Starting /dee2/code/volunteer_pipeline.sh SRR21853416 current disk space = 1550609018880 free memory = 1598926844 SRR21853416 SRAfilesize 2d696d8632963e2d5346c6f7f6379537 SRR21853416.sra SRR21853416.sra file validated SRR21853416 is single end SRR21853416 is conventional basespace SRR21853416 read1 length is 87-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853416_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 87-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.31 37.0 37.0 37.0 37.0 37.0 2 35.7925 37.0 37.0 37.0 37.0 37.0 3 35.9 37.0 37.0 37.0 37.0 37.0 4 36.036 37.0 37.0 37.0 37.0 37.0 5 35.937 37.0 37.0 37.0 37.0 37.0 6 36.015 37.0 37.0 37.0 37.0 37.0 7 35.869 37.0 37.0 37.0 37.0 37.0 8 36.0 37.0 37.0 37.0 37.0 37.0 9 35.976 37.0 37.0 37.0 37.0 37.0 10-11 35.904250000000005 37.0 37.0 37.0 37.0 37.0 12-13 35.975 37.0 37.0 37.0 37.0 37.0 14-15 35.995000000000005 37.0 37.0 37.0 37.0 37.0 16-17 35.916 37.0 37.0 37.0 37.0 37.0 18-19 35.84925 37.0 37.0 37.0 37.0 37.0 20-21 35.7875 37.0 37.0 37.0 37.0 37.0 22-23 35.906499999999994 37.0 37.0 37.0 37.0 37.0 24-25 35.893249999999995 37.0 37.0 37.0 37.0 37.0 26-27 35.70875 37.0 37.0 37.0 37.0 37.0 28-29 35.74525 37.0 37.0 37.0 37.0 37.0 30-31 35.663 37.0 37.0 37.0 37.0 37.0 32-33 35.758250000000004 37.0 37.0 37.0 37.0 37.0 34-35 35.61125 37.0 37.0 37.0 37.0 37.0 36-37 35.65625 37.0 37.0 37.0 37.0 37.0 38-39 35.69725 37.0 37.0 37.0 37.0 37.0 40-41 35.6665 37.0 37.0 37.0 37.0 37.0 42-43 35.720749999999995 37.0 37.0 37.0 37.0 37.0 44-45 35.63225 37.0 37.0 37.0 37.0 37.0 46-47 35.7855 37.0 37.0 37.0 37.0 37.0 48-49 35.59525 37.0 37.0 37.0 37.0 37.0 50-51 35.63549999999999 37.0 37.0 37.0 37.0 37.0 52-53 35.58025 37.0 37.0 37.0 37.0 37.0 54-55 35.54774999999999 37.0 37.0 37.0 37.0 37.0 56-57 35.560249999999996 37.0 37.0 37.0 37.0 37.0 58-59 35.56575 37.0 37.0 37.0 37.0 37.0 60-61 35.627250000000004 37.0 37.0 37.0 37.0 37.0 62-63 35.64425 37.0 37.0 37.0 37.0 37.0 64-65 35.635000000000005 37.0 37.0 37.0 37.0 37.0 66-67 35.62 37.0 37.0 37.0 37.0 37.0 68-69 35.59075 37.0 37.0 37.0 37.0 37.0 70-71 35.613249999999994 37.0 37.0 37.0 37.0 37.0 72-73 35.49275 37.0 37.0 37.0 37.0 37.0 74-75 35.4285 37.0 37.0 37.0 37.0 37.0 76-77 35.3995 37.0 37.0 37.0 37.0 37.0 78-79 35.49625 37.0 37.0 37.0 37.0 37.0 80-81 35.4695 37.0 37.0 37.0 37.0 37.0 82-83 35.442499999999995 37.0 37.0 37.0 37.0 37.0 84-85 35.62775 37.0 37.0 37.0 37.0 37.0 86-87 35.4745 37.0 37.0 37.0 37.0 37.0 88-89 35.384096024006 37.0 37.0 37.0 37.0 37.0 90-91 35.44586146536634 37.0 37.0 37.0 37.0 37.0 92-93 35.42810702675669 37.0 37.0 37.0 37.0 37.0 94-95 35.418854713678414 37.0 37.0 37.0 37.0 37.0 96-97 35.37378423946708 37.0 37.0 37.0 37.0 37.0 98-99 35.33755386631448 37.0 37.0 37.0 37.0 37.0 100-101 35.37162073055643 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 3.0 25 7.0 26 22.0 27 23.0 28 36.0 29 41.0 30 61.0 31 92.0 32 119.0 33 173.0 34 256.0 35 482.0 36 2123.0 37 559.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.050000000000004 13.125 16.05 42.775 2 26.150000000000002 18.675 29.7 25.474999999999998 3 28.4 21.15 22.3 28.15 4 28.675 27.85 17.0 26.474999999999998 5 29.075 29.475 19.1 22.35 6 22.275 32.925 19.925 24.875 7 21.4 15.475 37.0 26.125 8 23.95 21.275 24.75 30.025000000000002 9 23.474999999999998 20.75 25.624999999999996 30.15 10-11 26.325 27.025 19.2375 27.4125 12-13 25.174999999999997 21.4 24.65 28.775000000000002 14-15 25.074999999999996 22.112499999999997 24.587500000000002 28.225 16-17 25.95 24.1625 22.7625 27.125 18-19 24.8 24.3 22.8625 28.037499999999998 20-21 26.0125 23.9375 22.225 27.825 22-23 25.25 23.2625 24.0625 27.425 24-25 25.650000000000002 23.3125 22.1875 28.849999999999998 26-27 25.35 24.5125 22.5875 27.55 28-29 26.2125 22.8375 23.4125 27.537499999999998 30-31 25.525 23.4125 23.625 27.437499999999996 32-33 25.5125 23.9 23.425 27.1625 34-35 26.05 23.95 22.8625 27.1375 36-37 26.487500000000004 23.724999999999998 22.575 27.212500000000002 38-39 26.575 23.175 22.537499999999998 27.712500000000002 40-41 27.1625 22.5125 22.8625 27.462500000000002 42-43 25.912499999999998 24.212500000000002 22.8375 27.037499999999998 44-45 26.35 24.1625 22.075 27.4125 46-47 25.7 23.849999999999998 23.1 27.35 48-49 25.0625 24.3625 22.6125 27.962500000000002 50-51 26.187500000000004 23.6625 23.962500000000002 26.187500000000004 52-53 26.075 23.05 22.7625 28.1125 54-55 25.75 22.4375 23.2875 28.525 56-57 26.924999999999997 22.662499999999998 23.0125 27.400000000000002 58-59 26.4625 22.537499999999998 22.6125 28.3875 60-61 26.9625 23.150000000000002 22.412499999999998 27.474999999999998 62-63 27.2625 22.662499999999998 22.3625 27.712500000000002 64-65 26.6 22.7 22.475 28.225 66-67 26.6125 23.3375 23.025000000000002 27.025 68-69 26.8625 22.7625 22.675 27.700000000000003 70-71 26.3 23.599999999999998 23.0625 27.037499999999998 72-73 26.450000000000003 23.45 22.650000000000002 27.450000000000003 74-75 27.487499999999997 22.9875 22.2125 27.3125 76-77 26.875 23.4375 22.037499999999998 27.650000000000002 78-79 26.2125 22.8875 22.7 28.199999999999996 80-81 27.0 23.425 22.8125 26.7625 82-83 26.737499999999997 23.8125 22.85 26.6 84-85 26.5375 23.2875 22.55 27.625 86-87 25.7625 23.0125 23.6375 27.5875 88-89 26.91922980745186 22.455613903475868 22.218054513628406 28.40710177544386 90-91 26.63165791447862 22.918229557389346 23.080770192548137 27.369342335583895 92-93 26.144036009002253 24.306076519129782 22.193048262065513 27.35683920980245 94-95 26.581645411352838 23.43085771442861 22.48062015503876 27.506876719179797 96-97 27.007755816862648 22.604453340005005 23.68026019514636 26.70753064798599 98-99 26.765375854214124 21.867881548974943 23.373829410275878 27.992913186535056 100-101 28.177641653905056 9.647779479326186 28.499234303215925 33.675344563552834 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 3.0 28 3.5 29 3.0 30 4.5 31 7.0 32 10.5 33 13.0 34 24.0 35 29.5 36 30.5 37 42.0 38 57.0 39 69.0 40 86.5 41 103.5 42 112.5 43 127.0 44 136.0 45 144.5 46 148.5 47 151.0 48 147.5 49 138.5 50 134.5 51 130.0 52 122.0 53 110.0 54 92.5 55 89.5 56 89.5 57 87.5 58 101.0 59 105.0 60 96.5 61 82.0 62 76.0 63 85.5 64 85.5 65 82.5 66 92.0 67 91.0 68 80.5 69 77.5 70 79.0 71 79.0 72 72.5 73 61.0 74 48.0 75 36.0 76 33.0 77 30.0 78 23.0 79 15.5 80 7.0 81 3.5 82 3.0 83 1.5 84 1.0 85 1.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 1.0 96 2.0 97 11.0 98 68.0 99 245.0 100 814.0 101 2858.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.0 #Duplication Level Percentage of deduplicated Percentage of total 1 91.92934782608695 84.575 2 7.5 13.8 3 0.5163043478260869 1.425 4 0.05434782608695652 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369665 spots for SRR21853416.sra Written 369665 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra Read 369652 spots for SRR21853416.sra Written 369652 spots for SRR21853416.sra SRR ids: ['SRR21853416.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ttv7f5tu SRR21853416.sra spots: 7393053 blocks: [[1, 369652], [369653, 739304], [739305, 1108956], [1108957, 1478608], [1478609, 1848260], [1848261, 2217912], [2217913, 2587564], [2587565, 2957216], [2957217, 3326868], [3326869, 3696520], [3696521, 4066172], [4066173, 4435824], [4435825, 4805476], [4805477, 5175128], [5175129, 5544780], [5544781, 5914432], [5914433, 6284084], [6284085, 6653736], [6653737, 7023388], [7023389, 7393053]] SRR21853416 file size 1988007 SRR21853416 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853416 SRR21853416_1.fastq Input file: SRR21853416_1.fastq trimmed: SRR21853416-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:16:35 2024 >> started Fri Dec 6 14:16:39 2024 >> done (3.740s) 7393053 reads processed; of these: 2 ( 0.00%) short reads filtered out after trimming by size control 4921 ( 0.07%) empty reads filtered out after trimming by size control 7388130 (99.93%) reads available; of these: 257 ( 0.00%) trimmed reads available after processing 7387873 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 4 0.00% 28 0 0.00% 29 2 0.00% 30 0 0.00% 31 0 0.00% 32 4 0.00% 33 10 0.00% 34 3 0.00% 35 14 0.00% 36 14 0.00% 37 18 0.00% 38 15 0.00% 39 10 0.00% 40 16 0.00% 41 17 0.00% 42 16 0.00% 43 21 0.00% 44 22 0.00% 45 8 0.00% 46 17 0.00% 47 20 0.00% 48 18 0.00% 49 20 0.00% 50 15 0.00% 51 21 0.00% 52 14 0.00% 53 23 0.00% 54 24 0.00% 55 28 0.00% 56 24 0.00% 57 16 0.00% 58 26 0.00% 59 30 0.00% 60 34 0.00% 61 21 0.00% 62 24 0.00% 63 25 0.00% 64 19 0.00% 65 32 0.00% 66 23 0.00% 67 28 0.00% 68 24 0.00% 69 30 0.00% 70 33 0.00% 71 27 0.00% 72 21 0.00% 73 26 0.00% 74 33 0.00% 75 29 0.00% 76 32 0.00% 77 38 0.00% 78 37 0.00% 79 38 0.00% 80 47 0.00% 81 38 0.00% 82 45 0.00% 83 50 0.00% 84 44 0.00% 85 44 0.00% 86 54 0.00% 87 49 0.00% 88 68 0.00% 89 73 0.00% 90 94 0.00% 91 251 0.00% 92 80 0.00% 93 153 0.00% 94 452 0.01% 95 1824 0.02% 96 9795 0.13% 97 31383 0.42% 98 124828 1.69% 99 483939 6.55% 100 1587112 21.48% 101 5146641 69.66% 7388130 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=24 prefix-density=0.33 prefix-fanout=1.8 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=282.34 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=24.5 sequence=CGCCGCCGCCGAGGAGGCCGGCCAG Started job on | Dec 06 14:16:54 Started mapping on | Dec 06 14:16:55 Finished on | Dec 06 14:17:06 Mapping speed, Million of reads per hour | 2417.93 Number of input reads | 7388130 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 6791419 Uniquely mapped reads % | 91.92% Average mapped length | 100.27 Number of splices: Total | 2103620 Number of splices: Annotated (sjdb) | 1987995 Number of splices: GT/AG | 2073873 Number of splices: GC/AG | 24732 Number of splices: AT/AC | 1120 Number of splices: Non-canonical | 3895 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.01% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 252436 % of reads mapped to multiple loci | 3.42% Number of reads mapped to too many loci | 220226 % of reads mapped to too many loci | 2.98% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.24% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 344275 344275 344275 N_multimapping 252436 252436 252436 N_noFeature 267907 3580530 3388426 N_ambiguous 105690 9098 6884 UnstrandedReadsAssigned:6417822 PositiveStrandReadsAssigned:3201791 NegativeStrandReadsAssigned:3396109 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853416 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853416-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,388,130 reads, 6,610,367 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 985 rounds 52973 SRR21853416.ke.tsv 35125 SRR21853416.se.tsv 88098 total ==> SRR21853416.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 3.94495 1.15832 PNS24247 1044 945 19.1469 4.97944 PNS24249 1928 1829 85.6143 11.5039 PNS24246 1044 945 19.1469 4.97944 PNS24248 1044 945 19.1469 4.97944 PNS24244 1471 1372 0 0 PNS24243 293 194 2 2.53362 KQK14069 1603 1504 5652.82 923.699 KQK14071 474 375 549.417 360.068 ==> SRR21853416.se.tsv <== BRADI_1g14170v3 6648 BRADI_1g53295v3 31 BRADI_1g59795v3 125 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 494 BRADI_1g74790v3 85 BRADI_1g09890v3 5 BRADI_1g77505v3 110 BRADI_1g48960v3 0 SRR21853416 completed mapping pipeline successfully