Starting /dee2/code/volunteer_pipeline.sh SRR21853418 current disk space = 1550602076160 free memory = 1596195576 SRR21853418 SRAfilesize eb3ea9d381c7a4ece46e3b9546a060e2 SRR21853418.sra SRR21853418.sra file validated SRR21853418 is single end SRR21853418 is conventional basespace SRR21853418 read1 length is 96-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853418_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 96-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.4785 37.0 37.0 37.0 37.0 37.0 2 35.7125 37.0 37.0 37.0 37.0 37.0 3 35.8325 37.0 37.0 37.0 37.0 37.0 4 35.914 37.0 37.0 37.0 37.0 37.0 5 35.931 37.0 37.0 37.0 37.0 37.0 6 36.0505 37.0 37.0 37.0 37.0 37.0 7 35.9595 37.0 37.0 37.0 37.0 37.0 8 36.036 37.0 37.0 37.0 37.0 37.0 9 36.04 37.0 37.0 37.0 37.0 37.0 10-11 36.05625 37.0 37.0 37.0 37.0 37.0 12-13 36.01475000000001 37.0 37.0 37.0 37.0 37.0 14-15 35.976 37.0 37.0 37.0 37.0 37.0 16-17 35.8935 37.0 37.0 37.0 37.0 37.0 18-19 35.98225 37.0 37.0 37.0 37.0 37.0 20-21 36.006 37.0 37.0 37.0 37.0 37.0 22-23 35.919 37.0 37.0 37.0 37.0 37.0 24-25 35.97825 37.0 37.0 37.0 37.0 37.0 26-27 35.793499999999995 37.0 37.0 37.0 37.0 37.0 28-29 35.78675 37.0 37.0 37.0 37.0 37.0 30-31 35.8055 37.0 37.0 37.0 37.0 37.0 32-33 35.838499999999996 37.0 37.0 37.0 37.0 37.0 34-35 35.78475 37.0 37.0 37.0 37.0 37.0 36-37 35.83275 37.0 37.0 37.0 37.0 37.0 38-39 35.73425 37.0 37.0 37.0 37.0 37.0 40-41 35.782 37.0 37.0 37.0 37.0 37.0 42-43 35.7505 37.0 37.0 37.0 37.0 37.0 44-45 35.6605 37.0 37.0 37.0 37.0 37.0 46-47 35.747249999999994 37.0 37.0 37.0 37.0 37.0 48-49 35.6695 37.0 37.0 37.0 37.0 37.0 50-51 35.75 37.0 37.0 37.0 37.0 37.0 52-53 35.6575 37.0 37.0 37.0 37.0 37.0 54-55 35.76275 37.0 37.0 37.0 37.0 37.0 56-57 35.70925 37.0 37.0 37.0 37.0 37.0 58-59 35.64975 37.0 37.0 37.0 37.0 37.0 60-61 35.66275 37.0 37.0 37.0 37.0 37.0 62-63 35.796 37.0 37.0 37.0 37.0 37.0 64-65 35.6695 37.0 37.0 37.0 37.0 37.0 66-67 35.65625 37.0 37.0 37.0 37.0 37.0 68-69 35.77725 37.0 37.0 37.0 37.0 37.0 70-71 35.712999999999994 37.0 37.0 37.0 37.0 37.0 72-73 35.619 37.0 37.0 37.0 37.0 37.0 74-75 35.63975 37.0 37.0 37.0 37.0 37.0 76-77 35.61025 37.0 37.0 37.0 37.0 37.0 78-79 35.674499999999995 37.0 37.0 37.0 37.0 37.0 80-81 35.57325 37.0 37.0 37.0 37.0 37.0 82-83 35.55975 37.0 37.0 37.0 37.0 37.0 84-85 35.55275 37.0 37.0 37.0 37.0 37.0 86-87 35.53775 37.0 37.0 37.0 37.0 37.0 88-89 35.58825 37.0 37.0 37.0 37.0 37.0 90-91 35.64425 37.0 37.0 37.0 37.0 37.0 92-93 35.574749999999995 37.0 37.0 37.0 37.0 37.0 94-95 35.57125 37.0 37.0 37.0 37.0 37.0 96-97 35.55172779584689 37.0 37.0 37.0 37.0 37.0 98-99 35.47032850719336 37.0 37.0 37.0 37.0 37.0 100-101 35.445714905771325 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 2.0 26 12.0 27 17.0 28 37.0 29 42.0 30 63.0 31 85.0 32 120.0 33 173.0 34 212.0 35 471.0 36 2149.0 37 613.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.575 12.3 16.85 42.275 2 24.975 19.725 30.75 24.55 3 26.5 23.25 22.900000000000002 27.35 4 28.425 28.275 18.2 25.1 5 27.6 29.325000000000003 21.0 22.075 6 21.2 32.15 22.575 24.075 7 20.674999999999997 16.2 39.225 23.9 8 23.674999999999997 19.225 26.424999999999997 30.675 9 22.775000000000002 20.8 27.900000000000002 28.525 10-11 25.4 27.462500000000002 19.85 27.287499999999998 12-13 24.224999999999998 21.7 26.7125 27.3625 14-15 23.599999999999998 23.375 25.324999999999996 27.700000000000003 16-17 25.25 24.224999999999998 23.200000000000003 27.325 18-19 24.337500000000002 24.1125 24.2625 27.287499999999998 20-21 24.8125 23.549999999999997 24.1625 27.474999999999998 22-23 25.412499999999998 25.412499999999998 23.2875 25.887500000000003 24-25 24.6625 24.337500000000002 23.575 27.425 26-27 24.0375 24.8125 24.3 26.85 28-29 24.95 24.45 24.474999999999998 26.125 30-31 25.5 23.525 24.5125 26.4625 32-33 25.025 23.9375 24.1125 26.924999999999997 34-35 25.0125 24.8 23.5 26.687499999999996 36-37 24.7375 24.325 24.175 26.7625 38-39 26.400000000000002 23.1875 23.599999999999998 26.8125 40-41 25.074999999999996 24.375 23.599999999999998 26.950000000000003 42-43 24.2375 23.7375 24.675 27.35 44-45 25.174999999999997 24.3125 23.425 27.0875 46-47 24.212500000000002 24.8625 24.125 26.8 48-49 25.0125 23.0875 25.112499999999997 26.787499999999998 50-51 24.7 24.75 23.974999999999998 26.575 52-53 25.2875 24.275 24.0 26.437500000000004 54-55 26.187500000000004 23.7625 23.2375 26.8125 56-57 25.5625 24.275 24.1625 26.0 58-59 25.7125 24.1125 23.35 26.825 60-61 25.95 23.849999999999998 23.9875 26.2125 62-63 26.075 24.325 24.224999999999998 25.374999999999996 64-65 25.637500000000003 23.4625 24.05 26.85 66-67 26.1125 23.7125 24.3875 25.7875 68-69 25.8125 24.375 23.925 25.887500000000003 70-71 24.575 24.4125 24.45 26.5625 72-73 26.05 24.712500000000002 23.1 26.137500000000003 74-75 26.0125 24.1125 24.4 25.474999999999998 76-77 25.412499999999998 23.625 24.175 26.787499999999998 78-79 25.8625 24.349999999999998 23.925 25.8625 80-81 25.825 23.825 24.6625 25.687500000000004 82-83 25.05 24.087500000000002 23.875 26.987499999999997 84-85 26.4625 23.724999999999998 23.075000000000003 26.737499999999997 86-87 25.374999999999996 24.05 24.15 26.424999999999997 88-89 24.975 24.2375 24.6875 26.1 90-91 25.374999999999996 24.2875 23.9875 26.35 92-93 25.412499999999998 23.6125 23.9375 27.037499999999998 94-95 26.450000000000003 24.1375 23.599999999999998 25.8125 96-97 25.909716143553833 23.67137676628736 23.658872077028885 26.760035013129922 98-99 25.085649029311003 23.131582286511865 24.933384088313666 26.84938459586347 100-101 26.052919993737277 10.912791607953656 29.12165335838422 33.91263503992485 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 4.0 28 4.5 29 4.5 30 5.0 31 4.5 32 7.0 33 11.5 34 18.5 35 27.0 36 34.0 37 46.5 38 62.5 39 77.5 40 94.0 41 102.0 42 111.5 43 129.0 44 141.5 45 153.0 46 154.0 47 157.5 48 171.5 49 169.0 50 173.5 51 161.0 52 131.0 53 147.0 54 159.5 55 146.0 56 135.5 57 124.5 58 111.0 59 97.0 60 83.0 61 82.5 62 89.0 63 75.0 64 63.0 65 55.5 66 57.5 67 63.0 68 60.5 69 50.5 70 43.0 71 44.0 72 38.5 73 33.0 74 24.5 75 17.0 76 16.0 77 13.5 78 8.5 79 4.0 80 2.0 81 2.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 96 3.0 97 23.0 98 67.0 99 267.0 100 893.0 101 2747.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.45 #Duplication Level Percentage of deduplicated Percentage of total 1 90.54726368159204 81.89999999999999 2 8.568269762299613 15.5 3 0.7462686567164178 2.025 4 0.08291873963515754 0.3 5 0.027639579878385848 0.125 6 0.027639579878385848 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA 6 0.15 No Hit GCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAGTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326445 spots for SRR21853418.sra Written 326445 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra Read 326436 spots for SRR21853418.sra Written 326436 spots for SRR21853418.sra SRR ids: ['SRR21853418.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_efzw5v6c SRR21853418.sra spots: 6528729 blocks: [[1, 326436], [326437, 652872], [652873, 979308], [979309, 1305744], [1305745, 1632180], [1632181, 1958616], [1958617, 2285052], [2285053, 2611488], [2611489, 2937924], [2937925, 3264360], [3264361, 3590796], [3590797, 3917232], [3917233, 4243668], [4243669, 4570104], [4570105, 4896540], [4896541, 5222976], [5222977, 5549412], [5549413, 5875848], [5875849, 6202284], [6202285, 6528729]] SRR21853418 file size 1755267 SRR21853418 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853418 SRR21853418_1.fastq Input file: SRR21853418_1.fastq trimmed: SRR21853418-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:17:42 2024 >> started Fri Dec 6 14:17:46 2024 >> done (4.271s) 6528729 reads processed; of these: 1 ( 0.00%) short reads filtered out after trimming by size control 1822 ( 0.03%) empty reads filtered out after trimming by size control 6526906 (99.97%) reads available; of these: 179 ( 0.00%) trimmed reads available after processing 6526727 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 24 1 0.00% 25 0 0.00% 26 2 0.00% 27 2 0.00% 28 0 0.00% 29 2 0.00% 30 1 0.00% 31 4 0.00% 32 2 0.00% 33 4 0.00% 34 2 0.00% 35 13 0.00% 36 13 0.00% 37 11 0.00% 38 16 0.00% 39 7 0.00% 40 10 0.00% 41 10 0.00% 42 14 0.00% 43 13 0.00% 44 12 0.00% 45 6 0.00% 46 13 0.00% 47 11 0.00% 48 17 0.00% 49 10 0.00% 50 13 0.00% 51 12 0.00% 52 20 0.00% 53 14 0.00% 54 18 0.00% 55 22 0.00% 56 18 0.00% 57 23 0.00% 58 19 0.00% 59 15 0.00% 60 17 0.00% 61 27 0.00% 62 16 0.00% 63 20 0.00% 64 18 0.00% 65 16 0.00% 66 24 0.00% 67 27 0.00% 68 22 0.00% 69 19 0.00% 70 31 0.00% 71 23 0.00% 72 30 0.00% 73 26 0.00% 74 31 0.00% 75 27 0.00% 76 28 0.00% 77 25 0.00% 78 27 0.00% 79 41 0.00% 80 39 0.00% 81 29 0.00% 82 17 0.00% 83 39 0.00% 84 40 0.00% 85 51 0.00% 86 34 0.00% 87 50 0.00% 88 63 0.00% 89 75 0.00% 90 82 0.00% 91 619 0.01% 92 176 0.00% 93 216 0.00% 94 335 0.01% 95 1287 0.02% 96 7746 0.12% 97 29986 0.46% 98 109911 1.68% 99 434868 6.66% 100 1473899 22.58% 101 4466479 68.43% 6526906 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=18 prefix-density=0.68 prefix-fanout=2.1 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=5.48 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=1.8 sequence=CATCCGACCCGTCTTGAAACACGGACCAAGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGGAAGCTGACGAGCGGGAGGCCCTCACGGGCCGCACCGCTGGCCGACCCTGATCTTCTGTGAAGGGTTCGAGTTGGAGCACGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAA Started job on | Dec 06 14:18:00 Started mapping on | Dec 06 14:18:00 Finished on | Dec 06 14:18:13 Mapping speed, Million of reads per hour | 1807.45 Number of input reads | 6526906 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 4784497 Uniquely mapped reads % | 73.30% Average mapped length | 100.26 Number of splices: Total | 1660877 Number of splices: Annotated (sjdb) | 1571611 Number of splices: GT/AG | 1636934 Number of splices: GC/AG | 20224 Number of splices: AT/AC | 912 Number of splices: Non-canonical | 2807 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 2.20 Insertion rate per base | 0.01% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 751565 % of reads mapped to multiple loci | 11.51% Number of reads mapped to too many loci | 820661 % of reads mapped to too many loci | 12.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.96% % of reads unmapped: other | 1.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 990844 990844 990844 N_multimapping 751565 751565 751565 N_noFeature 277390 2535034 2462289 N_ambiguous 74301 4910 5379 UnstrandedReadsAssigned:4432806 PositiveStrandReadsAssigned:2244553 NegativeStrandReadsAssigned:2316829 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853418 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853418-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,526,906 reads, 4,793,672 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52973 SRR21853418.ke.tsv 35125 SRR21853418.se.tsv 88098 total ==> SRR21853418.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 27.5975 11.0349 PNS24247 1044 945 10.4856 3.71351 PNS24249 1928 1829 38.8963 7.11734 PNS24246 1044 945 10.4856 3.71351 PNS24248 1044 945 10.4856 3.71351 PNS24244 1471 1372 11.0495 2.69532 PNS24243 293 194 3 5.17538 KQK14069 1603 1504 2634.96 586.34 KQK14071 474 375 322.477 287.8 ==> SRR21853418.se.tsv <== BRADI_1g14170v3 3213 BRADI_1g53295v3 32 BRADI_1g59795v3 102 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 496 BRADI_1g74790v3 38 BRADI_1g09890v3 2 BRADI_1g77505v3 77 BRADI_1g48960v3 0 SRR21853418 completed mapping pipeline successfully