Starting /dee2/code/volunteer_pipeline.sh SRR21853414 current disk space = 1550637551616 free memory = 1599780648 SRR21853414 SRAfilesize 03165730b4ea03789d870f482a5a1dce SRR21853414.sra SRR21853414.sra file validated SRR21853414 is single end SRR21853414 is conventional basespace SRR21853414 read1 length is 62-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853414_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 62-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.843 37.0 37.0 37.0 25.0 37.0 2 34.912 37.0 37.0 37.0 25.0 37.0 3 35.471 37.0 37.0 37.0 37.0 37.0 4 35.4005 37.0 37.0 37.0 37.0 37.0 5 35.6825 37.0 37.0 37.0 37.0 37.0 6 35.6395 37.0 37.0 37.0 37.0 37.0 7 35.423 37.0 37.0 37.0 37.0 37.0 8 35.8105 37.0 37.0 37.0 37.0 37.0 9 35.7045 37.0 37.0 37.0 37.0 37.0 10-11 35.7425 37.0 37.0 37.0 37.0 37.0 12-13 35.631 37.0 37.0 37.0 37.0 37.0 14-15 35.696 37.0 37.0 37.0 37.0 37.0 16-17 35.681 37.0 37.0 37.0 37.0 37.0 18-19 35.71575 37.0 37.0 37.0 37.0 37.0 20-21 35.595749999999995 37.0 37.0 37.0 37.0 37.0 22-23 35.64625 37.0 37.0 37.0 37.0 37.0 24-25 35.6555 37.0 37.0 37.0 37.0 37.0 26-27 35.48875 37.0 37.0 37.0 37.0 37.0 28-29 35.530249999999995 37.0 37.0 37.0 37.0 37.0 30-31 35.502250000000004 37.0 37.0 37.0 37.0 37.0 32-33 35.5155 37.0 37.0 37.0 37.0 37.0 34-35 35.4275 37.0 37.0 37.0 37.0 37.0 36-37 35.330749999999995 37.0 37.0 37.0 31.0 37.0 38-39 35.429 37.0 37.0 37.0 37.0 37.0 40-41 35.3455 37.0 37.0 37.0 31.0 37.0 42-43 35.3395 37.0 37.0 37.0 37.0 37.0 44-45 35.31525 37.0 37.0 37.0 31.0 37.0 46-47 35.311 37.0 37.0 37.0 31.0 37.0 48-49 35.3705 37.0 37.0 37.0 31.0 37.0 50-51 35.268 37.0 37.0 37.0 31.0 37.0 52-53 35.3845 37.0 37.0 37.0 37.0 37.0 54-55 35.2375 37.0 37.0 37.0 31.0 37.0 56-57 35.3215 37.0 37.0 37.0 37.0 37.0 58-59 35.323750000000004 37.0 37.0 37.0 37.0 37.0 60-61 35.1795 37.0 37.0 37.0 25.0 37.0 62-63 35.23077869467367 37.0 37.0 37.0 25.0 37.0 64-65 35.19604901225306 37.0 37.0 37.0 31.0 37.0 66-67 35.161540385096274 37.0 37.0 37.0 25.0 37.0 68-69 35.09377344336084 37.0 37.0 37.0 25.0 37.0 70-71 35.0622655663916 37.0 37.0 37.0 25.0 37.0 72-73 35.168042010502624 37.0 37.0 37.0 25.0 37.0 74-75 34.989997499374844 37.0 37.0 37.0 25.0 37.0 76-77 34.97249312328082 37.0 37.0 37.0 25.0 37.0 78-79 35.06326581645412 37.0 37.0 37.0 25.0 37.0 80-81 35.09877469367342 37.0 37.0 37.0 25.0 37.0 82-83 35.19329832458115 37.0 37.0 37.0 25.0 37.0 84-85 35.03650912728182 37.0 37.0 37.0 25.0 37.0 86-87 35.032516258129064 37.0 37.0 37.0 25.0 37.0 88-89 35.01450725362682 37.0 37.0 37.0 25.0 37.0 90-91 35.029264632316156 37.0 37.0 37.0 25.0 37.0 92-93 34.85717858929465 37.0 37.0 37.0 25.0 37.0 94-95 34.97398699349675 37.0 37.0 37.0 25.0 37.0 96-97 35.02454960315693 37.0 37.0 37.0 25.0 37.0 98-99 34.90604442714313 37.0 37.0 37.0 25.0 37.0 100-101 34.955468190687164 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 4.0 24 4.0 25 11.0 26 21.0 27 27.0 28 45.0 29 70.0 30 82.0 31 128.0 32 139.0 33 215.0 34 306.0 35 619.0 36 2007.0 37 318.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.425 11.5 19.325 39.75 2 23.953605648008068 18.658598083711546 31.971759959657085 25.416036308623298 3 25.8 21.975 25.575 26.650000000000002 4 26.625 26.375 20.1 26.900000000000002 5 26.125 30.3 21.25 22.325 6 21.65 33.725 20.7 23.925 7 19.0 17.075000000000003 39.324999999999996 24.6 8 21.4 22.2 25.424999999999997 30.975 9 22.1 21.875 28.675 27.35 10-11 24.8 28.050000000000004 20.474999999999998 26.674999999999997 12-13 23.425 22.125 27.35 27.1 14-15 23.125 24.5 26.825 25.55 16-17 25.174999999999997 23.7875 24.462500000000002 26.575 18-19 23.8625 24.8 25.374999999999996 25.9625 20-21 24.474999999999998 25.7125 24.462500000000002 25.35 22-23 25.137500000000003 24.8 24.0125 26.05 24-25 24.5125 24.2625 25.3125 25.912499999999998 26-27 24.85 24.625 24.474999999999998 26.05 28-29 24.175 25.25 24.6625 25.912499999999998 30-31 24.8625 25.662499999999998 23.674999999999997 25.8 32-33 24.9375 25.624999999999996 24.9 24.5375 34-35 24.5125 24.2 24.7 26.5875 36-37 25.087500000000002 25.0625 23.7 26.150000000000002 38-39 24.4125 25.162499999999998 24.3125 26.1125 40-41 24.637500000000003 25.7875 23.575 26.0 42-43 24.8625 25.025 24.1875 25.924999999999997 44-45 24.099999999999998 24.15 25.0125 26.737499999999997 46-47 25.2625 24.625 24.15 25.9625 48-49 25.337500000000002 24.95 24.5 25.2125 50-51 25.0125 24.4125 24.2375 26.337500000000002 52-53 24.45 24.9875 24.3875 26.174999999999997 54-55 24.325 24.8625 24.725 26.087500000000002 56-57 24.325 23.5125 25.6 26.5625 58-59 25.15 24.5 24.55 25.8 60-61 25.2 23.9 24.5 26.400000000000002 62-63 24.57807225903238 24.1780222527816 25.428178522315285 25.815726965870734 64-65 25.418854713678417 24.268567141785446 24.981245311327832 25.331332833208304 66-67 24.3935983995999 25.331332833208304 24.69367341835459 25.581395348837212 68-69 25.218804701175294 24.568642160540136 24.006001500375092 26.206551637909474 70-71 25.381345336334082 24.81870467616904 24.056014003500874 25.743935983995996 72-73 24.943735933983497 24.60615153788447 23.918479619904975 26.531632908227053 74-75 25.44386096524131 24.718679669917478 24.468617154288573 25.36884221055264 76-77 25.743935983995996 24.90622655663916 22.918229557389346 26.431607901975497 78-79 25.343835958989747 24.81870467616904 24.218554638659665 25.618904726181547 80-81 25.51887971992998 25.243810952738183 23.568392098024507 25.668917229307326 82-83 25.04376094023506 25.006251562890725 23.80595148787197 26.144036009002253 84-85 24.99374843710928 25.056264066016503 23.85596399099775 26.094023505876468 86-87 25.362681340670335 24.312156078039017 24.562281140570285 25.76288144072036 88-89 25.87543771885943 23.761880940470235 23.974487243621812 26.388194097048522 90-91 25.100050025012504 24.72486243121561 23.936968484242122 26.23811905952976 92-93 25.162581290645324 24.68734367183592 24.512256128064035 25.63781890945473 94-95 25.175087543771884 24.574787393696848 23.461730865432717 26.788394197098548 96-97 25.297432686286786 25.685660613650597 24.50845335003131 24.50845335003131 98-99 25.24506683640993 23.98472310630172 25.194143857415657 25.57606619987269 100-101 26.604068857589986 10.453834115805947 29.74960876369327 33.1924882629108 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 5.5 2 4.0 3 1.5 4 1.0 5 1.0 6 1.0 7 1.5 8 1.0 9 0.5 10 1.0 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.5 23 2.0 24 2.5 25 4.0 26 4.5 27 4.5 28 6.5 29 9.5 30 11.5 31 13.0 32 15.0 33 20.5 34 29.0 35 36.0 36 38.5 37 45.0 38 76.0 39 93.0 40 108.5 41 138.0 42 153.5 43 151.0 44 160.5 45 170.0 46 171.5 47 183.0 48 170.0 49 151.5 50 140.0 51 129.0 52 135.0 53 124.5 54 103.5 55 101.0 56 84.0 57 79.5 58 79.0 59 68.5 60 72.5 61 67.0 62 60.5 63 70.5 64 75.0 65 67.0 66 70.5 67 64.5 68 53.5 69 52.5 70 48.0 71 45.5 72 41.0 73 38.0 74 32.0 75 26.5 76 24.0 77 17.5 78 12.0 79 12.0 80 8.5 81 4.5 82 2.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8500000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 62 1.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 4.0 96 3.0 97 20.0 98 87.0 99 245.0 100 888.0 101 2751.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.70338983050848 89.4 2 5.005296610169491 9.45 3 0.15889830508474578 0.44999999999999996 4 0.1059322033898305 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026483050847457626 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 12 0.3 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596948 spots for SRR21853414.sra Written 596948 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra Read 596934 spots for SRR21853414.sra Written 596934 spots for SRR21853414.sra SRR ids: ['SRR21853414.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ni2mye4w SRR21853414.sra spots: 11938694 blocks: [[1, 596934], [596935, 1193868], [1193869, 1790802], [1790803, 2387736], [2387737, 2984670], [2984671, 3581604], [3581605, 4178538], [4178539, 4775472], [4775473, 5372406], [5372407, 5969340], [5969341, 6566274], [6566275, 7163208], [7163209, 7760142], [7760143, 8357076], [8357077, 8954010], [8954011, 9550944], [9550945, 10147878], [10147879, 10744812], [10744813, 11341746], [11341747, 11938694]] SRR21853414 file size 3211912 SRR21853414 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853414 SRR21853414_1.fastq Input file: SRR21853414_1.fastq trimmed: SRR21853414-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:14:19 2024 >> started Fri Dec 6 14:14:26 2024 >> done (6.350s) 11938694 reads processed; of these: 17 ( 0.00%) short reads filtered out after trimming by size control 19708 ( 0.17%) empty reads filtered out after trimming by size control 11918969 (99.83%) reads available; of these: 375 ( 0.00%) trimmed reads available after processing 11918594 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 2 0.00% 23 0 0.00% 24 4 0.00% 25 1 0.00% 26 9 0.00% 27 6 0.00% 28 1 0.00% 29 7 0.00% 30 7 0.00% 31 5 0.00% 32 8 0.00% 33 9 0.00% 34 4 0.00% 35 54 0.00% 36 65 0.00% 37 61 0.00% 38 75 0.00% 39 84 0.00% 40 65 0.00% 41 67 0.00% 42 72 0.00% 43 77 0.00% 44 80 0.00% 45 102 0.00% 46 98 0.00% 47 85 0.00% 48 101 0.00% 49 81 0.00% 50 91 0.00% 51 97 0.00% 52 95 0.00% 53 86 0.00% 54 125 0.00% 55 100 0.00% 56 107 0.00% 57 109 0.00% 58 105 0.00% 59 124 0.00% 60 141 0.00% 61 121 0.00% 62 118 0.00% 63 158 0.00% 64 139 0.00% 65 154 0.00% 66 137 0.00% 67 161 0.00% 68 150 0.00% 69 152 0.00% 70 110 0.00% 71 154 0.00% 72 141 0.00% 73 140 0.00% 74 154 0.00% 75 149 0.00% 76 153 0.00% 77 168 0.00% 78 162 0.00% 79 190 0.00% 80 175 0.00% 81 218 0.00% 82 185 0.00% 83 193 0.00% 84 212 0.00% 85 211 0.00% 86 232 0.00% 87 241 0.00% 88 254 0.00% 89 262 0.00% 90 340 0.00% 91 583 0.00% 92 281 0.00% 93 462 0.00% 94 825 0.01% 95 3053 0.03% 96 16263 0.14% 97 56802 0.48% 98 220916 1.85% 99 792955 6.65% 100 2737587 22.97% 101 8081497 67.80% 11918969 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=197.69 fanout-score-rank=14 prefix-density=0.83 prefix-fanout=23.9 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=345.06 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=23.3 sequence=GCCGCCGCCGCG Started job on | Dec 06 14:14:43 Started mapping on | Dec 06 14:14:43 Finished on | Dec 06 14:15:12 Mapping speed, Million of reads per hour | 1479.60 Number of input reads | 11918969 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 10906275 Uniquely mapped reads % | 91.50% Average mapped length | 100.19 Number of splices: Total | 3653613 Number of splices: Annotated (sjdb) | 3447187 Number of splices: GT/AG | 3604086 Number of splices: GC/AG | 39949 Number of splices: AT/AC | 2146 Number of splices: Non-canonical | 7432 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.26 Insertion rate per base | 0.01% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 309670 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 206313 % of reads mapped to too many loci | 1.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.90% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 703024 703024 703024 N_multimapping 309670 309670 309670 N_noFeature 508861 5700996 5564074 N_ambiguous 171583 10875 11964 UnstrandedReadsAssigned:10225831 PositiveStrandReadsAssigned:5194404 NegativeStrandReadsAssigned:5330237 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853414 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853414-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,918,969 reads, 10,573,947 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52973 SRR21853414.ke.tsv 35125 SRR21853414.se.tsv 88098 total ==> SRR21853414.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 23.2762 4.58241 PNS24247 1044 945 56.0375 9.77135 PNS24249 1928 1829 139.464 12.5648 PNS24246 1044 945 56.0375 9.77135 PNS24248 1044 945 56.0375 9.77135 PNS24244 1471 1372 31.1469 3.74084 PNS24243 293 194 11 9.34326 KQK14069 1603 1504 4881.75 534.854 KQK14071 474 375 485.161 213.188 ==> SRR21853414.se.tsv <== BRADI_1g14170v3 5963 BRADI_1g53295v3 79 BRADI_1g59795v3 337 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 135 BRADI_1g74790v3 115 BRADI_1g09890v3 0 BRADI_1g77505v3 189 BRADI_1g48960v3 0 SRR21853414 completed mapping pipeline successfully