Starting /dee2/code/volunteer_pipeline.sh SRR21853412 current disk space = 1550659108864 free memory = 1357614332 SRR21853412 SRAfilesize 84ec893e35ac95a580f8961b26fd40d7 SRR21853412.sra SRR21853412.sra file validated SRR21853412 is single end SRR21853412 is conventional basespace SRR21853412 read1 length is 45-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853412_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 45-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.138 37.0 37.0 37.0 25.0 37.0 2 34.83725 37.0 37.0 37.0 25.0 37.0 3 35.51475 37.0 37.0 37.0 37.0 37.0 4 35.5555 37.0 37.0 37.0 37.0 37.0 5 35.992 37.0 37.0 37.0 37.0 37.0 6 35.734 37.0 37.0 37.0 37.0 37.0 7 35.5045 37.0 37.0 37.0 37.0 37.0 8 35.867 37.0 37.0 37.0 37.0 37.0 9 35.824 37.0 37.0 37.0 37.0 37.0 10-11 35.88475 37.0 37.0 37.0 37.0 37.0 12-13 35.82125 37.0 37.0 37.0 37.0 37.0 14-15 35.8485 37.0 37.0 37.0 37.0 37.0 16-17 35.747749999999996 37.0 37.0 37.0 37.0 37.0 18-19 35.81375 37.0 37.0 37.0 37.0 37.0 20-21 35.8935 37.0 37.0 37.0 37.0 37.0 22-23 35.69725 37.0 37.0 37.0 37.0 37.0 24-25 35.70225000000001 37.0 37.0 37.0 37.0 37.0 26-27 35.6015 37.0 37.0 37.0 37.0 37.0 28-29 35.581500000000005 37.0 37.0 37.0 37.0 37.0 30-31 35.568 37.0 37.0 37.0 37.0 37.0 32-33 35.54925 37.0 37.0 37.0 37.0 37.0 34-35 35.60625 37.0 37.0 37.0 37.0 37.0 36-37 35.554249999999996 37.0 37.0 37.0 37.0 37.0 38-39 35.45525 37.0 37.0 37.0 37.0 37.0 40-41 35.4345 37.0 37.0 37.0 37.0 37.0 42-43 35.49575 37.0 37.0 37.0 37.0 37.0 44-45 35.504000000000005 37.0 37.0 37.0 37.0 37.0 46-47 35.479619904976246 37.0 37.0 37.0 37.0 37.0 48-49 35.423855963991 37.0 37.0 37.0 37.0 37.0 50-51 35.40860215053763 37.0 37.0 37.0 37.0 37.0 52-53 35.49062265566391 37.0 37.0 37.0 37.0 37.0 54-55 35.486621655413856 37.0 37.0 37.0 37.0 37.0 56-57 35.48637159289822 37.0 37.0 37.0 37.0 37.0 58-59 35.50018182384515 37.0 37.0 37.0 37.0 37.0 60-61 35.35392696348174 37.0 37.0 37.0 37.0 37.0 62-63 35.417208604302154 37.0 37.0 37.0 37.0 37.0 64-65 35.42306730047535 37.0 37.0 37.0 37.0 37.0 66-67 35.37327995996998 37.0 37.0 37.0 37.0 37.0 68-69 35.36802601951464 37.0 37.0 37.0 37.0 37.0 70-71 35.256192144108084 37.0 37.0 37.0 31.0 37.0 72-73 35.33725293970478 37.0 37.0 37.0 31.0 37.0 74-75 35.24693520140105 37.0 37.0 37.0 31.0 37.0 76-77 35.248186139604705 37.0 37.0 37.0 25.0 37.0 78-79 35.34200650487866 37.0 37.0 37.0 37.0 37.0 80-81 35.29622216662497 37.0 37.0 37.0 31.0 37.0 82-83 35.383287465599196 37.0 37.0 37.0 37.0 37.0 84-85 35.17863397548162 37.0 37.0 37.0 25.0 37.0 86-87 35.316566566566564 37.0 37.0 37.0 37.0 37.0 88-89 35.27927927927928 37.0 37.0 37.0 31.0 37.0 90-91 35.259009009009006 37.0 37.0 37.0 31.0 37.0 92-93 35.1483983983984 37.0 37.0 37.0 25.0 37.0 94-95 35.21721721721722 37.0 37.0 37.0 31.0 37.0 96-97 35.27521177969581 37.0 37.0 37.0 31.0 37.0 98-99 35.33996228729533 37.0 37.0 37.0 37.0 37.0 100-101 35.221433425481145 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 2.0 25 9.0 26 11.0 27 27.0 28 29.0 29 61.0 30 85.0 31 117.0 32 123.0 33 182.0 34 297.0 35 578.0 36 2103.0 37 372.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.275 12.7 17.599999999999998 41.425 2 26.614332742466445 19.144087110660926 29.146619397315774 25.09496074955685 3 27.056764191047762 22.230557639409852 21.630407601900476 29.08227056764191 4 27.500000000000004 28.425 17.575 26.5 5 29.275000000000002 28.499999999999996 19.925 22.3 6 22.625 33.050000000000004 19.900000000000002 24.425 7 20.875 16.625 36.25 26.25 8 22.475 21.025 25.025 31.474999999999998 9 23.325000000000003 20.875 25.900000000000002 29.9 10-11 26.6 26.887499999999996 19.3125 27.200000000000003 12-13 24.1375 20.974999999999998 25.662499999999998 29.225 14-15 24.837500000000002 23.6125 24.1375 27.4125 16-17 25.974999999999998 23.2875 23.0875 27.650000000000002 18-19 25.6125 23.925 23.474999999999998 26.987499999999997 20-21 25.1875 23.6125 24.0375 27.1625 22-23 25.0 24.45 23.4625 27.0875 24-25 25.7 22.912499999999998 24.825 26.5625 26-27 24.925 24.85 23.7875 26.437500000000004 28-29 25.637500000000003 24.075 23.474999999999998 26.8125 30-31 24.525 24.8 23.225 27.450000000000003 32-33 25.8 24.2625 23.3125 26.625 34-35 24.349999999999998 23.9375 24.125 27.5875 36-37 25.775 23.8375 23.549999999999997 26.8375 38-39 25.650000000000002 24.4125 22.7375 27.200000000000003 40-41 24.85 24.587500000000002 23.925 26.637499999999996 42-43 25.575 23.1375 23.5625 27.725 44-45 25.687500000000004 23.7875 23.6375 26.887499999999996 46-47 26.831707926981746 23.730932733183295 22.280570142535634 27.156789197299325 48-49 26.231557889472366 24.043510877719427 23.068267066766694 26.65666416604151 50-51 26.04401100275069 23.55588897224306 23.005751437859466 27.394348587146787 52-53 26.006501625406354 22.99324831207802 23.680920230057513 27.319329832458116 54-55 26.91922980745186 23.493373343335833 22.53063265816454 27.056764191047762 56-57 25.95648912228057 23.63090772693173 23.20580145036259 27.206801700425103 58-59 26.60997874202826 22.733525071901965 23.28373139927473 27.372764786795052 60-61 25.437718859429715 24.212106053026513 23.374187093546773 26.975987993997 62-63 25.45022511255628 23.699349674837418 23.82441220610305 27.026013006503252 64-65 26.832624468351263 23.755316487365523 22.81711283462597 26.594946209657245 66-67 25.344008006004504 24.380785589191895 23.73029772329247 26.54490868151113 68-69 25.65674255691769 23.68026019514636 23.30497873405054 27.358018513885412 70-71 26.1195896922692 23.46760070052539 23.68026019514636 26.732549412059043 72-73 26.695021265949464 23.855391543657746 22.504378283712782 26.945208906680012 74-75 26.08206154615962 22.354265699274457 23.755316487365523 27.808356267200402 76-77 26.032024018013512 23.167375531648737 23.204903677758317 27.595696772579437 78-79 26.319739804853644 24.818613960470355 22.81711283462597 26.044533400050035 80-81 26.1195896922692 23.35501626219665 22.729547160370277 27.795846885163872 82-83 26.157117838378785 22.942206654991242 22.291718789091817 28.608956717538153 84-85 26.594946209657245 23.129847385539154 22.86715036277208 27.408056042031525 86-87 27.077077077077078 23.6986986986987 23.135635635635634 26.08858858858859 88-89 27.314814814814813 22.32232232232232 23.123123123123122 27.239739739739736 90-91 26.576576576576578 23.335835835835837 22.45995995995996 27.627627627627625 92-93 26.901901901901905 22.985485485485484 23.686186186186188 26.426426426426424 94-95 27.077077077077078 23.123123123123122 22.535035035035033 27.264764764764767 96-97 26.57150012521913 22.476834460305533 23.96694214876033 26.984723265715 98-99 27.247298156389064 22.39033693579148 23.776223776223777 26.586141131595674 100-101 28.129878239150795 9.428660630658756 27.91133312519513 34.53012800499532 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 2.0 23 2.0 24 1.0 25 0.5 26 0.5 27 2.5 28 3.5 29 3.0 30 3.5 31 7.5 32 12.5 33 15.0 34 19.0 35 22.5 36 27.5 37 39.0 38 44.5 39 56.5 40 88.5 41 120.0 42 141.0 43 161.5 44 160.0 45 137.5 46 157.5 47 159.0 48 135.5 49 137.0 50 139.0 51 153.5 52 131.5 53 114.0 54 115.5 55 113.5 56 112.5 57 91.5 58 85.0 59 76.5 60 72.0 61 81.0 62 85.0 63 85.0 64 85.5 65 82.5 66 75.5 67 67.0 68 68.5 69 72.5 70 76.0 71 72.0 72 58.5 73 56.5 74 45.0 75 29.0 76 28.5 77 23.0 78 15.5 79 14.0 80 7.5 81 4.0 82 3.5 83 2.5 84 1.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.275 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 44-45 1.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 1.0 60-61 0.0 62-63 1.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 1.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 1.0 96-97 26.0 98-99 334.0 100-101 3635.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.925 #Duplication Level Percentage of deduplicated Percentage of total 1 93.93132818738356 88.225 2 5.722651051370774 10.75 3 0.31940377961139205 0.8999999999999999 4 0.0 0.0 5 0.026616981634282673 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 5 0.125 TruSeq Adapter, Index 19 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794265 spots for SRR21853412.sra Written 794265 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra Read 794254 spots for SRR21853412.sra Written 794254 spots for SRR21853412.sra SRR ids: ['SRR21853412.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_llaq8g1c SRR21853412.sra spots: 15885091 blocks: [[1, 794254], [794255, 1588508], [1588509, 2382762], [2382763, 3177016], [3177017, 3971270], [3971271, 4765524], [4765525, 5559778], [5559779, 6354032], [6354033, 7148286], [7148287, 7942540], [7942541, 8736794], [8736795, 9531048], [9531049, 10325302], [10325303, 11119556], [11119557, 11913810], [11913811, 12708064], [12708065, 13502318], [13502319, 14296572], [14296573, 15090826], [15090827, 15885091]] SRR21853412 file size 4277927 SRR21853412 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853412 SRR21853412_1.fastq Input file: SRR21853412_1.fastq trimmed: SRR21853412-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:06:34 2024 >> started Fri Dec 6 14:06:42 2024 >> done (8.284s) 15885091 reads processed; of these: 14 ( 0.00%) short reads filtered out after trimming by size control 37791 ( 0.24%) empty reads filtered out after trimming by size control 15847286 (99.76%) reads available; of these: 444 ( 0.00%) trimmed reads available after processing 15846842 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 1 0.00% 23 3 0.00% 24 2 0.00% 25 4 0.00% 26 8 0.00% 27 0 0.00% 28 3 0.00% 29 4 0.00% 30 3 0.00% 31 3 0.00% 32 10 0.00% 33 2 0.00% 34 6 0.00% 35 74 0.00% 36 79 0.00% 37 56 0.00% 38 84 0.00% 39 67 0.00% 40 80 0.00% 41 85 0.00% 42 59 0.00% 43 84 0.00% 44 71 0.00% 45 87 0.00% 46 93 0.00% 47 110 0.00% 48 89 0.00% 49 91 0.00% 50 102 0.00% 51 107 0.00% 52 128 0.00% 53 123 0.00% 54 111 0.00% 55 104 0.00% 56 123 0.00% 57 148 0.00% 58 116 0.00% 59 164 0.00% 60 132 0.00% 61 168 0.00% 62 135 0.00% 63 160 0.00% 64 159 0.00% 65 160 0.00% 66 218 0.00% 67 169 0.00% 68 157 0.00% 69 178 0.00% 70 194 0.00% 71 196 0.00% 72 183 0.00% 73 175 0.00% 74 203 0.00% 75 214 0.00% 76 152 0.00% 77 219 0.00% 78 248 0.00% 79 269 0.00% 80 245 0.00% 81 270 0.00% 82 298 0.00% 83 276 0.00% 84 286 0.00% 85 340 0.00% 86 345 0.00% 87 345 0.00% 88 399 0.00% 89 417 0.00% 90 509 0.00% 91 958 0.01% 92 463 0.00% 93 620 0.00% 94 1201 0.01% 95 4214 0.03% 96 20966 0.13% 97 70091 0.44% 98 276080 1.74% 99 1049247 6.62% 100 3429683 21.64% 101 10983859 69.31% 15847286 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=4.12 fanout-score-rank=29 prefix-density=0.19 prefix-fanout=3.1 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=374.05 fanout-score-rank=1 prefix-density=1.14 prefix-fanout=26.2 sequence=CGCCGCCGCCGG Started job on | Dec 06 14:07:07 Started mapping on | Dec 06 14:07:07 Finished on | Dec 06 14:07:34 Mapping speed, Million of reads per hour | 2112.97 Number of input reads | 15847286 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 14232899 Uniquely mapped reads % | 89.81% Average mapped length | 100.23 Number of splices: Total | 4421343 Number of splices: Annotated (sjdb) | 4163944 Number of splices: GT/AG | 4360743 Number of splices: GC/AG | 48727 Number of splices: AT/AC | 2645 Number of splices: Non-canonical | 9228 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.01% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 523811 % of reads mapped to multiple loci | 3.31% Number of reads mapped to too many loci | 554314 % of reads mapped to too many loci | 3.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1090576 1090576 1090576 N_multimapping 523811 523811 523811 N_noFeature 585737 7369009 7253695 N_ambiguous 222148 13281 14623 UnstrandedReadsAssigned:13425014 PositiveStrandReadsAssigned:6850609 NegativeStrandReadsAssigned:6964581 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853412 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853412-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,847,286 reads, 13,854,401 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52973 SRR21853412.ke.tsv 35125 SRR21853412.se.tsv 88098 total ==> SRR21853412.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 6.48449e-06 9.1131e-07 PNS24247 1044 945 62.2279 7.74585 PNS24249 1928 1829 285.681 18.3732 PNS24246 1044 945 62.2279 7.74585 PNS24248 1044 945 62.2279 7.74585 PNS24244 1471 1372 29.6352 2.5408 PNS24243 293 194 7 4.24436 KQK14069 1603 1504 6980 545.913 KQK14071 474 375 849.03 266.322 ==> SRR21853412.se.tsv <== BRADI_1g14170v3 8444 BRADI_1g53295v3 86 BRADI_1g59795v3 345 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 201 BRADI_1g74790v3 231 BRADI_1g09890v3 0 BRADI_1g77505v3 227 BRADI_1g48960v3 0 SRR21853412 completed mapping pipeline successfully