Starting /dee2/code/volunteer_pipeline.sh SRR21853417 current disk space = 1550590148608 free memory = 1598918580 SRR21853417 SRAfilesize 9645fc46f0ae46212d14569c9532e3f8 SRR21853417.sra SRR21853417.sra file validated SRR21853417 is single end SRR21853417 is conventional basespace SRR21853417 read1 length is 68-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853417_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.811 37.0 37.0 37.0 25.0 37.0 2 34.9845 37.0 37.0 37.0 25.0 37.0 3 35.479 37.0 37.0 37.0 37.0 37.0 4 35.573 37.0 37.0 37.0 37.0 37.0 5 35.74 37.0 37.0 37.0 37.0 37.0 6 35.658 37.0 37.0 37.0 37.0 37.0 7 35.537 37.0 37.0 37.0 37.0 37.0 8 35.8585 37.0 37.0 37.0 37.0 37.0 9 35.7195 37.0 37.0 37.0 37.0 37.0 10-11 35.832 37.0 37.0 37.0 37.0 37.0 12-13 35.797 37.0 37.0 37.0 37.0 37.0 14-15 35.634 37.0 37.0 37.0 37.0 37.0 16-17 35.8295 37.0 37.0 37.0 37.0 37.0 18-19 35.7625 37.0 37.0 37.0 37.0 37.0 20-21 35.68875 37.0 37.0 37.0 37.0 37.0 22-23 35.76675 37.0 37.0 37.0 37.0 37.0 24-25 35.71475 37.0 37.0 37.0 37.0 37.0 26-27 35.6295 37.0 37.0 37.0 37.0 37.0 28-29 35.504999999999995 37.0 37.0 37.0 37.0 37.0 30-31 35.37025 37.0 37.0 37.0 37.0 37.0 32-33 35.522000000000006 37.0 37.0 37.0 37.0 37.0 34-35 35.5525 37.0 37.0 37.0 37.0 37.0 36-37 35.5245 37.0 37.0 37.0 37.0 37.0 38-39 35.426249999999996 37.0 37.0 37.0 37.0 37.0 40-41 35.480000000000004 37.0 37.0 37.0 37.0 37.0 42-43 35.3795 37.0 37.0 37.0 37.0 37.0 44-45 35.3565 37.0 37.0 37.0 37.0 37.0 46-47 35.366 37.0 37.0 37.0 37.0 37.0 48-49 35.484750000000005 37.0 37.0 37.0 37.0 37.0 50-51 35.414500000000004 37.0 37.0 37.0 37.0 37.0 52-53 35.441 37.0 37.0 37.0 37.0 37.0 54-55 35.39775 37.0 37.0 37.0 37.0 37.0 56-57 35.3835 37.0 37.0 37.0 37.0 37.0 58-59 35.34 37.0 37.0 37.0 37.0 37.0 60-61 35.254 37.0 37.0 37.0 31.0 37.0 62-63 35.315 37.0 37.0 37.0 31.0 37.0 64-65 35.39425 37.0 37.0 37.0 37.0 37.0 66-67 35.241749999999996 37.0 37.0 37.0 31.0 37.0 68-69 35.22426806701675 37.0 37.0 37.0 31.0 37.0 70-71 35.22355588897224 37.0 37.0 37.0 31.0 37.0 72-73 35.101775443860966 37.0 37.0 37.0 25.0 37.0 74-75 35.23409028845506 37.0 37.0 37.0 25.0 37.0 76-77 35.19534767383692 37.0 37.0 37.0 31.0 37.0 78-79 35.19984992496248 37.0 37.0 37.0 31.0 37.0 80-81 35.2016008004002 37.0 37.0 37.0 25.0 37.0 82-83 35.182591295647825 37.0 37.0 37.0 31.0 37.0 84-85 35.028264132066035 37.0 37.0 37.0 25.0 37.0 86-87 35.2376188094047 37.0 37.0 37.0 31.0 37.0 88-89 35.23492619464598 37.0 37.0 37.0 31.0 37.0 90-91 35.131598699024266 37.0 37.0 37.0 31.0 37.0 92-93 35.15965965965966 37.0 37.0 37.0 25.0 37.0 94-95 35.02502502502503 37.0 37.0 37.0 25.0 37.0 96-97 35.191051612208916 37.0 37.0 37.0 31.0 37.0 98-99 35.07437215486076 37.0 37.0 37.0 25.0 37.0 100-101 35.16830625245274 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 3.0 24 6.0 25 12.0 26 18.0 27 18.0 28 40.0 29 65.0 30 85.0 31 121.0 32 128.0 33 210.0 34 291.0 35 583.0 36 2026.0 37 392.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.475 12.15 17.45 41.925000000000004 2 26.930843008581522 19.863705199394246 28.899545683997978 24.30590610802625 3 29.275000000000002 22.1 21.175 27.450000000000003 4 29.075 27.275 16.825000000000003 26.825 5 27.525 29.4 20.3 22.775000000000002 6 22.55 32.45 20.25 24.75 7 21.625 17.825 34.949999999999996 25.6 8 23.3 21.975 22.175 32.550000000000004 9 22.35 20.424999999999997 26.25 30.975 10-11 26.474999999999998 27.1375 19.325 27.0625 12-13 24.6875 21.8625 25.2875 28.1625 14-15 24.2625 22.8625 24.5 28.375 16-17 26.137500000000003 23.549999999999997 23.1375 27.175 18-19 25.6125 23.5375 22.95 27.900000000000002 20-21 25.4875 23.0875 23.8375 27.5875 22-23 25.525 24.0375 23.0125 27.425 24-25 25.35 24.212500000000002 23.0625 27.375 26-27 25.825 22.525000000000002 23.625 28.025 28-29 26.1625 23.974999999999998 23.3 26.5625 30-31 25.5625 23.825 23.4875 27.125 32-33 25.074999999999996 24.9 23.35 26.674999999999997 34-35 25.4625 23.2875 23.925 27.325 36-37 25.7375 23.425 23.6375 27.200000000000003 38-39 25.2375 23.974999999999998 23.2875 27.500000000000004 40-41 25.15 23.9 23.6375 27.3125 42-43 25.8125 24.175 23.025000000000002 26.987499999999997 44-45 25.974999999999998 23.0125 23.5875 27.425 46-47 25.974999999999998 23.25 22.8625 27.9125 48-49 26.437500000000004 23.6625 22.875 27.025 50-51 25.912499999999998 22.650000000000002 23.8875 27.55 52-53 26.687499999999996 22.787499999999998 23.2875 27.237499999999997 54-55 25.25 24.125 22.425 28.199999999999996 56-57 25.7375 23.0 23.525 27.737499999999997 58-59 26.575 23.549999999999997 22.95 26.924999999999997 60-61 26.337500000000002 23.599999999999998 23.225 26.8375 62-63 26.2875 22.1 23.025000000000002 28.5875 64-65 25.75 23.724999999999998 22.9375 27.5875 66-67 25.662499999999998 23.125 23.1375 28.075 68-69 26.8533566695837 23.47793474184273 22.852856607075882 26.815851981497683 70-71 26.019004751187797 22.99324831207802 22.605651412853213 28.382095523880967 72-73 26.481620405101275 23.78094523630908 23.243310827706924 26.494123530882717 74-75 26.19732399649869 23.48380642741028 23.121170438914593 27.19769913717644 76-77 26.013006503251624 23.88694347173587 22.811405702851424 27.288644322161083 78-79 26.17558779389695 23.6368184092046 23.224112056028016 26.96348174087044 80-81 26.563281640820406 23.1615807903952 22.773886943471737 27.501250625312657 82-83 26.93846923461731 23.3991995997999 22.448724362181093 27.213606803401703 84-85 26.32566283141571 23.66183091545773 22.436218109054526 27.576288144072038 86-87 26.375687843921963 23.13656828414207 22.886443221610804 27.60130065032516 88-89 26.632474355766828 23.117338003502628 22.804603452589443 27.445584188141105 90-91 26.632474355766828 23.229922441831373 23.079809857393045 27.057793345008758 92-93 26.526526526526528 23.46096096096096 21.946946946946948 28.065565565565564 94-95 26.33883883883884 23.536036036036037 22.985485485485484 27.13963963963964 96-97 27.241983967935873 23.321643286573146 22.357214428857716 27.07915831663327 98-99 26.218038417504136 22.363566976211676 23.101386592036636 28.317008014247552 100-101 28.965839962564345 10.185618468257681 27.76477928560287 33.083762283575105 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.5 24 1.5 25 0.5 26 1.0 27 2.5 28 3.5 29 3.5 30 5.0 31 9.5 32 12.0 33 14.0 34 25.0 35 30.5 36 25.5 37 37.5 38 56.5 39 72.0 40 92.5 41 114.5 42 122.0 43 137.0 44 153.5 45 152.0 46 151.5 47 137.0 48 134.0 49 139.5 50 131.0 51 128.5 52 134.5 53 115.5 54 96.0 55 93.5 56 97.0 57 97.5 58 86.5 59 84.0 60 83.0 61 83.0 62 82.0 63 85.5 64 95.0 65 88.0 66 84.0 67 84.0 68 77.5 69 73.5 70 65.5 71 63.0 72 63.0 73 58.5 74 49.0 75 44.0 76 35.5 77 24.0 78 20.0 79 17.0 80 11.0 81 6.0 82 4.5 83 2.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.95 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 1.0 88 0.0 89 0.0 90 0.0 91 1.0 92 0.0 93 0.0 94 0.0 95 1.0 96 6.0 97 27.0 98 63.0 99 264.0 100 859.0 101 2776.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.375 #Duplication Level Percentage of deduplicated Percentage of total 1 93.25301204819277 87.075 2 6.398929049531459 11.95 3 0.34805890227576974 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609521 spots for SRR21853417.sra Written 609521 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra Read 609503 spots for SRR21853417.sra Written 609503 spots for SRR21853417.sra SRR ids: ['SRR21853417.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qmvnsrh4 SRR21853417.sra spots: 12190078 blocks: [[1, 609503], [609504, 1219006], [1219007, 1828509], [1828510, 2438012], [2438013, 3047515], [3047516, 3657018], [3657019, 4266521], [4266522, 4876024], [4876025, 5485527], [5485528, 6095030], [6095031, 6704533], [6704534, 7314036], [7314037, 7923539], [7923540, 8533042], [8533043, 9142545], [9142546, 9752048], [9752049, 10361551], [10361552, 10971054], [10971055, 11580557], [11580558, 12190078]] SRR21853417 file size 3280373 SRR21853417 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853417 SRR21853417_1.fastq Input file: SRR21853417_1.fastq trimmed: SRR21853417-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:17:04 2024 >> started Fri Dec 6 14:17:10 2024 >> done (5.912s) 12190078 reads processed; of these: 11 ( 0.00%) short reads filtered out after trimming by size control 14783 ( 0.12%) empty reads filtered out after trimming by size control 12175284 (99.88%) reads available; of these: 330 ( 0.00%) trimmed reads available after processing 12174954 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 3 0.00% 24 2 0.00% 25 1 0.00% 26 7 0.00% 27 4 0.00% 28 3 0.00% 29 7 0.00% 30 3 0.00% 31 4 0.00% 32 3 0.00% 33 4 0.00% 34 4 0.00% 35 60 0.00% 36 60 0.00% 37 57 0.00% 38 70 0.00% 39 52 0.00% 40 68 0.00% 41 70 0.00% 42 59 0.00% 43 58 0.00% 44 72 0.00% 45 65 0.00% 46 94 0.00% 47 74 0.00% 48 86 0.00% 49 73 0.00% 50 91 0.00% 51 88 0.00% 52 81 0.00% 53 96 0.00% 54 91 0.00% 55 93 0.00% 56 89 0.00% 57 97 0.00% 58 117 0.00% 59 110 0.00% 60 112 0.00% 61 101 0.00% 62 91 0.00% 63 101 0.00% 64 111 0.00% 65 124 0.00% 66 134 0.00% 67 108 0.00% 68 121 0.00% 69 93 0.00% 70 108 0.00% 71 118 0.00% 72 116 0.00% 73 123 0.00% 74 130 0.00% 75 143 0.00% 76 138 0.00% 77 136 0.00% 78 125 0.00% 79 144 0.00% 80 162 0.00% 81 161 0.00% 82 148 0.00% 83 168 0.00% 84 175 0.00% 85 157 0.00% 86 184 0.00% 87 196 0.00% 88 207 0.00% 89 199 0.00% 90 288 0.00% 91 638 0.01% 92 276 0.00% 93 369 0.00% 94 848 0.01% 95 3015 0.02% 96 16475 0.14% 97 52002 0.43% 98 207038 1.70% 99 801841 6.59% 100 2629000 21.59% 101 8457340 69.46% 12175284 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=24 prefix-density=0.32 prefix-fanout=1.8 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=30 fanout-score=273.27 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=24.7 sequence=CGCCGCCGCCGAGGAGGCCGGCCAG Started job on | Dec 06 14:17:25 Started mapping on | Dec 06 14:17:25 Finished on | Dec 06 14:17:49 Mapping speed, Million of reads per hour | 1826.29 Number of input reads | 12175284 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 11186859 Uniquely mapped reads % | 91.88% Average mapped length | 100.24 Number of splices: Total | 3540536 Number of splices: Annotated (sjdb) | 3346259 Number of splices: GT/AG | 3488483 Number of splices: GC/AG | 42921 Number of splices: AT/AC | 1832 Number of splices: Non-canonical | 7300 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 425279 % of reads mapped to multiple loci | 3.49% Number of reads mapped to too many loci | 359611 % of reads mapped to too many loci | 2.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.25% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 563146 563146 563146 N_multimapping 425279 425279 425279 N_noFeature 448948 5868734 5617339 N_ambiguous 174749 14606 11552 UnstrandedReadsAssigned:10563162 PositiveStrandReadsAssigned:5303519 NegativeStrandReadsAssigned:5557968 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853417 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853417-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,175,284 reads, 10,887,949 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,012 rounds 52973 SRR21853417.ke.tsv 35125 SRR21853417.se.tsv 88098 total ==> SRR21853417.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 2.62745 0.467631 PNS24247 1044 945 29.0986 4.58706 PNS24249 1928 1829 141.893 11.5569 PNS24246 1044 945 29.0986 4.58706 PNS24248 1044 945 29.0986 4.58706 PNS24244 1471 1372 23.184 2.51727 PNS24243 293 194 4 3.07151 KQK14069 1603 1504 9555.29 946.434 KQK14071 474 375 883.109 350.814 ==> SRR21853417.se.tsv <== BRADI_1g14170v3 11083 BRADI_1g53295v3 49 BRADI_1g59795v3 261 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 880 BRADI_1g74790v3 127 BRADI_1g09890v3 8 BRADI_1g77505v3 178 BRADI_1g48960v3 0 SRR21853417 completed mapping pipeline successfully