.0 100-101 35.00734552234309 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 1.0 23 2.0 24 13.0 25 18.0 26 19.0 27 29.0 28 51.0 29 63.0 30 70.0 31 129.0 32 162.0 33 207.0 34 281.0 35 518.0 36 2041.0 37 393.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.431607901975497 13.078269567391848 18.929732433108278 41.56039009752438 2 25.752592967366557 19.377687832026307 31.267391854287887 23.602327346319253 3 25.681420355088775 23.005751437859466 24.256064016004 27.056764191047762 4 26.581645411352838 27.28182045511378 20.43010752688172 25.70642660665166 5 27.70692673168292 29.507376844211052 21.680420105026258 21.10527631907977 6 21.955488872218055 32.75818954738685 20.280070017504375 25.006251562890725 7 20.40510127531883 17.104276069017253 38.63465866466617 23.85596399099775 8 23.330832708177045 21.955488872218055 23.80595148787197 30.90772693173293 9 21.230307576894223 22.005501375343837 28.507126781695426 28.257064266066518 10-11 24.756189047261813 26.969242310577645 21.080270067516878 27.19429857464366 12-13 23.755938984746187 22.755688922230558 25.93148287071768 27.556889222305575 14-15 23.25581395348837 24.918729682420604 25.543885971492873 26.281570392598148 16-17 24.618654663665918 24.90622655663916 24.093523380845213 26.38159539884971 18-19 24.093523380845213 24.343585896474117 25.831457864466117 25.731432858214554 20-21 24.60615153788447 25.10627656914228 23.88097024256064 26.406601650412604 22-23 24.90622655663916 25.256314078519633 24.256064016004 25.581395348837212 24-25 24.268567141785446 24.8062015503876 25.268817204301076 25.656414103525883 26-27 24.431107776944234 24.706176544136035 24.431107776944234 26.431607901975497 28-29 25.23130782695674 24.15603900975244 24.55613903475869 26.056514128532132 30-31 24.381095273818453 24.81870467616904 24.50612653163291 26.294073518379594 32-33 24.831207801950487 25.30632658164541 24.831207801950487 25.03125781445361 34-35 24.093523380845213 25.36884221055264 24.256064016004 26.281570392598148 36-37 25.09377344336084 24.518629657414355 24.268567141785446 26.11902975743936 38-39 24.431107776944234 25.03125781445361 24.568642160540136 25.968992248062015 40-41 25.30632658164541 24.956239059764943 23.905976494123532 25.831457864466117 42-43 24.721770663999 23.558834562961113 24.221583093660122 27.49781167937977 44-45 25.03751875937969 25.07503751875938 24.16208104052026 25.72536268134067 46-47 24.61230615307654 24.83741870935468 24.54977488744372 26.000500250125064 48-49 24.54977488744372 24.137068534267133 25.162581290645324 26.150575287643825 50-51 25.125062531265634 24.662331165582792 23.74937468734367 26.463231615807903 52-53 24.824912456228116 24.112056028014006 24.437218609304654 26.625812906453227 54-55 25.325162581290645 24.437218609304654 24.387193596798397 25.850425212606304 56-57 24.6248124062031 25.52526263131566 24.037018509254626 25.812906453226613 58-59 25.200100050025014 24.487243621810904 24.299649824912457 26.013006503251624 60-61 25.6128064032016 24.69984992496248 24.23711855927964 25.45022511255628 62-63 24.862431215607803 25.15007503751876 24.499749874937468 25.48774387193597 64-65 25.287643821910955 24.324662331165584 25.025012506253123 25.362681340670335 66-67 24.6248124062031 24.58729364682341 24.19959979989995 26.588294147073537 68-69 25.6128064032016 24.474737368684345 24.23711855927964 25.67533766883442 70-71 25.512756378189096 25.025012506253123 23.149074537268636 26.313156578289142 72-73 24.77488744372186 24.88744372186093 24.874937468734366 25.46273136568284 74-75 24.88744372186093 24.287143571785894 24.337168584292147 26.488244122061033 76-77 24.72486243121561 24.499749874937468 24.449724862431214 26.32566283141571 78-79 24.049524762381193 24.274637318659327 25.07503751875938 26.600800400200097 80-81 26.413206603301653 24.73736868434217 23.649324662331164 25.200100050025014 82-83 25.200100050025014 24.337168584292147 24.23711855927964 26.225612806403202 84-85 24.974987493746873 23.774387193596798 25.07503751875938 26.17558779389695 86-87 26.17558779389695 24.137068534267133 23.54927463731866 26.138069034517258 88-89 25.46273136568284 24.012006003001503 24.474737368684345 26.050525262631314 90-91 25.087543771885944 24.77488744372186 23.874437218609305 26.263131565782892 92-93 26.144608456342254 25.494120590442833 23.992994746059544 24.36827620715537 94-95 25.356517388041034 23.83037277958469 24.455841881411057 26.35726795096322 96-97 25.391260798798047 25.20345561537499 24.439714536121198 24.96556904970577 98-99 25.952260030472317 23.628745556119856 24.13661757237176 26.282376841036058 100-101 25.805946791862283 11.267605633802818 30.125195618153366 32.80125195618153 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.5 3 0.5 4 0.0 5 0.0 6 1.0 7 1.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 1.5 14 1.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.0 22 1.5 23 2.0 24 0.5 25 1.5 26 3.5 27 2.5 28 4.0 29 5.5 30 7.5 31 15.0 32 18.0 33 23.0 34 30.0 35 37.5 36 44.5 37 54.0 38 68.5 39 77.5 40 97.0 41 118.5 42 141.5 43 168.5 44 188.0 45 187.0 46 182.5 47 183.0 48 172.5 49 151.5 50 132.5 51 131.5 52 128.0 53 121.5 54 115.0 55 98.0 56 92.0 57 84.0 58 68.5 59 67.5 60 70.0 61 68.5 62 62.0 63 69.0 64 76.5 65 72.0 66 62.0 67 61.0 68 64.5 69 62.5 70 51.5 71 43.0 72 45.0 73 38.0 74 29.0 75 24.0 76 22.0 77 14.0 78 8.0 79 8.0 80 4.0 81 2.5 82 3.5 83 1.5 84 1.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 1.175 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 1.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 1.0 92-93 0.0 94-95 1.0 96-97 28.0 98-99 325.0 100-101 3643.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.925 #Duplication Level Percentage of deduplicated Percentage of total 1 93.0589184826473 86.47500000000001 2 6.349206349206349 11.799999999999999 3 0.5380683346785041 1.5 4 0.026903416733925208 0.1 5 0.026903416733925208 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGATGAAGACCAGCGTGAAGCTCATCCACGCCAGGCTTCATGCTCAGGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734108 spots for SRR21853410.sra Written 734108 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra Read 734091 spots for SRR21853410.sra Written 734091 spots for SRR21853410.sra SRR ids: ['SRR21853410.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q_gt72ou SRR21853410.sra spots: 14681837 blocks: [[1, 734091], [734092, 1468182], [1468183, 2202273], [2202274, 2936364], [2936365, 3670455], [3670456, 4404546], [4404547, 5138637], [5138638, 5872728], [5872729, 6606819], [6606820, 7340910], [7340911, 8075001], [8075002, 8809092], [8809093, 9543183], [9543184, 10277274], [10277275, 11011365], [11011366, 11745456], [11745457, 12479547], [12479548, 13213638], [13213639, 13947729], [13947730, 14681837]] SRR21853410 file size 3952725 SRR21853410 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853410 SRR21853410_1.fastq Input file: SRR21853410_1.fastq trimmed: SRR21853410-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:05:19 2024 >> started Fri Dec 6 14:05:27 2024 >> done (7.226s) 14681837 reads processed; of these: 10 ( 0.00%) short reads filtered out after trimming by size control 18258 ( 0.12%) empty reads filtered out after trimming by size control 14663569 (99.88%) reads available; of these: 338 ( 0.00%) trimmed reads available after processing 14663231 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 5 0.00% 23 3 0.00% 24 3 0.00% 25 1 0.00% 26 3 0.00% 27 5 0.00% 28 6 0.00% 29 5 0.00% 30 5 0.00% 31 7 0.00% 32 7 0.00% 33 8 0.00% 34 4 0.00% 35 54 0.00% 36 58 0.00% 37 69 0.00% 38 63 0.00% 39 63 0.00% 40 62 0.00% 41 61 0.00% 42 68 0.00% 43 81 0.00% 44 61 0.00% 45 90 0.00% 46 63 0.00% 47 76 0.00% 48 74 0.00% 49 74 0.00% 50 76 0.00% 51 83 0.00% 52 91 0.00% 53 88 0.00% 54 93 0.00% 55 71 0.00% 56 78 0.00% 57 96 0.00% 58 79 0.00% 59 108 0.00% 60 100 0.00% 61 90 0.00% 62 103 0.00% 63 79 0.00% 64 107 0.00% 65 119 0.00% 66 89 0.00% 67 123 0.00% 68 103 0.00% 69 82 0.00% 70 110 0.00% 71 113 0.00% 72 111 0.00% 73 118 0.00% 74 118 0.00% 75 106 0.00% 76 124 0.00% 77 139 0.00% 78 129 0.00% 79 151 0.00% 80 139 0.00% 81 159 0.00% 82 134 0.00% 83 164 0.00% 84 154 0.00% 85 141 0.00% 86 166 0.00% 87 187 0.00% 88 204 0.00% 89 251 0.00% 90 290 0.00% 91 807 0.01% 92 297 0.00% 93 410 0.00% 94 936 0.01% 95 3645 0.02% 96 20041 0.14% 97 69026 0.47% 98 271116 1.85% 99 984776 6.72% 100 3340597 22.78% 101 9965772 67.96% 14663569 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=197.69 fanout-score-rank=11 prefix-density=0.82 prefix-fanout=23.8 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=339.35 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=23.8 sequence=CGCCGCCGCCGG Started job on | Dec 06 14:05:43 Started mapping on | Dec 06 14:05:43 Finished on | Dec 06 14:06:18 Mapping speed, Million of reads per hour | 1508.25 Number of input reads | 14663569 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 13316353 Uniquely mapped reads % | 90.81% Average mapped length | 100.22 Number of splices: Total | 4541149 Number of splices: Annotated (sjdb) | 4291166 Number of splices: GT/AG | 4480730 Number of splices: GC/AG | 49781 Number of splices: AT/AC | 2790 Number of splices: Non-canonical | 7848 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.01% Deletion average length | 2.26 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 417465 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 343919 % of reads mapped to too many loci | 2.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.65% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 929751 929751 929751 N_multimapping 417465 417465 417465 N_noFeature 599128 6978164 6757341 N_ambiguous 205526 12864 14420 UnstrandedReadsAssigned:12511699 PositiveStrandReadsAssigned:6325325 NegativeStrandReadsAssigned:6544592 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853410 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853410-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,663,569 reads, 12,887,940 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 SRR21853410.ke.tsv 35125 SRR21853410.se.tsv 88098 total ==> SRR21853410.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 8.065e-06 1.28437e-06 PNS24247 1044 945 79.3362 11.1905 PNS24249 1928 1829 148.381 10.8137 PNS24246 1044 945 79.3362 11.1905 PNS24248 1044 945 79.3362 11.1905 PNS24244 1471 1372 52.6109 5.11131 PNS24243 293 194 15 10.3063 KQK14069 1603 1504 4958.08 439.417 KQK14071 474 375 730.978 259.827 ==> SRR21853410.se.tsv <== BRADI_1g14170v3 6405 BRADI_1g53295v3 66 BRADI_1g59795v3 464 BRADI_1g07683v3 0 BRADI_1g00485v3 23 BRADI_1g20270v3 239 BRADI_1g74790v3 109 BRADI_1g09890v3 0 BRADI_1g77505v3 223 BRADI_1g48960v3 0 SRR21853410 completed mapping pipeline successfully