Starting /dee2/code/volunteer_pipeline.sh SRR21853411 current disk space = 1550677188608 free memory = 1598034508 SRR21853411 SRAfilesize 74a1e447abba2b0f6db26df76a07a70a SRR21853411.sra SRR21853411.sra file validated SRR21853411 is single end SRR21853411 is conventional basespace SRR21853411 read1 length is 54-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853411_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 54-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.557 37.0 37.0 37.0 37.0 37.0 2 35.7695 37.0 37.0 37.0 37.0 37.0 3 35.998 37.0 37.0 37.0 37.0 37.0 4 36.1005 37.0 37.0 37.0 37.0 37.0 5 36.0635 37.0 37.0 37.0 37.0 37.0 6 36.091 37.0 37.0 37.0 37.0 37.0 7 36.108 37.0 37.0 37.0 37.0 37.0 8 36.0935 37.0 37.0 37.0 37.0 37.0 9 36.208 37.0 37.0 37.0 37.0 37.0 10-11 36.167 37.0 37.0 37.0 37.0 37.0 12-13 36.12375 37.0 37.0 37.0 37.0 37.0 14-15 36.091499999999996 37.0 37.0 37.0 37.0 37.0 16-17 36.01675 37.0 37.0 37.0 37.0 37.0 18-19 36.057500000000005 37.0 37.0 37.0 37.0 37.0 20-21 35.985 37.0 37.0 37.0 37.0 37.0 22-23 36.088499999999996 37.0 37.0 37.0 37.0 37.0 24-25 35.95425 37.0 37.0 37.0 37.0 37.0 26-27 35.919250000000005 37.0 37.0 37.0 37.0 37.0 28-29 35.8775 37.0 37.0 37.0 37.0 37.0 30-31 35.8835 37.0 37.0 37.0 37.0 37.0 32-33 35.89175 37.0 37.0 37.0 37.0 37.0 34-35 35.89475 37.0 37.0 37.0 37.0 37.0 36-37 35.89675 37.0 37.0 37.0 37.0 37.0 38-39 35.908500000000004 37.0 37.0 37.0 37.0 37.0 40-41 35.950500000000005 37.0 37.0 37.0 37.0 37.0 42-43 35.879999999999995 37.0 37.0 37.0 37.0 37.0 44-45 35.8645 37.0 37.0 37.0 37.0 37.0 46-47 35.86 37.0 37.0 37.0 37.0 37.0 48-49 35.769000000000005 37.0 37.0 37.0 37.0 37.0 50-51 35.795500000000004 37.0 37.0 37.0 37.0 37.0 52-53 35.70675 37.0 37.0 37.0 37.0 37.0 54-55 35.809853088272064 37.0 37.0 37.0 37.0 37.0 56-57 35.81595398849713 37.0 37.0 37.0 37.0 37.0 58-59 35.696924231057764 37.0 37.0 37.0 37.0 37.0 60-61 35.77344336084021 37.0 37.0 37.0 37.0 37.0 62-63 35.837209302325576 37.0 37.0 37.0 37.0 37.0 64-65 35.73543385846462 37.0 37.0 37.0 37.0 37.0 66-67 35.784446111527885 37.0 37.0 37.0 37.0 37.0 68-69 35.791645822911455 37.0 37.0 37.0 37.0 37.0 70-71 35.81190595297649 37.0 37.0 37.0 37.0 37.0 72-73 35.72361180590295 37.0 37.0 37.0 37.0 37.0 74-75 35.69409704852426 37.0 37.0 37.0 37.0 37.0 76-77 35.815407703851925 37.0 37.0 37.0 37.0 37.0 78-79 35.731865932966485 37.0 37.0 37.0 37.0 37.0 80-81 35.79539769884943 37.0 37.0 37.0 37.0 37.0 82-83 35.67383691845923 37.0 37.0 37.0 37.0 37.0 84-85 35.77688844422211 37.0 37.0 37.0 37.0 37.0 86-87 35.72736368184092 37.0 37.0 37.0 37.0 37.0 88-89 35.56128064032016 37.0 37.0 37.0 37.0 37.0 90-91 35.57303651825913 37.0 37.0 37.0 37.0 37.0 92-93 35.6488988988989 37.0 37.0 37.0 37.0 37.0 94-95 35.632632632632635 37.0 37.0 37.0 37.0 37.0 96-97 35.56803146790631 37.0 37.0 37.0 37.0 37.0 98-99 35.54435857677181 37.0 37.0 37.0 37.0 37.0 100-101 35.51190998926515 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 4.0 26 13.0 27 7.0 28 26.0 29 40.0 30 63.0 31 77.0 32 100.0 33 137.0 34 245.0 35 461.0 36 2211.0 37 614.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.825 13.125 16.8 41.25 2 25.25 19.5 29.15 26.1 3 27.85 21.875 22.325 27.950000000000003 4 28.125 27.200000000000003 17.525 27.150000000000002 5 28.4 28.475 20.1 23.025000000000002 6 23.875 32.175 20.325 23.625 7 20.974999999999998 16.25 37.55 25.224999999999998 8 23.150000000000002 21.5 24.4 30.95 9 22.85 20.125 27.800000000000004 29.225 10-11 26.400000000000002 26.275 19.537499999999998 27.787499999999998 12-13 24.95 21.462500000000002 24.3 29.2875 14-15 25.2875 23.549999999999997 23.825 27.3375 16-17 26.3625 23.0875 23.4375 27.1125 18-19 24.6125 24.6875 23.625 27.075 20-21 25.45 24.2625 23.05 27.237499999999997 22-23 25.4875 23.4125 23.150000000000002 27.950000000000003 24-25 25.324999999999996 23.3125 23.974999999999998 27.3875 26-27 25.837500000000002 23.1 23.8625 27.200000000000003 28-29 26.075 22.9625 23.1625 27.800000000000004 30-31 25.025 24.175 23.5125 27.287499999999998 32-33 25.900000000000002 23.7375 23.150000000000002 27.212500000000002 34-35 25.575 23.6625 23.724999999999998 27.037499999999998 36-37 25.2875 23.325000000000003 23.5625 27.825 38-39 24.425 24.4125 23.25 27.9125 40-41 25.75 23.6875 22.5875 27.975 42-43 25.7875 24.2375 23.0875 26.887499999999996 44-45 24.825 23.6625 23.849999999999998 27.6625 46-47 25.95 23.674999999999997 23.4875 26.887499999999996 48-49 26.0 24.05 22.5 27.450000000000003 50-51 25.912499999999998 23.525 23.45 27.1125 52-53 25.525 23.0375 23.6875 27.750000000000004 54-55 26.22827853481685 22.365295661957745 23.415426928366045 27.990998874859358 56-57 26.156539134783696 23.030757689422355 23.905976494123532 26.906726681670417 58-59 25.98149537384346 23.718429607401852 22.843210802700675 27.45686421605401 60-61 26.144036009002253 22.793198299574893 23.63090772693173 27.431857964491122 62-63 26.744186046511626 23.50587646911728 22.58064516129032 27.169292323080768 64-65 26.731682920730183 23.40585146286572 22.818204551137786 27.04426106526632 66-67 25.543885971492873 24.093523380845213 22.80570142535634 27.556889222305575 68-69 26.638319159579787 23.19909954977489 23.17408704352176 26.988494247123562 70-71 26.475737868934466 23.1615807903952 23.261630815407706 27.101050525262632 72-73 27.063531765882942 22.948974487243625 23.299149574787396 26.688344172086044 74-75 26.713356678339167 22.98649324662331 22.898949474737368 27.40120060030015 76-77 26.21310655327664 23.736868434217108 22.461230615307652 27.5887943971986 78-79 26.013006503251624 23.499249624812407 23.186593296648326 27.301150575287643 80-81 26.413206603301653 23.574287143571787 23.424212106053027 26.588294147073537 82-83 27.62631315657829 22.898949474737368 22.14857428714357 27.326163081540773 84-85 27.388694347173587 24.074537268634316 22.486243121560783 26.050525262631314 86-87 26.550775387693847 23.936968484242122 22.67383691845923 26.8384192096048 88-89 26.738369184592298 23.56178089044522 22.71135567783892 26.988494247123562 90-91 26.488244122061033 23.074037018509255 22.911455727863935 27.52626313156578 92-93 26.8018018018018 22.61011011011011 23.135635635635634 27.45245245245245 94-95 27.014514514514516 23.21071071071071 22.74774774774775 27.027027027027028 96-97 26.649968691296184 22.892924232936757 23.731997495303695 26.725109580463368 98-99 27.184836534792012 22.719755756265105 23.13954967561379 26.955858033329093 100-101 27.164366373902133 10.131744040150565 28.528858218318696 34.175031367628605 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 2.0 27 2.5 28 5.0 29 6.5 30 5.5 31 8.0 32 11.0 33 11.5 34 13.0 35 22.0 36 36.5 37 48.0 38 50.5 39 67.5 40 94.0 41 115.0 42 125.0 43 131.0 44 143.0 45 156.5 46 152.0 47 147.0 48 151.5 49 139.5 50 131.0 51 128.0 52 116.5 53 116.5 54 121.5 55 111.0 56 105.0 57 101.5 58 86.5 59 88.0 60 86.0 61 76.5 62 74.5 63 72.5 64 82.0 65 75.5 66 79.5 67 89.0 68 77.5 69 80.0 70 84.0 71 70.0 72 62.5 73 51.5 74 41.0 75 35.0 76 30.0 77 26.5 78 19.0 79 16.5 80 8.5 81 5.0 82 7.0 83 3.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 2.0 92 0.0 93 0.0 94 0.0 95 1.0 96 5.0 97 17.0 98 85.0 99 266.0 100 868.0 101 2754.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.225 #Duplication Level Percentage of deduplicated Percentage of total 1 92.24722146923285 85.075 2 7.1564109514773655 13.200000000000001 3 0.5150447275684468 1.425 4 0.0813228517213337 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351637 spots for SRR21853411.sra Written 351637 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra Read 351631 spots for SRR21853411.sra Written 351631 spots for SRR21853411.sra SRR ids: ['SRR21853411.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m5weoial SRR21853411.sra spots: 7032626 blocks: [[1, 351631], [351632, 703262], [703263, 1054893], [1054894, 1406524], [1406525, 1758155], [1758156, 2109786], [2109787, 2461417], [2461418, 2813048], [2813049, 3164679], [3164680, 3516310], [3516311, 3867941], [3867942, 4219572], [4219573, 4571203], [4571204, 4922834], [4922835, 5274465], [5274466, 5626096], [5626097, 5977727], [5977728, 6329358], [6329359, 6680989], [6680990, 7032626]] SRR21853411 file size 1890961 SRR21853411 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853411 SRR21853411_1.fastq Input file: SRR21853411_1.fastq trimmed: SRR21853411-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:05:19 2024 >> started Fri Dec 6 14:05:23 2024 >> done (3.456s) 7032626 reads processed; of these: 4 ( 0.00%) short reads filtered out after trimming by size control 11175 ( 0.16%) empty reads filtered out after trimming by size control 7021447 (99.84%) reads available; of these: 247 ( 0.00%) trimmed reads available after processing 7021200 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 4 0.00% 33 10 0.00% 34 2 0.00% 35 16 0.00% 36 8 0.00% 37 19 0.00% 38 11 0.00% 39 8 0.00% 40 14 0.00% 41 15 0.00% 42 17 0.00% 43 15 0.00% 44 17 0.00% 45 25 0.00% 46 19 0.00% 47 11 0.00% 48 16 0.00% 49 8 0.00% 50 20 0.00% 51 26 0.00% 52 18 0.00% 53 14 0.00% 54 20 0.00% 55 23 0.00% 56 27 0.00% 57 32 0.00% 58 29 0.00% 59 23 0.00% 60 28 0.00% 61 44 0.00% 62 37 0.00% 63 39 0.00% 64 34 0.00% 65 33 0.00% 66 38 0.00% 67 27 0.00% 68 30 0.00% 69 45 0.00% 70 45 0.00% 71 37 0.00% 72 34 0.00% 73 51 0.00% 74 36 0.00% 75 50 0.00% 76 43 0.00% 77 43 0.00% 78 64 0.00% 79 71 0.00% 80 46 0.00% 81 59 0.00% 82 76 0.00% 83 61 0.00% 84 80 0.00% 85 105 0.00% 86 92 0.00% 87 94 0.00% 88 108 0.00% 89 107 0.00% 90 129 0.00% 91 338 0.00% 92 135 0.00% 93 207 0.00% 94 520 0.01% 95 1755 0.02% 96 9398 0.13% 97 30394 0.43% 98 121542 1.73% 99 463480 6.60% 100 1510371 21.51% 101 4881051 69.52% 7021447 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.97 fanout-score-rank=31 prefix-density=0.19 prefix-fanout=3.0 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=361.39 fanout-score-rank=1 prefix-density=1.14 prefix-fanout=25.1 sequence=CGCCGCCGCCGG Started job on | Dec 06 14:05:39 Started mapping on | Dec 06 14:05:39 Finished on | Dec 06 14:05:51 Mapping speed, Million of reads per hour | 2106.43 Number of input reads | 7021447 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 6316524 Uniquely mapped reads % | 89.96% Average mapped length | 100.26 Number of splices: Total | 1938240 Number of splices: Annotated (sjdb) | 1825204 Number of splices: GT/AG | 1911949 Number of splices: GC/AG | 21395 Number of splices: AT/AC | 1127 Number of splices: Non-canonical | 3769 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 230663 % of reads mapped to multiple loci | 3.29% Number of reads mapped to too many loci | 250432 % of reads mapped to too many loci | 3.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 474260 474260 474260 N_multimapping 230663 230663 230663 N_noFeature 256866 3294594 3192880 N_ambiguous 97085 5534 6352 UnstrandedReadsAssigned:5962573 PositiveStrandReadsAssigned:3016396 NegativeStrandReadsAssigned:3117292 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853411 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853411-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,021,447 reads, 6,161,172 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,027 rounds 52973 SRR21853411.ke.tsv 35125 SRR21853411.se.tsv 88098 total ==> SRR21853411.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 11.9488 3.78924 PNS24247 1044 945 20.4167 5.73462 PNS24249 1928 1829 131.835 19.1323 PNS24246 1044 945 20.4167 5.73462 PNS24248 1044 945 20.4167 5.73462 PNS24244 1471 1372 8.96622 1.73463 PNS24243 293 194 5 6.841 KQK14069 1603 1504 2971.99 524.506 KQK14071 474 375 368.744 261.002 ==> SRR21853411.se.tsv <== BRADI_1g14170v3 3634 BRADI_1g53295v3 27 BRADI_1g59795v3 117 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 90 BRADI_1g74790v3 115 BRADI_1g09890v3 0 BRADI_1g77505v3 94 BRADI_1g48960v3 0 SRR21853411 completed mapping pipeline successfully