Starting /dee2/code/volunteer_pipeline.sh SRR21853415 current disk space = 1550591356928 free memory = 1598485284 SRR21853415 SRAfilesize 8bae92f1b96cf8dd5b546dba2b9db815 SRR21853415.sra SRR21853415.sra file validated SRR21853415 is single end SRR21853415 is conventional basespace SRR21853415 read1 length is 96-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853415_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 96-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.25625 32.0 32.0 32.0 32.0 32.0 2 31.44925 32.0 32.0 32.0 32.0 32.0 3 31.537 32.0 32.0 32.0 32.0 32.0 4 31.562 32.0 32.0 32.0 32.0 32.0 5 31.53275 32.0 32.0 32.0 32.0 32.0 6 34.92175 36.0 36.0 36.0 36.0 36.0 7 35.20025 36.0 36.0 36.0 36.0 36.0 8 35.12625 36.0 36.0 36.0 36.0 36.0 9 35.118 36.0 36.0 36.0 36.0 36.0 10-11 35.101625 36.0 36.0 36.0 36.0 36.0 12-13 35.081125 36.0 36.0 36.0 36.0 36.0 14-15 35.128875 36.0 36.0 36.0 36.0 36.0 16-17 35.027625 36.0 36.0 36.0 36.0 36.0 18-19 35.04625 36.0 36.0 36.0 36.0 36.0 20-21 35.016999999999996 36.0 36.0 36.0 36.0 36.0 22-23 34.97525 36.0 36.0 36.0 34.0 36.0 24-25 34.927625 36.0 36.0 36.0 36.0 36.0 26-27 34.884375 36.0 36.0 36.0 34.0 36.0 28-29 34.90275 36.0 36.0 36.0 32.0 36.0 30-31 34.87775 36.0 36.0 36.0 32.0 36.0 32-33 34.755875 36.0 36.0 36.0 32.0 36.0 34-35 34.778999999999996 36.0 36.0 36.0 32.0 36.0 36-37 34.719125 36.0 36.0 36.0 32.0 36.0 38-39 34.6345 36.0 36.0 36.0 32.0 36.0 40-41 34.595375000000004 36.0 36.0 36.0 34.0 36.0 42-43 34.66425 36.0 36.0 36.0 32.0 36.0 44-45 34.561499999999995 36.0 36.0 36.0 32.0 36.0 46-47 34.644 36.0 36.0 36.0 32.0 36.0 48-49 34.673 36.0 36.0 36.0 32.0 36.0 50-51 34.603875 36.0 36.0 36.0 32.0 36.0 52-53 34.613125 36.0 36.0 36.0 32.0 36.0 54-55 34.480000000000004 36.0 36.0 36.0 32.0 36.0 56-57 34.435875 36.0 36.0 36.0 32.0 36.0 58-59 34.3535 36.0 36.0 36.0 32.0 36.0 60-61 34.30825 36.0 36.0 36.0 32.0 36.0 62-63 34.3635 36.0 36.0 36.0 32.0 36.0 64-65 34.27375 36.0 36.0 36.0 32.0 36.0 66-67 34.164500000000004 36.0 36.0 36.0 32.0 36.0 68-69 34.140625 36.0 36.0 36.0 32.0 36.0 70-71 34.06725 36.0 36.0 36.0 32.0 36.0 72-73 34.13175 36.0 36.0 36.0 32.0 36.0 74-75 34.025999999999996 36.0 36.0 36.0 32.0 36.0 76-77 33.990375 36.0 36.0 36.0 32.0 36.0 78-79 34.0005 36.0 36.0 36.0 32.0 36.0 80-81 33.817499999999995 36.0 36.0 36.0 27.0 36.0 82-83 33.884875 36.0 36.0 36.0 29.5 36.0 84-85 33.924499999999995 36.0 36.0 36.0 32.0 36.0 86-87 33.895375 36.0 36.0 36.0 32.0 36.0 88-89 33.8825 36.0 36.0 36.0 29.5 36.0 90-91 33.8275 36.0 36.0 36.0 29.5 36.0 92-93 33.706625 36.0 36.0 36.0 27.0 36.0 94-95 33.758375 36.0 36.0 36.0 27.0 36.0 96-97 33.73864759639459 36.0 36.0 36.0 27.0 36.0 98-99 33.71440514593428 36.0 36.0 36.0 27.0 36.0 100-101 32.84883812214613 36.0 34.0 36.0 20.5 36.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 11101 1 0.0 11101 2 0.0 11101 3 0.0 11101 4 0.0 11101 5 0.0 11101 6 0.0 11101 7 0.0 11101 8 0.0 11101 9 0.0 11101 10-11 0.0 11101 12-13 0.0 11101 14-15 0.0 11101 16-17 0.0 11101 18-19 0.0 11101 20-21 0.0 11101 22-23 0.0 11101 24-25 0.0 11101 26-27 0.0 11101 28-29 0.0 11101 30-31 0.0 11101 32-33 0.0 11101 34-35 0.0 11101 36-37 0.0 11101 38-39 0.0 11101 40-41 0.0 11101 42-43 0.0 11101 44-45 0.0 11101 46-47 0.0 11101 48-49 0.0 11101 50-51 0.0 11101 52-53 0.0 11101 54-55 0.0 11101 56-57 0.0 11101 58-59 0.0 11101 60-61 0.0 11101 62-63 0.0 11101 64-65 0.0 11101 66-67 0.0 11101 68-69 0.0 11101 70-71 0.0 11101 72-73 0.0 11101 74-75 0.0 11101 76-77 0.0 11101 78-79 0.0 11101 80-81 0.0 11101 82-83 0.0 11101 84-85 0.0 11101 86-87 0.0 11101 88-89 0.0 11101 90-91 0.0 11101 92-93 0.0 11101 94-95 0.0 11101 96-97 0.0 11101 98-99 0.0 11101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 5.0 21 3.0 22 6.0 23 14.0 24 13.0 25 25.0 26 20.0 27 32.0 28 52.0 29 82.0 30 108.0 31 132.0 32 189.0 33 313.0 34 707.0 35 2299.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.199999999999996 13.8 19.625 38.375 2 24.075 20.025000000000002 31.7 24.2 3 25.424999999999997 23.125 25.874999999999996 25.575 4 26.424999999999997 28.4 20.525 24.65 5 26.150000000000002 30.675 21.675 21.5 6 22.099724379854674 32.84891004760711 21.92432974191932 23.12703583061889 7 19.5 17.474999999999998 39.45 23.575 8 21.9 23.525 26.3 28.275 9 21.375 21.5 28.825 28.299999999999997 10-11 24.725 29.037499999999998 20.9125 25.324999999999996 12-13 23.075000000000003 23.125 27.037499999999998 26.7625 14-15 23.1875 24.887500000000003 26.4125 25.5125 16-17 24.224999999999998 24.75 24.825 26.200000000000003 18-19 23.1375 25.5625 25.424999999999997 25.874999999999996 20-21 23.425 25.2 25.324999999999996 26.05 22-23 24.462500000000002 25.687500000000004 24.962500000000002 24.887500000000003 24-25 23.5875 25.9625 24.6 25.85 26-27 23.849999999999998 25.624999999999996 25.124999999999996 25.4 28-29 24.25 25.162499999999998 25.124999999999996 25.4625 30-31 24.462500000000002 25.0625 24.6 25.874999999999996 32-33 23.7125 25.95 25.124999999999996 25.2125 34-35 24.775 25.087500000000002 25.7625 24.375 36-37 24.1125 25.7875 25.074999999999996 25.025 38-39 24.2875 25.1875 25.8 24.725 40-41 23.9 25.174999999999997 24.925 26.0 42-43 23.8875 25.05 24.837500000000002 26.224999999999998 44-45 24.0 26.25 25.35 24.4 46-47 24.175 25.7 25.4375 24.6875 48-49 24.5625 24.55 25.337500000000002 25.55 50-51 23.95 25.775 24.9875 25.2875 52-53 23.599999999999998 25.4875 24.762500000000003 26.150000000000002 54-55 24.825 24.6125 25.0 25.5625 56-57 24.4875 25.2625 25.2875 24.962500000000002 58-59 24.637500000000003 24.9375 24.4375 25.9875 60-61 24.15 25.6125 25.45 24.7875 62-63 25.924999999999997 25.074999999999996 23.95 25.05 64-65 24.55 26.087500000000002 23.4875 25.874999999999996 66-67 24.925 24.1625 25.724999999999998 25.1875 68-69 23.8125 25.362499999999997 25.1875 25.637500000000003 70-71 25.0625 24.925 24.2375 25.775 72-73 23.8125 25.587500000000002 24.45 26.150000000000002 74-75 25.224999999999998 26.0375 23.5125 25.224999999999998 76-77 25.0125 25.7875 24.3625 24.837500000000002 78-79 24.45 25.362499999999997 25.2375 24.95 80-81 25.275 25.35 24.65 24.725 82-83 25.337500000000002 24.8125 24.2875 25.5625 84-85 25.55 25.112499999999997 24.175 25.162499999999998 86-87 25.112499999999997 25.5625 25.025 24.3 88-89 24.825 24.9 24.55 25.724999999999998 90-91 25.2 24.6125 24.8625 25.324999999999996 92-93 24.875 25.900000000000002 24.3125 24.9125 94-95 25.637500000000003 25.324999999999996 24.0125 25.025 96-97 25.25644233174881 24.7935951963973 25.243932949712285 24.706029522141606 98-99 26.23574144486692 24.20785804816223 24.752851711026615 24.803548795944234 100-101 26.318289786223275 11.670625494853523 30.182106096595408 31.828978622327792 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 14.0 1 8.0 2 1.0 3 0.5 4 2.0 5 2.5 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 2.0 20 3.0 21 2.0 22 1.5 23 0.5 24 1.0 25 3.0 26 3.0 27 2.0 28 5.5 29 9.5 30 11.0 31 13.0 32 14.0 33 19.5 34 29.0 35 40.0 36 57.5 37 71.5 38 83.5 39 99.5 40 123.5 41 144.0 42 159.0 43 178.0 44 175.0 45 165.0 46 186.0 47 196.5 48 172.5 49 158.5 50 148.5 51 132.5 52 120.0 53 116.0 54 103.0 55 89.5 56 82.5 57 74.5 58 80.5 59 78.5 60 68.5 61 63.0 62 52.0 63 49.0 64 55.0 65 60.5 66 62.5 67 56.0 68 50.5 69 46.5 70 41.0 71 41.5 72 41.5 73 33.0 74 23.5 75 19.0 76 18.5 77 15.5 78 9.5 79 6.5 80 6.0 81 2.5 82 1.0 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.22499999999999998 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 96 6.0 97 14.0 98 70.0 99 278.0 100 949.0 101 2683.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77335683706875 99.05000000000001 2 0.15109544195416771 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.02518257365902795 0.15 7 0.02518257365902795 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02518257365902795 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 13 0.325 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 7 0.17500000000000002 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 6 0.15 TruSeq Adapter, Index 19 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398604 spots for SRR21853415.sra Written 398604 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra Read 398597 spots for SRR21853415.sra Written 398597 spots for SRR21853415.sra SRR ids: ['SRR21853415.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q6e6fsnk SRR21853415.sra spots: 7971947 blocks: [[1, 398597], [398598, 797194], [797195, 1195791], [1195792, 1594388], [1594389, 1992985], [1992986, 2391582], [2391583, 2790179], [2790180, 3188776], [3188777, 3587373], [3587374, 3985970], [3985971, 4384567], [4384568, 4783164], [4783165, 5181761], [5181762, 5580358], [5580359, 5978955], [5978956, 6377552], [6377553, 6776149], [6776150, 7174746], [7174747, 7573343], [7573344, 7971947]] SRR21853415 file size 2172472 SRR21853415 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853415 SRR21853415_1.fastq Input file: SRR21853415_1.fastq trimmed: SRR21853415-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:16:23 2024 >> started Fri Dec 6 14:16:30 2024 >> done (7.029s) 7971947 reads processed; of these: 10 ( 0.00%) short reads filtered out after trimming by size control 18187 ( 0.23%) empty reads filtered out after trimming by size control 7953750 (99.77%) reads available; of these: 88 ( 0.00%) trimmed reads available after processing 7953662 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 2 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 1 0.00% 28 0 0.00% 29 1 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 3 0.00% 34 2 0.00% 35 25 0.00% 36 16 0.00% 37 21 0.00% 38 40 0.00% 39 22 0.00% 40 22 0.00% 41 32 0.00% 42 19 0.00% 43 23 0.00% 44 22 0.00% 45 21 0.00% 46 30 0.00% 47 26 0.00% 48 28 0.00% 49 21 0.00% 50 19 0.00% 51 31 0.00% 52 28 0.00% 53 38 0.00% 54 27 0.00% 55 33 0.00% 56 28 0.00% 57 34 0.00% 58 30 0.00% 59 37 0.00% 60 38 0.00% 61 52 0.00% 62 43 0.00% 63 42 0.00% 64 61 0.00% 65 51 0.00% 66 40 0.00% 67 38 0.00% 68 50 0.00% 69 46 0.00% 70 46 0.00% 71 36 0.00% 72 45 0.00% 73 54 0.00% 74 45 0.00% 75 55 0.00% 76 48 0.00% 77 55 0.00% 78 62 0.00% 79 61 0.00% 80 63 0.00% 81 66 0.00% 82 75 0.00% 83 66 0.00% 84 93 0.00% 85 70 0.00% 86 104 0.00% 87 97 0.00% 88 115 0.00% 89 113 0.00% 90 149 0.00% 91 312 0.00% 92 141 0.00% 93 196 0.00% 94 478 0.01% 95 1875 0.02% 96 9999 0.13% 97 37677 0.47% 98 145434 1.83% 99 515279 6.48% 100 1840730 23.14% 101 5398964 67.88% 7953750 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=189.48 fanout-score-rank=12 prefix-density=0.79 prefix-fanout=23.4 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=352.04 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=23.4 sequence=CGCCGCCGCCGA Started job on | Dec 06 14:16:46 Started mapping on | Dec 06 14:16:46 Finished on | Dec 06 14:17:09 Mapping speed, Million of reads per hour | 1244.93 Number of input reads | 7953750 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 7227653 Uniquely mapped reads % | 90.87% Average mapped length | 100.20 Number of splices: Total | 2409753 Number of splices: Annotated (sjdb) | 2275585 Number of splices: GT/AG | 2377940 Number of splices: GC/AG | 26205 Number of splices: AT/AC | 1412 Number of splices: Non-canonical | 4196 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 2.05 Insertion rate per base | 0.01% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 198922 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 145260 % of reads mapped to too many loci | 1.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.59% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 527175 527175 527175 N_multimapping 198922 198922 198922 N_noFeature 356336 3782726 3701938 N_ambiguous 113692 7333 7895 UnstrandedReadsAssigned:6757625 PositiveStrandReadsAssigned:3437594 NegativeStrandReadsAssigned:3517820 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853415 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853415-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,953,750 reads, 7,042,551 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52973 SRR21853415.ke.tsv 35125 SRR21853415.se.tsv 88098 total ==> SRR21853415.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 59.0357 17.5624 PNS24247 1044 945 18.5858 4.89715 PNS24249 1928 1829 100.793 13.7219 PNS24246 1044 945 18.5858 4.89715 PNS24248 1044 945 18.5858 4.89715 PNS24244 1471 1372 20.4136 3.70475 PNS24243 293 194 8 10.2679 KQK14069 1603 1504 2875.98 476.137 KQK14071 474 375 258.087 171.368 ==> SRR21853415.se.tsv <== BRADI_1g14170v3 3530 BRADI_1g53295v3 46 BRADI_1g59795v3 265 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 79 BRADI_1g74790v3 64 BRADI_1g09890v3 0 BRADI_1g77505v3 124 BRADI_1g48960v3 0 SRR21853415 completed mapping pipeline successfully