Starting /dee2/code/volunteer_pipeline.sh SRR21853421 current disk space = 1550481780736 free memory = 1349436504 SRR21853421 SRAfilesize 5731dfa6e7aa2e49876dcb7ec5ee4044 SRR21853421.sra SRR21853421.sra file validated SRR21853421 is single end SRR21853421 is conventional basespace SRR21853421 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853421_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.94025 37.0 37.0 37.0 25.0 37.0 2 34.82825 37.0 37.0 37.0 25.0 37.0 3 35.273 37.0 37.0 37.0 37.0 37.0 4 35.60375 37.0 37.0 37.0 37.0 37.0 5 35.66975 37.0 37.0 37.0 37.0 37.0 6 35.66225 37.0 37.0 37.0 37.0 37.0 7 35.44275 37.0 37.0 37.0 37.0 37.0 8 35.71175 37.0 37.0 37.0 37.0 37.0 9 35.50275 37.0 37.0 37.0 37.0 37.0 10-11 35.71475 37.0 37.0 37.0 37.0 37.0 12-13 35.68625 37.0 37.0 37.0 37.0 37.0 14-15 35.73325 37.0 37.0 37.0 37.0 37.0 16-17 35.653 37.0 37.0 37.0 37.0 37.0 18-19 35.628 37.0 37.0 37.0 37.0 37.0 20-21 35.64125 37.0 37.0 37.0 37.0 37.0 22-23 35.691 37.0 37.0 37.0 37.0 37.0 24-25 35.547 37.0 37.0 37.0 37.0 37.0 26-27 35.422 37.0 37.0 37.0 37.0 37.0 28-29 35.49875 37.0 37.0 37.0 37.0 37.0 30-31 35.5015 37.0 37.0 37.0 37.0 37.0 32-33 35.403 37.0 37.0 37.0 37.0 37.0 34-35 35.49875 37.0 37.0 37.0 37.0 37.0 36-37 35.43507630723042 37.0 37.0 37.0 37.0 37.0 38-39 35.47935951963973 37.0 37.0 37.0 37.0 37.0 40-41 35.42031523642732 37.0 37.0 37.0 37.0 37.0 42-43 35.47885914435827 37.0 37.0 37.0 37.0 37.0 44-45 35.49036777583187 37.0 37.0 37.0 37.0 37.0 46-47 35.53139854891168 37.0 37.0 37.0 37.0 37.0 48-49 35.4365774330748 37.0 37.0 37.0 37.0 37.0 50-51 35.263697773329994 37.0 37.0 37.0 25.0 37.0 52-53 35.4193144858644 37.0 37.0 37.0 37.0 37.0 54-55 35.26519889917438 37.0 37.0 37.0 31.0 37.0 56-57 35.456842631973984 37.0 37.0 37.0 37.0 37.0 58-59 35.190893169877405 37.0 37.0 37.0 31.0 37.0 60-61 35.29246935201401 37.0 37.0 37.0 25.0 37.0 62-63 35.27120340255192 37.0 37.0 37.0 31.0 37.0 64-65 35.37928446334751 37.0 37.0 37.0 37.0 37.0 66-67 35.32374280710533 37.0 37.0 37.0 31.0 37.0 68-69 35.3324993745309 37.0 37.0 37.0 37.0 37.0 70-71 35.132165206508134 37.0 37.0 37.0 25.0 37.0 72-73 35.17499340374768 37.0 37.0 37.0 25.0 37.0 74-75 35.157235853780676 37.0 37.0 37.0 25.0 37.0 76-77 35.19404106159239 37.0 37.0 37.0 25.0 37.0 78-79 35.230846269404104 37.0 37.0 37.0 31.0 37.0 80-81 35.15623435152729 37.0 37.0 37.0 25.0 37.0 82-83 35.16349524286429 37.0 37.0 37.0 25.0 37.0 84-85 35.02228342513771 37.0 37.0 37.0 25.0 37.0 86-87 35.20931397095644 37.0 37.0 37.0 31.0 37.0 88-89 35.200550826239365 37.0 37.0 37.0 25.0 37.0 90-91 35.110165247871805 37.0 37.0 37.0 25.0 37.0 92-93 35.01677516274411 37.0 37.0 37.0 25.0 37.0 94-95 34.957185778668006 37.0 37.0 37.0 25.0 37.0 96-97 34.959426614872214 37.0 37.0 37.0 25.0 37.0 98-99 35.12387485635429 37.0 37.0 37.0 25.0 37.0 100-101 34.96042425347193 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.0 25 12.0 26 15.0 27 27.0 28 39.0 29 47.0 30 91.0 31 99.0 32 176.0 33 206.0 34 346.0 35 576.0 36 2023.0 37 334.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.09532149111834 14.235676757568177 18.06354766074556 40.605454090567925 2 24.740703263344297 20.667847204654695 32.1274981027068 22.46395142929421 3 27.127127127127125 23.24824824824825 23.973973973973976 25.650650650650654 4 26.64498373780335 29.67225419064298 19.039279459594695 24.64348261195897 5 26.319739804853644 31.123342506880157 21.61621215911934 20.94070552914686 6 20.965724293219914 34.9762321741306 22.091568676507382 21.966474856142106 7 20.26519889917438 17.062797097823367 37.95346509882412 24.718538904178132 8 21.56617463097323 23.492619464598448 27.020265198899175 27.920940705529144 9 21.816362271703778 21.36602451838879 28.446334751063297 28.371278458844134 10-11 25.03127345509132 29.509632224168126 21.015761821366024 24.44333249937453 12-13 23.942957217913435 22.116587440580435 27.34550913184889 26.594946209657245 14-15 23.58018513885414 24.68101075806855 26.257192894671004 25.481611208406306 16-17 24.11808856642482 24.993745308981737 25.268951713785338 25.619214410808105 18-19 23.655241431073303 26.319739804853644 24.59344508381286 25.431573680260193 20-21 24.11808856642482 25.64423317488116 25.156367275456592 25.081310983237426 22-23 24.230673004753562 25.40655491618714 25.64423317488116 24.718538904178132 24-25 22.241681260945708 26.182136602451838 26.21966474856142 25.356517388041034 26-27 24.26820115086315 25.431573680260193 25.13134851138354 25.168876657493122 28-29 24.893670252689517 25.65674255691769 23.967975981986488 25.481611208406306 30-31 23.617713284963724 25.544158118588946 25.906930197648236 24.931198398799097 32-33 23.792844633475106 26.344758568926697 25.456592444333246 24.405804353264948 34-35 23.592694520890667 25.9819864898674 25.93194896172129 24.49337002752064 36-37 24.293219914936202 25.268951713785338 25.8443832874656 24.59344508381286 38-39 23.617713284963724 26.444833625218916 25.068801601200903 24.86865148861646 40-41 25.31898924193145 25.806855141356017 23.805354015511636 25.068801601200903 42-43 23.54265699274456 25.9819864898674 25.093820365273956 25.381536152114087 44-45 23.755316487365523 26.35726795096322 25.281461095821868 24.605954465849386 46-47 24.518388791593697 25.456592444333246 24.655991993995496 25.369026770077557 48-49 22.929697272954716 26.45734300725544 25.23142356767576 25.381536152114087 50-51 23.567675756817614 26.207155366524894 25.156367275456592 25.068801601200903 52-53 24.06805103827871 25.781836377282964 25.444083062296723 24.706029522141606 54-55 23.68026019514636 24.993745308981737 26.032024018013512 25.293970477858394 56-57 24.00550412809607 25.268951713785338 25.894420815611706 24.83112334250688 58-59 24.706029522141606 25.093820365273956 25.281461095821868 24.91868901676257 60-61 24.59344508381286 25.25644233174881 25.369026770077557 24.78108581436077 62-63 25.13134851138354 25.156367275456592 25.606705028771582 24.10557918438829 64-65 24.293219914936202 26.45734300725544 24.59344508381286 24.655991993995496 66-67 24.180635476607456 25.143857893420062 25.344008006004504 25.331498623967974 68-69 24.44333249937453 26.670002501876404 24.806104578433825 24.080560420315237 70-71 24.893617021276597 25.494367959949937 25.494367959949937 24.11764705882353 72-73 24.045562648641884 26.085868068594316 25.284766554011767 24.583802728752033 74-75 24.52428642964447 25.225338007010517 25.600901352028043 24.649474211316978 76-77 24.749624436654983 25.938908362543817 25.112669003505257 24.198798197295943 78-79 24.236354531797698 25.087631447170754 25.07511266900351 25.600901352028043 80-81 24.14872308462694 26.189283925888834 25.050075112669003 24.611917876815223 82-83 24.2864296444667 25.31296945418127 25.98898347521282 24.41161742613921 84-85 24.374061091637454 25.27541311967952 25.550826239359036 24.799699549323986 86-87 24.812218327491237 25.112669003505257 25.58838257386079 24.486730095142715 88-89 24.13620430645969 26.076614922383573 25.475713570355534 24.3114672008012 90-91 23.510265398097147 26.10165247871808 25.6885327991988 24.699549323985977 92-93 23.923385077616423 26.99048572859289 24.774661992989483 24.3114672008012 94-95 24.236354531797698 25.78868302453681 25.51326990485729 24.461692538808215 96-97 24.830954169797145 25.156523916854496 25.7450538442274 24.267468069120962 98-99 24.774029280712924 24.67218332272438 26.072565245066837 24.481222151495864 100-101 25.798212005108557 11.861430395913155 31.36973180076628 30.970625798212005 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.5 24 2.0 25 1.0 26 0.5 27 3.5 28 5.5 29 6.0 30 9.5 31 14.0 32 17.5 33 22.5 34 29.0 35 34.0 36 50.0 37 62.5 38 76.0 39 107.0 40 129.0 41 149.0 42 187.0 43 195.5 44 199.5 45 213.5 46 208.0 47 199.0 48 189.0 49 173.0 50 159.5 51 148.5 52 141.0 53 122.0 54 104.0 55 106.5 56 94.5 57 80.5 58 73.5 59 66.5 60 57.5 61 55.0 62 52.5 63 41.0 64 38.0 65 38.5 66 31.5 67 34.5 68 35.5 69 30.5 70 32.0 71 32.5 72 26.0 73 27.0 74 26.5 75 16.5 76 13.5 77 9.0 78 6.0 79 5.0 80 2.5 81 2.5 82 2.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 1.175 3 0.1 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.075 14-15 0.075 16-17 0.075 18-19 0.075 20-21 0.075 22-23 0.075 24-25 0.075 26-27 0.075 28-29 0.075 30-31 0.075 32-33 0.075 34-35 0.075 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 3.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 2.0 70-71 0.0 72-73 1.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 23.0 98-99 364.0 100-101 3607.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.7 #Duplication Level Percentage of deduplicated Percentage of total 1 93.5965848452508 87.7 2 6.08324439701174 11.4 3 0.32017075773745995 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667869 spots for SRR21853421.sra Written 667869 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra Read 667851 spots for SRR21853421.sra Written 667851 spots for SRR21853421.sra SRR ids: ['SRR21853421.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ivnom0ci SRR21853421.sra spots: 13357038 blocks: [[1, 667851], [667852, 1335702], [1335703, 2003553], [2003554, 2671404], [2671405, 3339255], [3339256, 4007106], [4007107, 4674957], [4674958, 5342808], [5342809, 6010659], [6010660, 6678510], [6678511, 7346361], [7346362, 8014212], [8014213, 8682063], [8682064, 9349914], [9349915, 10017765], [10017766, 10685616], [10685617, 11353467], [11353468, 12021318], [12021319, 12689169], [12689170, 13357038]] SRR21853421 file size 3594390 SRR21853421 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853421 SRR21853421_1.fastq Input file: SRR21853421_1.fastq trimmed: SRR21853421-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:24:39 2024 >> started Fri Dec 6 14:24:46 2024 >> done (7.107s) 13357038 reads processed; of these: 12 ( 0.00%) short reads filtered out after trimming by size control 7041 ( 0.05%) empty reads filtered out after trimming by size control 13349985 (99.95%) reads available; of these: 276 ( 0.00%) trimmed reads available after processing 13349709 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 2 0.00% 21 1 0.00% 22 1 0.00% 23 3 0.00% 24 1 0.00% 25 1 0.00% 26 4 0.00% 27 1 0.00% 28 6 0.00% 29 2 0.00% 30 3 0.00% 31 5 0.00% 32 3 0.00% 33 4 0.00% 34 3 0.00% 35 75 0.00% 36 71 0.00% 37 51 0.00% 38 65 0.00% 39 72 0.00% 40 73 0.00% 41 83 0.00% 42 69 0.00% 43 77 0.00% 44 66 0.00% 45 73 0.00% 46 83 0.00% 47 85 0.00% 48 63 0.00% 49 96 0.00% 50 92 0.00% 51 82 0.00% 52 97 0.00% 53 81 0.00% 54 79 0.00% 55 92 0.00% 56 101 0.00% 57 101 0.00% 58 109 0.00% 59 80 0.00% 60 128 0.00% 61 111 0.00% 62 110 0.00% 63 103 0.00% 64 130 0.00% 65 115 0.00% 66 135 0.00% 67 144 0.00% 68 126 0.00% 69 146 0.00% 70 150 0.00% 71 186 0.00% 72 145 0.00% 73 143 0.00% 74 139 0.00% 75 132 0.00% 76 176 0.00% 77 161 0.00% 78 179 0.00% 79 203 0.00% 80 201 0.00% 81 228 0.00% 82 199 0.00% 83 209 0.00% 84 219 0.00% 85 225 0.00% 86 242 0.00% 87 274 0.00% 88 262 0.00% 89 317 0.00% 90 350 0.00% 91 740 0.01% 92 371 0.00% 93 481 0.00% 94 855 0.01% 95 2747 0.02% 96 18077 0.14% 97 67352 0.50% 98 257006 1.93% 99 903323 6.77% 100 3190265 23.90% 101 8901123 66.68% 13349985 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=16 prefix-density=0.20 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=9.32 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=1.9 sequence=GCTGCTGGCACCAGACTTGCCCTCCAATGGATCCTCGTTAAGGGATTTAGATTGTACTCATTCCAATTACCAGACACTAATGTGCCCGGTATTGTTATTTATTGTCACTACCTCCCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTAATTCTCCGTCACCCGTCACCACCATGGTAGGCCCCTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGATGCGTCGCCGGCACGAGGGCCGTGCGATCCGTCG Started job on | Dec 06 14:25:17 Started mapping on | Dec 06 14:25:17 Finished on | Dec 06 14:25:46 Mapping speed, Million of reads per hour | 1657.24 Number of input reads | 13349985 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 12300037 Uniquely mapped reads % | 92.14% Average mapped length | 100.22 Number of splices: Total | 4579885 Number of splices: Annotated (sjdb) | 4344758 Number of splices: GT/AG | 4516260 Number of splices: GC/AG | 54770 Number of splices: AT/AC | 2617 Number of splices: Non-canonical | 6238 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 480969 % of reads mapped to multiple loci | 3.60% Number of reads mapped to too many loci | 358009 % of reads mapped to too many loci | 2.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.16% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 568979 568979 568979 N_multimapping 480969 480969 480969 N_noFeature 699245 6531190 6305672 N_ambiguous 188210 12895 14175 UnstrandedReadsAssigned:11412582 PositiveStrandReadsAssigned:5755952 NegativeStrandReadsAssigned:5980190 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853421 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853421-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,349,985 reads, 11,776,100 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52973 SRR21853421.ke.tsv 35125 SRR21853421.se.tsv 88098 total ==> SRR21853421.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 34.3812 5.71188 PNS24249 1928 1829 52.593 4.51445 PNS24246 1044 945 34.3812 5.71188 PNS24248 1044 945 34.3812 5.71188 PNS24244 1471 1372 40.2634 4.6073 PNS24243 293 194 4 3.23704 KQK14069 1603 1504 3818.01 398.547 KQK14071 474 375 495.652 207.508 ==> SRR21853421.se.tsv <== BRADI_1g14170v3 4991 BRADI_1g53295v3 81 BRADI_1g59795v3 420 BRADI_1g07683v3 0 BRADI_1g00485v3 75 BRADI_1g20270v3 1274 BRADI_1g74790v3 92 BRADI_1g09890v3 1 BRADI_1g77505v3 209 BRADI_1g48960v3 0 SRR21853421 completed mapping pipeline successfully