Starting /dee2/code/volunteer_pipeline.sh SRR21853413 current disk space = 1550644174848 free memory = 1360952564 SRR21853413 SRAfilesize 4d88db7b96f436978eb654623cc9a6c0 SRR21853413.sra SRR21853413.sra file validated SRR21853413 is single end SRR21853413 is conventional basespace SRR21853413 read1 length is 75-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853413_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 75-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.1835 37.0 37.0 37.0 25.0 37.0 2 35.5645 37.0 37.0 37.0 37.0 37.0 3 35.82825 37.0 37.0 37.0 37.0 37.0 4 35.8515 37.0 37.0 37.0 37.0 37.0 5 36.0235 37.0 37.0 37.0 37.0 37.0 6 36.0175 37.0 37.0 37.0 37.0 37.0 7 35.836 37.0 37.0 37.0 37.0 37.0 8 36.04 37.0 37.0 37.0 37.0 37.0 9 35.9175 37.0 37.0 37.0 37.0 37.0 10-11 36.11025 37.0 37.0 37.0 37.0 37.0 12-13 35.96525 37.0 37.0 37.0 37.0 37.0 14-15 35.9855 37.0 37.0 37.0 37.0 37.0 16-17 35.97225 37.0 37.0 37.0 37.0 37.0 18-19 35.92425 37.0 37.0 37.0 37.0 37.0 20-21 35.918499999999995 37.0 37.0 37.0 37.0 37.0 22-23 35.873000000000005 37.0 37.0 37.0 37.0 37.0 24-25 35.926 37.0 37.0 37.0 37.0 37.0 26-27 35.769 37.0 37.0 37.0 37.0 37.0 28-29 35.6935 37.0 37.0 37.0 37.0 37.0 30-31 35.7245 37.0 37.0 37.0 37.0 37.0 32-33 35.63175 37.0 37.0 37.0 37.0 37.0 34-35 35.655 37.0 37.0 37.0 37.0 37.0 36-37 35.74875 37.0 37.0 37.0 37.0 37.0 38-39 35.672 37.0 37.0 37.0 37.0 37.0 40-41 35.553 37.0 37.0 37.0 37.0 37.0 42-43 35.64275 37.0 37.0 37.0 37.0 37.0 44-45 35.47325 37.0 37.0 37.0 37.0 37.0 46-47 35.50375 37.0 37.0 37.0 37.0 37.0 48-49 35.5155 37.0 37.0 37.0 37.0 37.0 50-51 35.4765 37.0 37.0 37.0 37.0 37.0 52-53 35.360749999999996 37.0 37.0 37.0 37.0 37.0 54-55 35.423500000000004 37.0 37.0 37.0 37.0 37.0 56-57 35.26075 37.0 37.0 37.0 31.0 37.0 58-59 35.378 37.0 37.0 37.0 31.0 37.0 60-61 35.3715 37.0 37.0 37.0 37.0 37.0 62-63 35.273250000000004 37.0 37.0 37.0 25.0 37.0 64-65 35.24925 37.0 37.0 37.0 31.0 37.0 66-67 35.318749999999994 37.0 37.0 37.0 31.0 37.0 68-69 35.3005 37.0 37.0 37.0 31.0 37.0 70-71 35.24125 37.0 37.0 37.0 31.0 37.0 72-73 35.1335 37.0 37.0 37.0 25.0 37.0 74-75 35.13575 37.0 37.0 37.0 25.0 37.0 76-77 35.051512878219555 37.0 37.0 37.0 25.0 37.0 78-79 34.94748687171793 37.0 37.0 37.0 25.0 37.0 80-81 35.06301575393849 37.0 37.0 37.0 25.0 37.0 82-83 34.9904976244061 37.0 37.0 37.0 25.0 37.0 84-85 35.06301575393849 37.0 37.0 37.0 25.0 37.0 86-87 34.924731182795696 37.0 37.0 37.0 25.0 37.0 88-89 34.948487121780445 37.0 37.0 37.0 25.0 37.0 90-91 34.788697174293574 37.0 37.0 37.0 25.0 37.0 92-93 34.790197549387344 37.0 37.0 37.0 25.0 37.0 94-95 34.8174543635909 37.0 37.0 37.0 25.0 37.0 96-97 34.72211972081196 37.0 37.0 37.0 25.0 37.0 98-99 34.61201371127419 37.0 37.0 37.0 25.0 37.0 100-101 34.54054517750663 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 5.0 22 1.0 23 3.0 24 6.0 25 9.0 26 19.0 27 23.0 28 32.0 29 45.0 30 63.0 31 96.0 32 133.0 33 206.0 34 337.0 35 670.0 36 2029.0 37 322.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.913956978489246 12.956478239119559 18.734367183591797 40.3951975987994 2 26.275 19.5 28.7 25.525 3 26.044533400050035 22.942206654991242 24.418313735301474 26.594946209657245 4 27.325 28.499999999999996 19.425 24.75 5 29.175 29.4 20.575 20.849999999999998 6 22.3 32.875 21.05 23.775 7 19.375 17.125 39.525 23.974999999999998 8 22.975 21.475 25.3 30.25 9 21.275 21.6 28.9 28.225 10-11 25.474999999999998 28.475 20.3875 25.662499999999998 12-13 24.05 22.1375 26.0 27.8125 14-15 24.4375 24.525 25.85 25.1875 16-17 24.712500000000002 23.9875 24.425 26.875 18-19 24.1875 25.362499999999997 24.962500000000002 25.4875 20-21 24.2 25.35 24.45 26.0 22-23 23.875 24.825 24.637500000000003 26.6625 24-25 24.0125 25.05 25.074999999999996 25.8625 26-27 24.0 25.0 24.837500000000002 26.1625 28-29 24.349999999999998 26.2125 23.25 26.187500000000004 30-31 24.85 26.0 24.962500000000002 24.1875 32-33 24.4 25.1 25.0125 25.4875 34-35 25.3125 24.65 24.337500000000002 25.7 36-37 25.156289072268066 25.056264066016503 24.81870467616904 24.968742185546386 38-39 25.124999999999996 24.65 23.9 26.325 40-41 24.75 25.2 23.65 26.400000000000002 42-43 24.5625 25.087500000000002 24.45 25.900000000000002 44-45 23.980995248812203 25.93148287071768 24.518629657414355 25.568892223055762 46-47 24.543635908977244 25.51887971992998 23.980995248812203 25.95648912228057 48-49 23.962500000000002 25.35 23.8125 26.875 50-51 23.4375 25.412499999999998 24.55 26.6 52-53 24.95 25.75 23.474999999999998 25.825 54-55 24.675 24.474999999999998 24.675 26.174999999999997 56-57 25.05 24.3125 24.575 26.0625 58-59 24.7 24.9 24.175 26.224999999999998 60-61 25.4 24.5625 24.0125 26.025 62-63 25.3125 24.975 24.95 24.762500000000003 64-65 25.224999999999998 24.425 24.712500000000002 25.637500000000003 66-67 24.8625 25.1 24.075 25.9625 68-69 25.7875 25.362499999999997 23.9875 24.8625 70-71 24.8625 24.425 23.8375 26.875 72-73 24.712500000000002 24.75 24.2 26.337500000000002 74-75 25.2375 23.775 24.099999999999998 26.887499999999996 76-77 25.55638909727432 24.793698424606152 24.293573393348336 25.35633908477119 78-79 24.781195298824706 24.60615153788447 24.131032758189548 26.481620405101275 80-81 24.36859214803701 24.76869217304326 23.95598899724931 26.906726681670417 82-83 25.218804701175294 24.293573393348336 24.85621405351338 25.63140785196299 84-85 25.656414103525883 24.093523380845213 24.256064016004 25.993998499624904 86-87 24.756189047261813 25.568892223055762 23.980995248812203 25.693923480870218 88-89 24.493623405851466 23.793448362090523 25.79394848712178 25.918979744936234 90-91 25.318829707426854 24.093523380845213 23.85596399099775 26.731682920730183 92-93 25.343835958989747 25.84396099024756 23.85596399099775 24.956239059764943 94-95 25.581395348837212 24.618654663665918 23.093273318329583 26.70667666916729 96-97 24.252283819296707 24.55262169941184 25.60380427981479 25.591290201476664 98-99 24.860122075279754 23.334181078331635 24.593082400813834 27.212614445574772 100-101 26.76475191735796 10.392862732822037 31.585537642823603 31.2568477069964 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.0 2 1.0 3 1.0 4 1.0 5 0.5 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 1.0 14 1.5 15 1.5 16 1.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.0 22 1.5 23 3.0 24 2.0 25 2.0 26 5.0 27 7.0 28 5.5 29 6.0 30 8.0 31 10.5 32 14.0 33 17.0 34 30.5 35 45.5 36 56.0 37 65.0 38 69.0 39 86.5 40 116.0 41 139.0 42 141.5 43 159.0 44 171.5 45 170.0 46 176.0 47 181.0 48 172.5 49 144.5 50 137.0 51 131.5 52 121.5 53 111.5 54 111.5 55 115.0 56 92.5 57 67.0 58 67.5 59 61.5 60 54.5 61 65.0 62 76.0 63 79.0 64 68.0 65 61.5 66 57.5 67 56.5 68 62.5 69 61.5 70 57.5 71 48.5 72 40.0 73 39.5 74 28.5 75 24.5 76 23.0 77 19.0 78 18.0 79 10.5 80 5.0 81 3.5 82 3.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.025 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.025 46-47 0.025 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 7.0 97 21.0 98 78.0 99 248.0 100 901.0 101 2744.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.875 #Duplication Level Percentage of deduplicated Percentage of total 1 94.16777629826898 88.4 2 5.40612516644474 10.15 3 0.34620505992010653 0.975 4 0.05326231691078562 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02663115845539281 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0125 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209087 spots for SRR21853413.sra Written 209087 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra Read 209077 spots for SRR21853413.sra Written 209077 spots for SRR21853413.sra SRR ids: ['SRR21853413.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mesgedbq SRR21853413.sra spots: 4181550 blocks: [[1, 209077], [209078, 418154], [418155, 627231], [627232, 836308], [836309, 1045385], [1045386, 1254462], [1254463, 1463539], [1463540, 1672616], [1672617, 1881693], [1881694, 2090770], [2090771, 2299847], [2299848, 2508924], [2508925, 2718001], [2718002, 2927078], [2927079, 3136155], [3136156, 3345232], [3345233, 3554309], [3554310, 3763386], [3763387, 3972463], [3972464, 4181550]] SRR21853413 file size 1123786 SRR21853413 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853413 SRR21853413_1.fastq Input file: SRR21853413_1.fastq trimmed: SRR21853413-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:13:01 2024 >> started Fri Dec 6 14:13:03 2024 >> done (2.405s) 4181550 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 3712 ( 0.09%) empty reads filtered out after trimming by size control 4177835 (99.91%) reads available; of these: 272 ( 0.01%) trimmed reads available after processing 4177563 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 2 0.00% 29 0 0.00% 30 0 0.00% 31 3 0.00% 32 3 0.00% 33 0 0.00% 34 4 0.00% 35 13 0.00% 36 9 0.00% 37 10 0.00% 38 16 0.00% 39 9 0.00% 40 15 0.00% 41 7 0.00% 42 10 0.00% 43 10 0.00% 44 10 0.00% 45 14 0.00% 46 12 0.00% 47 11 0.00% 48 15 0.00% 49 11 0.00% 50 15 0.00% 51 7 0.00% 52 19 0.00% 53 16 0.00% 54 15 0.00% 55 18 0.00% 56 15 0.00% 57 12 0.00% 58 18 0.00% 59 14 0.00% 60 10 0.00% 61 21 0.00% 62 19 0.00% 63 21 0.00% 64 34 0.00% 65 25 0.00% 66 23 0.00% 67 12 0.00% 68 18 0.00% 69 24 0.00% 70 30 0.00% 71 11 0.00% 72 30 0.00% 73 27 0.00% 74 15 0.00% 75 16 0.00% 76 19 0.00% 77 24 0.00% 78 22 0.00% 79 28 0.00% 80 30 0.00% 81 23 0.00% 82 37 0.00% 83 19 0.00% 84 39 0.00% 85 46 0.00% 86 39 0.00% 87 45 0.00% 88 37 0.00% 89 49 0.00% 90 71 0.00% 91 169 0.00% 92 52 0.00% 93 85 0.00% 94 254 0.01% 95 975 0.02% 96 5682 0.14% 97 19724 0.47% 98 76721 1.84% 99 278205 6.66% 100 955960 22.88% 101 2838810 67.95% 4177835 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=205.70 fanout-score-rank=13 prefix-density=0.87 prefix-fanout=24.7 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=346.97 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=24.7 sequence=CGCCGCCGCCGG Started job on | Dec 06 14:13:27 Started mapping on | Dec 06 14:13:27 Finished on | Dec 06 14:13:40 Mapping speed, Million of reads per hour | 1156.94 Number of input reads | 4177835 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 3829498 Uniquely mapped reads % | 91.66% Average mapped length | 100.24 Number of splices: Total | 1269010 Number of splices: Annotated (sjdb) | 1196727 Number of splices: GT/AG | 1252043 Number of splices: GC/AG | 13866 Number of splices: AT/AC | 671 Number of splices: Non-canonical | 2430 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 107460 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 80932 % of reads mapped to too many loci | 1.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.66% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 240877 240877 240877 N_multimapping 107460 107460 107460 N_noFeature 179658 2008756 1947663 N_ambiguous 60218 3790 4181 UnstrandedReadsAssigned:3589622 PositiveStrandReadsAssigned:1816952 NegativeStrandReadsAssigned:1877654 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853413 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853413-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,177,835 reads, 3,718,963 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,000 rounds 52973 SRR21853413.ke.tsv 35125 SRR21853413.se.tsv 88098 total ==> SRR21853413.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 23.1472 11.5734 PNS24249 1928 1829 68.7863 17.7698 PNS24246 1044 945 23.1472 11.5734 PNS24248 1044 945 23.1472 11.5734 PNS24244 1471 1372 4.77203 1.6434 PNS24243 293 194 1 2.43552 KQK14069 1603 1504 1586.39 498.374 KQK14071 474 375 161.603 203.615 ==> SRR21853413.se.tsv <== BRADI_1g14170v3 1932 BRADI_1g53295v3 29 BRADI_1g59795v3 150 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 51 BRADI_1g74790v3 42 BRADI_1g09890v3 0 BRADI_1g77505v3 41 BRADI_1g48960v3 0 SRR21853413 completed mapping pipeline successfully