Starting /dee2/code/volunteer_pipeline.sh SRR21853419 current disk space = 1550596702208 free memory = 1324015900 SRR21853419 SRAfilesize 33930b05834f391a049921da44b9e4f5 SRR21853419.sra SRR21853419.sra file validated SRR21853419 is single end SRR21853419 is conventional basespace SRR21853419 read1 length is 93-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853419_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 93-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.042 37.0 37.0 37.0 25.0 37.0 2 34.839 37.0 37.0 37.0 25.0 37.0 3 35.3035 37.0 37.0 37.0 25.0 37.0 4 35.414 37.0 37.0 37.0 37.0 37.0 5 35.646 37.0 37.0 37.0 37.0 37.0 6 35.5985 37.0 37.0 37.0 37.0 37.0 7 35.4825 37.0 37.0 37.0 37.0 37.0 8 35.538 37.0 37.0 37.0 37.0 37.0 9 35.618 37.0 37.0 37.0 37.0 37.0 10-11 35.805499999999995 37.0 37.0 37.0 37.0 37.0 12-13 35.7565 37.0 37.0 37.0 37.0 37.0 14-15 35.716 37.0 37.0 37.0 37.0 37.0 16-17 35.668499999999995 37.0 37.0 37.0 37.0 37.0 18-19 35.71275 37.0 37.0 37.0 37.0 37.0 20-21 35.62975 37.0 37.0 37.0 37.0 37.0 22-23 35.64275000000001 37.0 37.0 37.0 37.0 37.0 24-25 35.6445 37.0 37.0 37.0 37.0 37.0 26-27 35.50175 37.0 37.0 37.0 37.0 37.0 28-29 35.488 37.0 37.0 37.0 37.0 37.0 30-31 35.498 37.0 37.0 37.0 37.0 37.0 32-33 35.43425 37.0 37.0 37.0 37.0 37.0 34-35 35.44125 37.0 37.0 37.0 37.0 37.0 36-37 35.34425 37.0 37.0 37.0 37.0 37.0 38-39 35.3565 37.0 37.0 37.0 37.0 37.0 40-41 35.2615 37.0 37.0 37.0 37.0 37.0 42-43 35.40575 37.0 37.0 37.0 37.0 37.0 44-45 35.444 37.0 37.0 37.0 37.0 37.0 46-47 35.36625 37.0 37.0 37.0 31.0 37.0 48-49 35.39125 37.0 37.0 37.0 31.0 37.0 50-51 35.30375 37.0 37.0 37.0 37.0 37.0 52-53 35.437749999999994 37.0 37.0 37.0 37.0 37.0 54-55 35.424 37.0 37.0 37.0 31.0 37.0 56-57 35.37325 37.0 37.0 37.0 31.0 37.0 58-59 35.343 37.0 37.0 37.0 37.0 37.0 60-61 35.3745 37.0 37.0 37.0 37.0 37.0 62-63 35.31325 37.0 37.0 37.0 37.0 37.0 64-65 35.333 37.0 37.0 37.0 31.0 37.0 66-67 35.2475 37.0 37.0 37.0 31.0 37.0 68-69 35.3555 37.0 37.0 37.0 37.0 37.0 70-71 35.23425 37.0 37.0 37.0 25.0 37.0 72-73 35.19825 37.0 37.0 37.0 25.0 37.0 74-75 35.19 37.0 37.0 37.0 25.0 37.0 76-77 35.19825 37.0 37.0 37.0 25.0 37.0 78-79 35.20575 37.0 37.0 37.0 25.0 37.0 80-81 35.19475 37.0 37.0 37.0 25.0 37.0 82-83 35.23225 37.0 37.0 37.0 31.0 37.0 84-85 35.18375 37.0 37.0 37.0 31.0 37.0 86-87 35.14175 37.0 37.0 37.0 25.0 37.0 88-89 35.12875 37.0 37.0 37.0 25.0 37.0 90-91 35.109 37.0 37.0 37.0 25.0 37.0 92-93 35.111000000000004 37.0 37.0 37.0 25.0 37.0 94-95 34.99174793698425 37.0 37.0 37.0 25.0 37.0 96-97 35.06257259803672 37.0 37.0 37.0 25.0 37.0 98-99 35.02775104187514 37.0 37.0 37.0 25.0 37.0 100-101 35.13927305052032 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 3.0 24 4.0 25 15.0 26 14.0 27 34.0 28 54.0 29 57.0 30 82.0 31 87.0 32 152.0 33 223.0 34 299.0 35 565.0 36 2076.0 37 334.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.625 13.325000000000001 17.775 41.275 2 25.088607594936708 18.88607594936709 30.683544303797465 25.341772151898734 3 27.250000000000004 24.25 21.925 26.575 4 27.725 28.875 18.0 25.4 5 27.875 30.85 19.35 21.925 6 21.75 33.425 20.75 24.075 7 19.875 15.625 38.2 26.3 8 23.125 22.25 24.275 30.349999999999998 9 22.325 19.725 28.675 29.275000000000002 10-11 24.962500000000002 27.125 20.8625 27.05 12-13 25.45 22.162499999999998 25.124999999999996 27.2625 14-15 24.55 23.95 24.4125 27.0875 16-17 25.837500000000002 24.4 23.9375 25.825 18-19 24.712500000000002 24.55 24.5375 26.200000000000003 20-21 25.337500000000002 24.325 23.8375 26.5 22-23 25.374999999999996 24.224999999999998 24.1375 26.2625 24-25 25.35 24.325 24.3125 26.0125 26-27 23.7875 23.9875 24.6125 27.6125 28-29 24.762500000000003 24.2875 24.1625 26.787499999999998 30-31 24.9125 24.075 24.099999999999998 26.9125 32-33 24.1125 25.8 23.474999999999998 26.6125 34-35 24.712500000000002 24.425 23.575 27.287499999999998 36-37 24.825 23.5875 24.5125 27.075 38-39 25.4625 23.875 23.9 26.7625 40-41 25.8125 24.2875 24.2625 25.637500000000003 42-43 25.25 25.5125 23.925 25.3125 44-45 25.0 25.0625 23.8875 26.05 46-47 25.5625 24.9375 23.0375 26.4625 48-49 24.9375 25.0 24.4125 25.650000000000002 50-51 25.324999999999996 24.85 23.7875 26.0375 52-53 25.8 23.7125 23.8125 26.674999999999997 54-55 25.7125 24.3875 23.849999999999998 26.05 56-57 25.25 25.4375 23.8375 25.474999999999998 58-59 25.874999999999996 24.2 24.0 25.924999999999997 60-61 25.05 23.5125 25.087500000000002 26.35 62-63 25.2125 25.275 24.05 25.4625 64-65 25.637500000000003 24.474999999999998 23.9875 25.900000000000002 66-67 25.5375 24.175 23.775 26.5125 68-69 25.15 24.925 23.7625 26.1625 70-71 26.400000000000002 23.775 23.175 26.650000000000002 72-73 26.6 24.7 23.25 25.45 74-75 25.324999999999996 23.35 24.4375 26.887499999999996 76-77 26.2875 23.849999999999998 24.075 25.7875 78-79 25.174999999999997 24.875 23.45 26.5 80-81 25.174999999999997 23.962500000000002 24.525 26.337500000000002 82-83 26.3625 23.7625 22.9375 26.937499999999996 84-85 26.1125 24.8 23.525 25.5625 86-87 25.4 23.799999999999997 23.95 26.85 88-89 25.374999999999996 23.7375 24.525 26.3625 90-91 25.674999999999997 25.1 23.3125 25.912499999999998 92-93 25.474999999999998 23.8625 24.762500000000003 25.900000000000002 94-95 25.868967241810452 23.0432608152038 24.356089022255563 26.731682920730183 96-97 25.885592689948677 23.056702966579046 24.483665039429216 26.57403930404306 98-99 25.354969574036513 23.884381338742394 24.505578093306287 26.25507099391481 100-101 26.140625 11.375 30.234375000000004 32.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 0.5 27 2.0 28 4.5 29 3.0 30 4.5 31 6.5 32 10.5 33 13.0 34 16.5 35 28.5 36 40.0 37 52.0 38 61.0 39 75.5 40 91.0 41 105.0 42 117.5 43 127.5 44 145.5 45 163.5 46 171.0 47 155.0 48 154.0 49 171.0 50 160.5 51 138.5 52 130.0 53 139.5 54 143.5 55 135.5 56 148.0 57 155.5 58 128.5 59 106.0 60 89.0 61 74.5 62 79.5 63 83.0 64 71.5 65 58.5 66 51.5 67 49.0 68 53.5 69 48.5 70 44.0 71 46.0 72 38.5 73 27.0 74 19.0 75 15.0 76 10.0 77 10.5 78 11.5 79 7.5 80 3.0 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 93 1.0 94 0.0 95 0.0 96 9.0 97 19.0 98 54.0 99 260.0 100 914.0 101 2743.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.65526675786595 83.75 2 7.387140902872777 13.5 3 0.8481532147742818 2.325 4 0.08207934336525308 0.3 5 0.027359781121751026 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATTCTTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra Read 650265 spots for SRR21853419.sra Written 650265 spots for SRR21853419.sra Read 650261 spots for SRR21853419.sra Written 650261 spots for SRR21853419.sra SRR ids: ['SRR21853419.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__s3_xe1v SRR21853419.sra spots: 13005224 blocks: [[1, 650261], [650262, 1300522], [1300523, 1950783], [1950784, 2601044], [2601045, 3251305], [3251306, 3901566], [3901567, 4551827], [4551828, 5202088], [5202089, 5852349], [5852350, 6502610], [6502611, 7152871], [7152872, 7803132], [7803133, 8453393], [8453394, 9103654], [9103655, 9753915], [9753916, 10404176], [10404177, 11054437], [11054438, 11704698], [11704699, 12354959], [12354960, 13005224]] SRR21853419 file size 3500256 SRR21853419 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853419 SRR21853419_1.fastq Input file: SRR21853419_1.fastq trimmed: SRR21853419-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:18:41 2024 >> started Fri Dec 6 14:18:50 2024 >> done (8.378s) 13005224 reads processed; of these: 17 ( 0.00%) short reads filtered out after trimming by size control 5767 ( 0.04%) empty reads filtered out after trimming by size control 12999440 (99.96%) reads available; of these: 237 ( 0.00%) trimmed reads available after processing 12999203 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 1 0.00% 23 1 0.00% 24 2 0.00% 25 0 0.00% 26 5 0.00% 27 0 0.00% 28 4 0.00% 29 1 0.00% 30 2 0.00% 31 4 0.00% 32 2 0.00% 33 2 0.00% 34 4 0.00% 35 57 0.00% 36 48 0.00% 37 64 0.00% 38 40 0.00% 39 47 0.00% 40 52 0.00% 41 49 0.00% 42 61 0.00% 43 43 0.00% 44 58 0.00% 45 49 0.00% 46 65 0.00% 47 52 0.00% 48 59 0.00% 49 66 0.00% 50 54 0.00% 51 58 0.00% 52 65 0.00% 53 77 0.00% 54 89 0.00% 55 84 0.00% 56 73 0.00% 57 74 0.00% 58 66 0.00% 59 98 0.00% 60 63 0.00% 61 72 0.00% 62 86 0.00% 63 121 0.00% 64 97 0.00% 65 110 0.00% 66 102 0.00% 67 100 0.00% 68 83 0.00% 69 72 0.00% 70 99 0.00% 71 124 0.00% 72 117 0.00% 73 93 0.00% 74 102 0.00% 75 107 0.00% 76 137 0.00% 77 125 0.00% 78 120 0.00% 79 164 0.00% 80 162 0.00% 81 164 0.00% 82 161 0.00% 83 161 0.00% 84 157 0.00% 85 191 0.00% 86 204 0.00% 87 197 0.00% 88 194 0.00% 89 216 0.00% 90 259 0.00% 91 1487 0.01% 92 469 0.00% 93 561 0.00% 94 718 0.01% 95 2608 0.02% 96 15048 0.12% 97 59136 0.45% 98 220566 1.70% 99 869658 6.69% 100 2934624 22.58% 101 8888822 68.38% 12999440 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=16 prefix-density=0.68 prefix-fanout=2.1 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=25 fanout-score=4.82 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=2.0 sequence=GCCAGAGGAAAAGAAAGCAAAAGCGATTCCCGTAGTAGCGGCGAGCGAAATGGGAGCAGCCTAAACCGTGAAAACGGGGTTGTGGGAGAGCAATACAAGCGTTGTGCTGCTAGGCGAAGCGGTTGAGTGCCGCACCCTAGATGGCTAAAGTCCAGTAGCCGAAAGCATCACTAGCTTACGCTCTGACCCGAGTAGCATGGGGCACGTGGAATCCCGTGTGAATCAGCAAGGACCACCTTGCAAGGCTAAATACTCCTGGGTGACCGATAGCGAAGTAGTACCGTGAGGGAAAGGTGAAAAGAACCCCCAGTGGGTAGTGAAATAGAACGTGAAACCGTGCTGAGCTCCCAAGCAGTGGGAGGGGAAAGTGATCTCTGACCGCGTGCCTGTTGAAGAATGAGCCGGCGACTCATAGGCAGTGGCTTGGTTAAGGGAACGGAACCCACCGGAGCCGTAGCGAAAGCGAGTCTTCATAGGGCGATTGTCACTGCTTATGGACCCGAACCTGGGT Started job on | Dec 06 14:19:12 Started mapping on | Dec 06 14:19:12 Finished on | Dec 06 14:19:34 Mapping speed, Million of reads per hour | 2127.18 Number of input reads | 12999440 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 9485835 Uniquely mapped reads % | 72.97% Average mapped length | 100.22 Number of splices: Total | 3302392 Number of splices: Annotated (sjdb) | 3125647 Number of splices: GT/AG | 3254543 Number of splices: GC/AG | 40055 Number of splices: AT/AC | 1848 Number of splices: Non-canonical | 5946 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.20 Insertion rate per base | 0.01% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1526587 % of reads mapped to multiple loci | 11.74% Number of reads mapped to too many loci | 1615668 % of reads mapped to too many loci | 12.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.13% % of reads unmapped: other | 1.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1987018 1987018 1987018 N_multimapping 1526587 1526587 1526587 N_noFeature 550706 5008452 4901372 N_ambiguous 146449 9816 10979 UnstrandedReadsAssigned:8788680 PositiveStrandReadsAssigned:4467567 NegativeStrandReadsAssigned:4573484 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853419 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853419-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,999,440 reads, 9,508,844 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52973 SRR21853419.ke.tsv 35125 SRR21853419.se.tsv 88098 total ==> SRR21853419.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 37.5472 6.66582 PNS24249 1928 1829 76.6519 7.031 PNS24246 1044 945 37.5472 6.66582 PNS24248 1044 945 37.5472 6.66582 PNS24244 1471 1372 9.70657 1.18692 PNS24243 293 194 4 3.45913 KQK14069 1603 1504 5212.32 581.422 KQK14071 474 375 717.57 321.027 ==> SRR21853419.se.tsv <== BRADI_1g14170v3 6612 BRADI_1g53295v3 47 BRADI_1g59795v3 202 BRADI_1g07683v3 0 BRADI_1g00485v3 51 BRADI_1g20270v3 884 BRADI_1g74790v3 73 BRADI_1g09890v3 4 BRADI_1g77505v3 157 BRADI_1g48960v3 2 SRR21853419 completed mapping pipeline successfully