Starting /dee2/code/volunteer_pipeline.sh SRR21853420 current disk space = 1550584074240 free memory = 1599863600 SRR21853420 SRAfilesize 7d786c56486f4af5c5f55b72d2f33c56 SRR21853420.sra SRR21853420.sra file validated SRR21853420 is single end SRR21853420 is conventional basespace SRR21853420 read1 length is 77-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853420_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 77-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.4285 37.0 37.0 37.0 37.0 37.0 2 35.64 37.0 37.0 37.0 37.0 37.0 3 35.92 37.0 37.0 37.0 37.0 37.0 4 35.965 37.0 37.0 37.0 37.0 37.0 5 35.9315 37.0 37.0 37.0 37.0 37.0 6 36.058 37.0 37.0 37.0 37.0 37.0 7 35.9485 37.0 37.0 37.0 37.0 37.0 8 35.9595 37.0 37.0 37.0 37.0 37.0 9 35.8545 37.0 37.0 37.0 37.0 37.0 10-11 35.95525 37.0 37.0 37.0 37.0 37.0 12-13 36.0045 37.0 37.0 37.0 37.0 37.0 14-15 35.907250000000005 37.0 37.0 37.0 37.0 37.0 16-17 35.884249999999994 37.0 37.0 37.0 37.0 37.0 18-19 35.918 37.0 37.0 37.0 37.0 37.0 20-21 35.827749999999995 37.0 37.0 37.0 37.0 37.0 22-23 35.83825 37.0 37.0 37.0 37.0 37.0 24-25 35.843999999999994 37.0 37.0 37.0 37.0 37.0 26-27 35.8545 37.0 37.0 37.0 37.0 37.0 28-29 35.707499999999996 37.0 37.0 37.0 37.0 37.0 30-31 35.7535 37.0 37.0 37.0 37.0 37.0 32-33 35.7595 37.0 37.0 37.0 37.0 37.0 34-35 35.700500000000005 37.0 37.0 37.0 37.0 37.0 36-37 35.65925 37.0 37.0 37.0 37.0 37.0 38-39 35.7015 37.0 37.0 37.0 37.0 37.0 40-41 35.763000000000005 37.0 37.0 37.0 37.0 37.0 42-43 35.706 37.0 37.0 37.0 37.0 37.0 44-45 35.5565 37.0 37.0 37.0 37.0 37.0 46-47 35.733999999999995 37.0 37.0 37.0 37.0 37.0 48-49 35.48925 37.0 37.0 37.0 37.0 37.0 50-51 35.6525 37.0 37.0 37.0 37.0 37.0 52-53 35.66225 37.0 37.0 37.0 37.0 37.0 54-55 35.55825 37.0 37.0 37.0 37.0 37.0 56-57 35.64575000000001 37.0 37.0 37.0 37.0 37.0 58-59 35.552499999999995 37.0 37.0 37.0 37.0 37.0 60-61 35.6025 37.0 37.0 37.0 37.0 37.0 62-63 35.73224999999999 37.0 37.0 37.0 37.0 37.0 64-65 35.5525 37.0 37.0 37.0 37.0 37.0 66-67 35.647999999999996 37.0 37.0 37.0 37.0 37.0 68-69 35.553250000000006 37.0 37.0 37.0 37.0 37.0 70-71 35.563500000000005 37.0 37.0 37.0 37.0 37.0 72-73 35.49225 37.0 37.0 37.0 37.0 37.0 74-75 35.56225 37.0 37.0 37.0 37.0 37.0 76-77 35.552 37.0 37.0 37.0 37.0 37.0 78-79 35.644661165291325 37.0 37.0 37.0 37.0 37.0 80-81 35.47936984246061 37.0 37.0 37.0 37.0 37.0 82-83 35.534633658414606 37.0 37.0 37.0 37.0 37.0 84-85 35.5406351587897 37.0 37.0 37.0 37.0 37.0 86-87 35.459614903725935 37.0 37.0 37.0 37.0 37.0 88-89 35.39234808702176 37.0 37.0 37.0 37.0 37.0 90-91 35.49399699849925 37.0 37.0 37.0 37.0 37.0 92-93 35.47348674337169 37.0 37.0 37.0 37.0 37.0 94-95 35.458479239619805 37.0 37.0 37.0 37.0 37.0 96-97 35.475724064637966 37.0 37.0 37.0 37.0 37.0 98-99 35.318392985475555 37.0 37.0 37.0 37.0 37.0 100-101 35.211832453780026 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 2.0 24 4.0 25 7.0 26 9.0 27 24.0 28 29.0 29 55.0 30 63.0 31 106.0 32 130.0 33 158.0 34 225.0 35 461.0 36 2197.0 37 528.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.775000000000002 13.525 17.325 40.375 2 25.5 19.5 31.924999999999997 23.075000000000003 3 25.525 23.625 24.725 26.125 4 25.974999999999998 30.275000000000002 19.7 24.05 5 26.974999999999998 31.0 21.825 20.200000000000003 6 21.45 32.65 21.875 24.025 7 19.900000000000002 17.925 37.925 24.25 8 21.425 23.075000000000003 25.6 29.9 9 20.9 23.025000000000002 28.975 27.1 10-11 25.45 28.6875 21.075 24.7875 12-13 23.025000000000002 23.4625 27.075 26.437500000000004 14-15 22.900000000000002 25.374999999999996 25.724999999999998 26.0 16-17 23.65 25.624999999999996 25.162499999999998 25.5625 18-19 23.8625 25.224999999999998 25.4375 25.474999999999998 20-21 23.0 26.7625 25.224999999999998 25.0125 22-23 23.9125 26.0 25.1 24.9875 24-25 24.099999999999998 25.900000000000002 25.0375 24.962500000000002 26-27 22.162499999999998 26.237500000000004 26.4125 25.1875 28-29 24.4 26.337500000000002 24.9375 24.325 30-31 22.05 26.575 25.412499999999998 25.9625 32-33 24.2625 26.0125 25.2625 24.462500000000002 34-35 23.7375 25.4 25.775 25.087500000000002 36-37 23.150000000000002 26.85 25.137500000000003 24.8625 38-39 23.825 25.887500000000003 25.124999999999996 25.162499999999998 40-41 24.0625 26.875 24.637500000000003 24.425 42-43 23.75 26.3125 25.525 24.4125 44-45 24.275 26.424999999999997 25.2125 24.087500000000002 46-47 24.887500000000003 25.9875 24.55 24.575 48-49 23.6875 26.075 25.162499999999998 25.074999999999996 50-51 23.6375 25.4625 25.074999999999996 25.825 52-53 23.925 25.912499999999998 24.6625 25.5 54-55 23.849999999999998 25.4 26.337500000000002 24.4125 56-57 24.837500000000002 25.687500000000004 25.2375 24.2375 58-59 24.6875 25.0375 26.0625 24.212500000000002 60-61 23.6625 25.3 25.55 25.4875 62-63 24.474999999999998 25.362499999999997 25.7375 24.425 64-65 23.9375 26.174999999999997 25.0125 24.875 66-67 24.4 25.1875 25.8625 24.55 68-69 24.4875 24.4125 26.7125 24.3875 70-71 24.625 26.0 25.0625 24.3125 72-73 24.1375 26.1 24.75 25.0125 74-75 24.337500000000002 26.450000000000003 25.25 23.962500000000002 76-77 24.1875 25.2125 25.2375 25.362499999999997 78-79 23.843460865216304 26.25656414103526 25.156289072268066 24.74368592148037 80-81 23.918479619904975 26.469117279319832 24.868717179294826 24.74368592148037 82-83 24.243560890222557 26.081520380095025 25.018754688672168 24.656164041010253 84-85 23.3183295823956 26.131532883220803 25.681420355088775 24.868717179294826 86-87 23.843460865216304 25.70642660665166 25.23130782695674 25.218804701175294 88-89 23.868467116779193 26.269067266816705 25.381345336334082 24.48112028007002 90-91 24.637318659329665 24.79989994997499 25.22511255627814 25.337668834417208 92-93 25.07503751875938 25.48774387193597 25.125062531265634 24.312156078039017 94-95 24.58729364682341 25.65032516258129 24.72486243121561 25.03751875937969 96-97 23.66116116116116 25.425425425425423 26.076076076076077 24.83733733733734 98-99 23.887051640803865 23.89977105062325 26.97786822691427 25.235309081658613 100-101 24.623434279372127 11.35246551450769 32.78896464246076 31.235135563659426 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 1.5 27 1.0 28 3.5 29 6.5 30 11.5 31 15.5 32 16.5 33 22.5 34 31.0 35 45.5 36 63.0 37 78.0 38 84.5 39 102.5 40 132.5 41 158.5 42 185.5 43 193.5 44 205.0 45 212.5 46 201.5 47 186.5 48 181.5 49 179.5 50 165.0 51 147.0 52 122.0 53 116.5 54 111.0 55 83.0 56 73.5 57 78.5 58 69.5 59 58.5 60 63.5 61 62.0 62 53.0 63 45.5 64 38.0 65 46.5 66 46.5 67 40.0 68 38.0 69 34.0 70 41.0 71 36.5 72 21.0 73 18.0 74 13.5 75 10.5 76 13.0 77 12.0 78 9.0 79 7.0 80 3.0 81 1.0 82 1.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 1.0 96 2.0 97 21.0 98 86.0 99 270.0 100 929.0 101 2689.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.58959849097278 85.9 2 7.033144704931285 13.05 3 0.37725680409593104 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390932 spots for SRR21853420.sra Written 390932 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra Read 390919 spots for SRR21853420.sra Written 390919 spots for SRR21853420.sra SRR ids: ['SRR21853420.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_egb3rlzj SRR21853420.sra spots: 7818393 blocks: [[1, 390919], [390920, 781838], [781839, 1172757], [1172758, 1563676], [1563677, 1954595], [1954596, 2345514], [2345515, 2736433], [2736434, 3127352], [3127353, 3518271], [3518272, 3909190], [3909191, 4300109], [4300110, 4691028], [4691029, 5081947], [5081948, 5472866], [5472867, 5863785], [5863786, 6254704], [6254705, 6645623], [6645624, 7036542], [7036543, 7427461], [7427462, 7818393]] SRR21853420 file size 2101811 SRR21853420 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853420 SRR21853420_1.fastq Input file: SRR21853420_1.fastq trimmed: SRR21853420-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:19:06 2024 >> started Fri Dec 6 14:19:10 2024 >> done (4.263s) 7818393 reads processed; of these: 1 ( 0.00%) short reads filtered out after trimming by size control 2190 ( 0.03%) empty reads filtered out after trimming by size control 7816202 (99.97%) reads available; of these: 250 ( 0.00%) trimmed reads available after processing 7815952 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 2 0.00% 32 3 0.00% 33 9 0.00% 34 8 0.00% 35 17 0.00% 36 15 0.00% 37 16 0.00% 38 13 0.00% 39 7 0.00% 40 13 0.00% 41 22 0.00% 42 27 0.00% 43 17 0.00% 44 16 0.00% 45 16 0.00% 46 16 0.00% 47 19 0.00% 48 18 0.00% 49 28 0.00% 50 19 0.00% 51 17 0.00% 52 19 0.00% 53 35 0.00% 54 22 0.00% 55 25 0.00% 56 22 0.00% 57 27 0.00% 58 22 0.00% 59 21 0.00% 60 29 0.00% 61 32 0.00% 62 33 0.00% 63 28 0.00% 64 31 0.00% 65 26 0.00% 66 36 0.00% 67 26 0.00% 68 33 0.00% 69 31 0.00% 70 35 0.00% 71 35 0.00% 72 48 0.00% 73 35 0.00% 74 37 0.00% 75 37 0.00% 76 50 0.00% 77 45 0.00% 78 55 0.00% 79 53 0.00% 80 38 0.00% 81 58 0.00% 82 42 0.00% 83 61 0.00% 84 72 0.00% 85 58 0.00% 86 59 0.00% 87 76 0.00% 88 80 0.00% 89 90 0.00% 90 132 0.00% 91 339 0.00% 92 98 0.00% 93 172 0.00% 94 408 0.01% 95 1586 0.02% 96 10432 0.13% 97 39326 0.50% 98 149867 1.92% 99 527788 6.75% 100 1866524 23.88% 101 5217646 66.75% 7816202 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=21 prefix-density=0.23 prefix-fanout=1.9 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=173.23 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=21.6 sequence=CGCCGCCGCCGC Started job on | Dec 06 14:19:25 Started mapping on | Dec 06 14:19:26 Finished on | Dec 06 14:19:37 Mapping speed, Million of reads per hour | 2558.03 Number of input reads | 7816202 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 7193442 Uniquely mapped reads % | 92.03% Average mapped length | 100.25 Number of splices: Total | 2660390 Number of splices: Annotated (sjdb) | 2523214 Number of splices: GT/AG | 2623467 Number of splices: GC/AG | 31913 Number of splices: AT/AC | 1634 Number of splices: Non-canonical | 3376 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 1.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 279995 % of reads mapped to multiple loci | 3.58% Number of reads mapped to too many loci | 217462 % of reads mapped to too many loci | 2.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.18% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 342765 342765 342765 N_multimapping 279995 279995 279995 N_noFeature 414052 3834164 3678326 N_ambiguous 110368 7639 8563 UnstrandedReadsAssigned:6669022 PositiveStrandReadsAssigned:3351639 NegativeStrandReadsAssigned:3506553 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853420 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853420-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,816,202 reads, 6,882,622 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52973 SRR21853420.ke.tsv 35125 SRR21853420.se.tsv 88098 total ==> SRR21853420.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 26.9108 7.70916 PNS24249 1928 1829 27.355 4.04889 PNS24246 1044 945 26.9108 7.70916 PNS24248 1044 945 26.9108 7.70916 PNS24244 1471 1372 37.9126 7.48069 PNS24243 293 194 2 2.79088 KQK14069 1603 1504 2128.12 383.055 KQK14071 474 375 317.253 229.027 ==> SRR21853420.se.tsv <== BRADI_1g14170v3 2820 BRADI_1g53295v3 49 BRADI_1g59795v3 229 BRADI_1g07683v3 0 BRADI_1g00485v3 48 BRADI_1g20270v3 816 BRADI_1g74790v3 58 BRADI_1g09890v3 3 BRADI_1g77505v3 129 BRADI_1g48960v3 0 SRR21853420 completed mapping pipeline successfully