Starting /dee2/code/volunteer_pipeline.sh SRR21853422 current disk space = 1550330208256 free memory = 1599128504 SRR21853422 SRAfilesize 30cb9fd6068bb375b4e4737d26687acc SRR21853422.sra SRR21853422.sra file validated SRR21853422 is single end SRR21853422 is conventional basespace SRR21853422 read1 length is 88-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853422_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 88-101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.3005 37.0 37.0 37.0 37.0 37.0 2 35.698 37.0 37.0 37.0 37.0 37.0 3 35.7945 37.0 37.0 37.0 37.0 37.0 4 35.828 37.0 37.0 37.0 37.0 37.0 5 36.0 37.0 37.0 37.0 37.0 37.0 6 35.924 37.0 37.0 37.0 37.0 37.0 7 35.749 37.0 37.0 37.0 37.0 37.0 8 36.062 37.0 37.0 37.0 37.0 37.0 9 35.8945 37.0 37.0 37.0 37.0 37.0 10-11 36.02375 37.0 37.0 37.0 37.0 37.0 12-13 35.96425 37.0 37.0 37.0 37.0 37.0 14-15 35.911500000000004 37.0 37.0 37.0 37.0 37.0 16-17 35.86875 37.0 37.0 37.0 37.0 37.0 18-19 35.92075 37.0 37.0 37.0 37.0 37.0 20-21 35.8995 37.0 37.0 37.0 37.0 37.0 22-23 35.857 37.0 37.0 37.0 37.0 37.0 24-25 35.811 37.0 37.0 37.0 37.0 37.0 26-27 35.771 37.0 37.0 37.0 37.0 37.0 28-29 35.76275 37.0 37.0 37.0 37.0 37.0 30-31 35.81 37.0 37.0 37.0 37.0 37.0 32-33 35.67700000000001 37.0 37.0 37.0 37.0 37.0 34-35 35.62475 37.0 37.0 37.0 37.0 37.0 36-37 35.6835 37.0 37.0 37.0 37.0 37.0 38-39 35.705 37.0 37.0 37.0 37.0 37.0 40-41 35.63475 37.0 37.0 37.0 37.0 37.0 42-43 35.692750000000004 37.0 37.0 37.0 37.0 37.0 44-45 35.54174999999999 37.0 37.0 37.0 37.0 37.0 46-47 35.686 37.0 37.0 37.0 37.0 37.0 48-49 35.5075 37.0 37.0 37.0 37.0 37.0 50-51 35.6285 37.0 37.0 37.0 37.0 37.0 52-53 35.61525 37.0 37.0 37.0 37.0 37.0 54-55 35.53675 37.0 37.0 37.0 37.0 37.0 56-57 35.522999999999996 37.0 37.0 37.0 37.0 37.0 58-59 35.46725 37.0 37.0 37.0 37.0 37.0 60-61 35.4995 37.0 37.0 37.0 37.0 37.0 62-63 35.560500000000005 37.0 37.0 37.0 37.0 37.0 64-65 35.5905 37.0 37.0 37.0 37.0 37.0 66-67 35.65325 37.0 37.0 37.0 37.0 37.0 68-69 35.519999999999996 37.0 37.0 37.0 37.0 37.0 70-71 35.459 37.0 37.0 37.0 37.0 37.0 72-73 35.543499999999995 37.0 37.0 37.0 37.0 37.0 74-75 35.47625 37.0 37.0 37.0 37.0 37.0 76-77 35.56325 37.0 37.0 37.0 37.0 37.0 78-79 35.4865 37.0 37.0 37.0 37.0 37.0 80-81 35.461 37.0 37.0 37.0 37.0 37.0 82-83 35.48375 37.0 37.0 37.0 37.0 37.0 84-85 35.439499999999995 37.0 37.0 37.0 37.0 37.0 86-87 35.51775000000001 37.0 37.0 37.0 37.0 37.0 88-89 35.288136227170384 37.0 37.0 37.0 31.0 37.0 90-91 35.445834375781835 37.0 37.0 37.0 37.0 37.0 92-93 35.40430322742057 37.0 37.0 37.0 37.0 37.0 94-95 35.48836627470603 37.0 37.0 37.0 37.0 37.0 96-97 35.35081442003266 37.0 37.0 37.0 37.0 37.0 98-99 35.33109223012086 37.0 37.0 37.0 37.0 37.0 100-101 35.218792943364804 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 2.0 25 6.0 26 11.0 27 18.0 28 34.0 29 57.0 30 66.0 31 92.0 32 127.0 33 162.0 34 262.0 35 508.0 36 2160.0 37 491.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.725 12.55 16.650000000000002 42.075 2 27.875 18.175 28.275 25.674999999999997 3 27.05 21.575 22.15 29.225 4 28.875 27.55 16.525000000000002 27.05 5 29.325000000000003 29.75 18.575 22.35 6 23.025000000000002 31.95 18.15 26.875 7 21.95 15.875 36.675000000000004 25.5 8 24.775 20.05 23.974999999999998 31.2 9 22.2 20.200000000000003 26.950000000000003 30.65 10-11 27.537499999999998 26.3125 18.775 27.375 12-13 24.625 20.825 24.7375 29.812499999999996 14-15 24.4375 23.2875 23.9125 28.3625 16-17 26.924999999999997 22.9625 21.4 28.712500000000002 18-19 26.2625 22.7 22.85 28.1875 20-21 26.3 23.6125 21.8875 28.199999999999996 22-23 26.3 24.075 22.0 27.625 24-25 25.8125 22.6875 23.175 28.325 26-27 25.7625 22.8 22.75 28.6875 28-29 25.95 23.200000000000003 23.0 27.85 30-31 24.349999999999998 23.150000000000002 23.5875 28.9125 32-33 26.400000000000002 22.8375 23.2625 27.500000000000004 34-35 25.35 23.05 23.575 28.025 36-37 25.974999999999998 22.3375 23.150000000000002 28.537499999999998 38-39 26.224999999999998 23.7125 21.875 28.1875 40-41 27.250000000000004 22.2625 22.662499999999998 27.825 42-43 26.5125 22.875 23.2875 27.325 44-45 26.0375 22.5625 23.425 27.975 46-47 26.55 22.875 21.075 29.5 48-49 25.8125 23.400000000000002 21.912499999999998 28.875 50-51 26.4625 22.575 22.625 28.3375 52-53 25.45 22.5125 22.925 29.1125 54-55 26.325 23.05 23.0 27.625 56-57 25.9875 23.025000000000002 23.175 27.8125 58-59 27.725 23.3125 21.987499999999997 26.974999999999998 60-61 26.325 23.5 22.112499999999997 28.0625 62-63 26.9625 22.400000000000002 22.3125 28.325 64-65 27.1125 22.4375 23.150000000000002 27.3 66-67 27.900000000000002 22.125 22.287499999999998 27.6875 68-69 26.9125 22.925 22.412499999999998 27.750000000000004 70-71 26.5625 22.3125 22.55 28.575 72-73 26.1625 22.537499999999998 23.775 27.525 74-75 26.6 22.15 23.4125 27.8375 76-77 26.924999999999997 22.05 22.85 28.175 78-79 27.650000000000002 23.0125 22.35 26.987499999999997 80-81 25.45 23.3625 22.7375 28.449999999999996 82-83 26.8 22.2625 22.2625 28.675 84-85 25.974999999999998 22.3625 23.0 28.6625 86-87 26.474999999999998 22.2625 23.2125 28.050000000000004 88-89 26.747530323871448 23.096161060397648 22.033262473427534 28.123046142303366 90-91 27.670753064798596 22.70452839629722 21.528646484863646 28.096072054040533 92-93 27.270452839629723 23.079809857393045 22.554415811858895 27.09532149111834 94-95 27.220415311483613 22.39179384538404 22.191643732799598 28.19614711033275 96-97 26.83110053837486 23.22524101665206 22.31125579065982 27.63240265431326 98-99 27.166603222941248 21.723131582286513 22.89049612993275 28.21976906483949 100-101 28.22455923291061 10.052582740488711 27.40488710176307 34.31797092483761 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.5 27 2.0 28 3.0 29 2.0 30 4.5 31 10.5 32 12.0 33 11.5 34 17.5 35 27.0 36 32.5 37 38.5 38 53.0 39 65.5 40 79.0 41 93.0 42 103.0 43 117.5 44 133.5 45 127.5 46 117.0 47 135.5 48 137.0 49 133.0 50 138.5 51 117.0 52 104.0 53 115.5 54 109.5 55 94.5 56 103.5 57 113.0 58 102.0 59 94.0 60 101.0 61 100.5 62 100.0 63 99.5 64 93.0 65 103.0 66 97.0 67 84.0 68 84.0 69 85.5 70 78.5 71 71.0 72 64.0 73 64.0 74 60.5 75 41.5 76 34.0 77 27.5 78 22.0 79 13.5 80 8.5 81 8.5 82 6.5 83 3.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 88 3.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 1.0 96 5.0 97 22.0 98 57.0 99 259.0 100 840.0 101 2813.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.375 #Duplication Level Percentage of deduplicated Percentage of total 1 92.53044654939106 85.475 2 6.847090663058186 12.65 3 0.5683355886332883 1.575 4 0.027063599458728015 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027063599458728015 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 8 0.2 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra Read 362067 spots for SRR21853422.sra Written 362067 spots for SRR21853422.sra SRR ids: ['SRR21853422.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2i6b8ge5 SRR21853422.sra spots: 7241340 blocks: [[1, 362067], [362068, 724134], [724135, 1086201], [1086202, 1448268], [1448269, 1810335], [1810336, 2172402], [2172403, 2534469], [2534470, 2896536], [2896537, 3258603], [3258604, 3620670], [3620671, 3982737], [3982738, 4344804], [4344805, 4706871], [4706872, 5068938], [5068939, 5431005], [5431006, 5793072], [5793073, 6155139], [6155140, 6517206], [6517207, 6879273], [6879274, 7241340]] SRR21853422 file size 1947245 SRR21853422 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853422 SRR21853422_1.fastq Input file: SRR21853422_1.fastq trimmed: SRR21853422-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:25:42 2024 >> started Fri Dec 6 14:25:46 2024 >> done (3.788s) 7241340 reads processed; of these: 5 ( 0.00%) short reads filtered out after trimming by size control 22923 ( 0.32%) empty reads filtered out after trimming by size control 7218412 (99.68%) reads available; of these: 242 ( 0.00%) trimmed reads available after processing 7218170 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 1 0.00% 25 3 0.00% 26 0 0.00% 27 4 0.00% 28 4 0.00% 29 3 0.00% 30 0 0.00% 31 5 0.00% 32 4 0.00% 33 6 0.00% 34 6 0.00% 35 23 0.00% 36 21 0.00% 37 17 0.00% 38 18 0.00% 39 26 0.00% 40 25 0.00% 41 26 0.00% 42 21 0.00% 43 21 0.00% 44 22 0.00% 45 30 0.00% 46 19 0.00% 47 22 0.00% 48 23 0.00% 49 29 0.00% 50 20 0.00% 51 26 0.00% 52 22 0.00% 53 30 0.00% 54 29 0.00% 55 32 0.00% 56 27 0.00% 57 33 0.00% 58 24 0.00% 59 35 0.00% 60 42 0.00% 61 41 0.00% 62 30 0.00% 63 28 0.00% 64 24 0.00% 65 37 0.00% 66 32 0.00% 67 32 0.00% 68 28 0.00% 69 37 0.00% 70 31 0.00% 71 26 0.00% 72 32 0.00% 73 33 0.00% 74 39 0.00% 75 41 0.00% 76 44 0.00% 77 36 0.00% 78 54 0.00% 79 32 0.00% 80 53 0.00% 81 61 0.00% 82 48 0.00% 83 38 0.00% 84 44 0.00% 85 61 0.00% 86 62 0.00% 87 65 0.00% 88 61 0.00% 89 85 0.00% 90 89 0.00% 91 319 0.00% 92 114 0.00% 93 140 0.00% 94 438 0.01% 95 1709 0.02% 96 9388 0.13% 97 29995 0.42% 98 117006 1.62% 99 468785 6.49% 100 1530688 21.21% 101 5057806 70.07% 7218412 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=23 prefix-density=0.51 prefix-fanout=1.8 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=25 fanout-score=197.70 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=22.9 sequence=CGCCGCCGCCGC Started job on | Dec 06 14:26:01 Started mapping on | Dec 06 14:26:01 Finished on | Dec 06 14:26:15 Mapping speed, Million of reads per hour | 1856.16 Number of input reads | 7218412 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 6275720 Uniquely mapped reads % | 86.94% Average mapped length | 100.29 Number of splices: Total | 2002853 Number of splices: Annotated (sjdb) | 1905853 Number of splices: GT/AG | 1974171 Number of splices: GC/AG | 23969 Number of splices: AT/AC | 955 Number of splices: Non-canonical | 3758 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.00% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 437661 % of reads mapped to multiple loci | 6.06% Number of reads mapped to too many loci | 382775 % of reads mapped to too many loci | 5.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.93% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 505031 505031 505031 N_multimapping 437661 437661 437661 N_noFeature 222797 3282421 3134422 N_ambiguous 96680 9866 5722 UnstrandedReadsAssigned:5956243 PositiveStrandReadsAssigned:2983433 NegativeStrandReadsAssigned:3135576 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853422 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853422-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,218,412 reads, 6,201,361 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52973 SRR21853422.ke.tsv 35125 SRR21853422.se.tsv 88098 total ==> SRR21853422.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 11.2069 3.04472 PNS24249 1928 1829 66.7995 9.37675 PNS24246 1044 945 11.2069 3.04472 PNS24248 1044 945 11.2069 3.04472 PNS24244 1471 1372 11.5797 2.16688 PNS24243 293 194 4 5.2936 KQK14069 1603 1504 407.501 69.5623 KQK14071 474 375 28.0711 19.2186 ==> SRR21853422.se.tsv <== BRADI_1g14170v3 484 BRADI_1g53295v3 21 BRADI_1g59795v3 74 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 569 BRADI_1g74790v3 86 BRADI_1g09890v3 1 BRADI_1g77505v3 68 BRADI_1g48960v3 0 SRR21853422 completed mapping pipeline successfully