Starting /dee2/code/volunteer_pipeline.sh SRR21853423 current disk space = 1550452834304 free memory = 1597043864 SRR21853423 SRAfilesize cf14b928a15ea9de1e3a6665be6b56a8 SRR21853423.sra SRR21853423.sra file validated SRR21853423 is single end SRR21853423 is conventional basespace SRR21853423 read1 length is 40-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853423_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 40-101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.6625 37.0 37.0 37.0 25.0 37.0 2 34.7885 37.0 37.0 37.0 25.0 37.0 3 35.2865 37.0 37.0 37.0 37.0 37.0 4 35.357 37.0 37.0 37.0 37.0 37.0 5 35.615 37.0 37.0 37.0 37.0 37.0 6 35.481 37.0 37.0 37.0 37.0 37.0 7 35.327 37.0 37.0 37.0 37.0 37.0 8 35.6315 37.0 37.0 37.0 37.0 37.0 9 35.66 37.0 37.0 37.0 37.0 37.0 10-11 35.674499999999995 37.0 37.0 37.0 37.0 37.0 12-13 35.682 37.0 37.0 37.0 37.0 37.0 14-15 35.611999999999995 37.0 37.0 37.0 37.0 37.0 16-17 35.60025 37.0 37.0 37.0 37.0 37.0 18-19 35.554249999999996 37.0 37.0 37.0 37.0 37.0 20-21 35.542249999999996 37.0 37.0 37.0 37.0 37.0 22-23 35.5065 37.0 37.0 37.0 37.0 37.0 24-25 35.55475 37.0 37.0 37.0 37.0 37.0 26-27 35.42425 37.0 37.0 37.0 37.0 37.0 28-29 35.39 37.0 37.0 37.0 37.0 37.0 30-31 35.409 37.0 37.0 37.0 37.0 37.0 32-33 35.4325 37.0 37.0 37.0 37.0 37.0 34-35 35.399 37.0 37.0 37.0 37.0 37.0 36-37 35.4405 37.0 37.0 37.0 37.0 37.0 38-39 35.314750000000004 37.0 37.0 37.0 37.0 37.0 40-41 35.29128107026757 37.0 37.0 37.0 31.0 37.0 42-43 35.281820455113774 37.0 37.0 37.0 31.0 37.0 44-45 35.24231057764442 37.0 37.0 37.0 31.0 37.0 46-47 35.274568642160546 37.0 37.0 37.0 31.0 37.0 48-49 35.31082770692673 37.0 37.0 37.0 31.0 37.0 50-51 35.255063765941486 37.0 37.0 37.0 31.0 37.0 52-53 35.29482370592648 37.0 37.0 37.0 31.0 37.0 54-55 35.1902975743936 37.0 37.0 37.0 25.0 37.0 56-57 35.205301325331334 37.0 37.0 37.0 31.0 37.0 58-59 35.115278819704926 37.0 37.0 37.0 31.0 37.0 60-61 35.1712928232058 37.0 37.0 37.0 25.0 37.0 62-63 35.118029507376846 37.0 37.0 37.0 25.0 37.0 64-65 35.16079019754939 37.0 37.0 37.0 25.0 37.0 66-67 35.00150037509377 37.0 37.0 37.0 25.0 37.0 68-69 35.04701175293823 37.0 37.0 37.0 25.0 37.0 70-71 35.05901475368842 37.0 37.0 37.0 25.0 37.0 72-73 35.127781945486376 37.0 37.0 37.0 31.0 37.0 74-75 35.054263565891475 37.0 37.0 37.0 25.0 37.0 76-77 34.98574643660915 37.0 37.0 37.0 25.0 37.0 78-79 35.07126781695423 37.0 37.0 37.0 25.0 37.0 80-81 35.10252563140785 37.0 37.0 37.0 25.0 37.0 82-83 35.01175293823456 37.0 37.0 37.0 25.0 37.0 84-85 34.99749937484371 37.0 37.0 37.0 25.0 37.0 86-87 34.9394848712178 37.0 37.0 37.0 25.0 37.0 88-89 35.00750187546887 37.0 37.0 37.0 25.0 37.0 90-91 35.01150287571893 37.0 37.0 37.0 25.0 37.0 92-93 34.93323330832708 37.0 37.0 37.0 25.0 37.0 94-95 35.060015003750934 37.0 37.0 37.0 25.0 37.0 96-97 34.82400239207551 37.0 37.0 37.0 25.0 37.0 98-99 34.85320999123836 37.0 37.0 37.0 25.0 37.0 100-101 34.790096164738955 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 8.0 25 10.0 26 19.0 27 22.0 28 58.0 29 66.0 30 101.0 31 130.0 32 166.0 33 213.0 34 311.0 35 632.0 36 1930.0 37 330.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.549999999999997 12.0 16.7 42.75 2 26.084762865792126 19.55095862764884 28.38042381432896 25.983854692230068 3 26.700000000000003 22.375 22.375 28.549999999999997 4 28.375 26.875 18.35 26.400000000000002 5 28.525 29.4 20.775 21.3 6 22.900000000000002 31.724999999999998 19.325 26.05 7 21.2 16.05 34.675 28.075 8 23.7 20.1 23.7 32.5 9 22.975 19.775000000000002 26.424999999999997 30.825000000000003 10-11 26.3 26.787499999999998 18.4875 28.425 12-13 23.849999999999998 22.1375 24.3625 29.65 14-15 25.1 22.2625 24.425 28.212500000000002 16-17 27.250000000000004 22.412499999999998 22.45 27.8875 18-19 24.762500000000003 23.3875 23.962500000000002 27.8875 20-21 25.724999999999998 22.912499999999998 23.75 27.6125 22-23 25.9625 23.45 22.95 27.6375 24-25 25.412499999999998 24.3875 22.650000000000002 27.55 26-27 26.4625 24.0375 22.525000000000002 26.974999999999998 28-29 27.3 22.45 23.225 27.025 30-31 26.137500000000003 22.037499999999998 22.9875 28.8375 32-33 26.224999999999998 24.3125 22.6375 26.825 34-35 25.55 23.549999999999997 22.7 28.199999999999996 36-37 25.724999999999998 23.6375 23.549999999999997 27.0875 38-39 26.0625 23.6875 22.912499999999998 27.3375 40-41 25.778222277784725 23.32791598949869 23.6029503687961 27.29091136392049 42-43 25.84396099024756 23.055763940985248 23.055763940985248 28.044511127781945 44-45 26.006501625406354 23.618404601150285 22.568142035508878 27.806951737934483 46-47 27.719429857464366 23.080770192548137 22.355588897224308 26.84421105276319 48-49 25.381345336334082 23.143285821455365 23.518379594898725 27.956989247311824 50-51 25.63140785196299 22.818204551137786 23.705926481620406 27.84446111527882 52-53 26.731682920730183 22.868217054263564 21.867966991747938 28.532133033258315 54-55 26.25656414103526 23.36834208552138 22.53063265816454 27.84446111527882 56-57 27.00675168792198 22.693173293323333 22.780695173793447 27.51937984496124 58-59 26.65666416604151 23.20580145036259 22.29307326831708 27.84446111527882 60-61 26.906726681670417 23.280820205051263 22.9057264316079 26.906726681670417 62-63 27.169292323080768 23.243310827706924 21.54288572143036 28.044511127781945 64-65 26.76919229807452 22.768192048012004 23.10577644411103 27.35683920980245 66-67 26.081520380095025 23.893473368342086 21.91797949487372 28.107026756689173 68-69 27.069267316829208 22.893223305826456 22.793198299574893 27.24431107776944 70-71 27.881970492623154 22.118029507376843 22.43060765191298 27.569392348087025 72-73 26.506626656664167 23.40585146286572 21.80545136284071 28.28207051762941 74-75 27.419354838709676 22.705676419104776 22.9057264316079 26.969242310577645 76-77 27.981995498874717 22.080520130032507 22.99324831207802 26.944236059014752 78-79 25.618904726181547 22.518129532383096 22.83070767691923 29.03225806451613 80-81 26.59414853713428 23.055763940985248 23.118279569892472 27.231807951987996 82-83 26.806701675418854 22.61815453863466 23.1807951987997 27.394348587146787 84-85 26.6816704176044 22.768192048012004 22.455613903475868 28.094523630907727 86-87 26.469117279319832 23.143285821455365 23.243310827706924 27.144286071517882 88-89 26.93173293323331 21.842960740185045 22.95573893473368 28.26956739184796 90-91 26.981745436359088 22.868217054263564 22.018004501125283 28.132033008252062 92-93 26.36909227306827 23.34333583395849 23.093273318329583 27.19429857464366 94-95 26.9567391847962 22.61815453863466 22.568142035508878 27.85696424106027 96-97 27.750657153586182 22.931530854925523 22.218049818500436 27.099762172987855 98-99 27.07883712073124 21.18826964580424 23.93043036689095 27.802462866573567 100-101 27.315394242803503 10.434918648310388 27.15894868585732 35.09073842302878 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 0.5 25 2.0 26 2.0 27 0.5 28 0.0 29 0.5 30 2.5 31 7.5 32 11.0 33 13.5 34 19.5 35 23.0 36 27.0 37 29.5 38 48.0 39 68.5 40 86.0 41 101.0 42 100.5 43 112.5 44 124.5 45 136.0 46 149.5 47 148.0 48 152.0 49 141.5 50 128.5 51 122.0 52 117.0 53 123.0 54 114.5 55 109.0 56 109.0 57 99.5 58 106.0 59 117.0 60 105.0 61 89.0 62 87.5 63 99.5 64 101.5 65 86.5 66 70.0 67 76.0 68 82.0 69 84.5 70 82.5 71 70.0 72 66.0 73 52.5 74 42.0 75 37.0 76 28.5 77 23.5 78 19.0 79 17.0 80 13.0 81 7.5 82 4.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8999999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40-41 1.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 1.0 96-97 28.0 98-99 342.0 100-101 3628.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.94505201387037 88.05 2 5.734862630034677 10.75 3 0.2667377967457989 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026673779674579887 0.2 9 0.0 0.0 >10 0.026673779674579887 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 10 0.25 TruSeq Adapter, Index 7 (97% over 35bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCGCGTAT 8 0.2 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690071 spots for SRR21853423.sra Written 690071 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra Read 690059 spots for SRR21853423.sra Written 690059 spots for SRR21853423.sra SRR ids: ['SRR21853423.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qjzco5cg SRR21853423.sra spots: 13801192 blocks: [[1, 690059], [690060, 1380118], [1380119, 2070177], [2070178, 2760236], [2760237, 3450295], [3450296, 4140354], [4140355, 4830413], [4830414, 5520472], [5520473, 6210531], [6210532, 6900590], [6900591, 7590649], [7590650, 8280708], [8280709, 8970767], [8970768, 9660826], [9660827, 10350885], [10350886, 11040944], [11040945, 11731003], [11731004, 12421062], [12421063, 13111121], [13111122, 13801192]] SRR21853423 file size 3715440 SRR21853423 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853423 SRR21853423_1.fastq Input file: SRR21853423_1.fastq trimmed: SRR21853423-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:28:10 2024 >> started Fri Dec 6 14:28:22 2024 >> done (11.903s) 13801192 reads processed; of these: 24 ( 0.00%) short reads filtered out after trimming by size control 74875 ( 0.54%) empty reads filtered out after trimming by size control 13726293 (99.46%) reads available; of these: 474 ( 0.00%) trimmed reads available after processing 13725819 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 1 0.00% 21 4 0.00% 22 1 0.00% 23 2 0.00% 24 4 0.00% 25 5 0.00% 26 3 0.00% 27 5 0.00% 28 7 0.00% 29 4 0.00% 30 5 0.00% 31 6 0.00% 32 11 0.00% 33 6 0.00% 34 5 0.00% 35 68 0.00% 36 84 0.00% 37 83 0.00% 38 91 0.00% 39 94 0.00% 40 111 0.00% 41 111 0.00% 42 109 0.00% 43 98 0.00% 44 112 0.00% 45 108 0.00% 46 96 0.00% 47 120 0.00% 48 103 0.00% 49 129 0.00% 50 124 0.00% 51 125 0.00% 52 124 0.00% 53 119 0.00% 54 131 0.00% 55 148 0.00% 56 113 0.00% 57 133 0.00% 58 142 0.00% 59 123 0.00% 60 140 0.00% 61 142 0.00% 62 139 0.00% 63 135 0.00% 64 137 0.00% 65 178 0.00% 66 145 0.00% 67 164 0.00% 68 134 0.00% 69 157 0.00% 70 163 0.00% 71 167 0.00% 72 177 0.00% 73 133 0.00% 74 143 0.00% 75 153 0.00% 76 139 0.00% 77 175 0.00% 78 231 0.00% 79 165 0.00% 80 220 0.00% 81 203 0.00% 82 198 0.00% 83 210 0.00% 84 218 0.00% 85 191 0.00% 86 225 0.00% 87 225 0.00% 88 263 0.00% 89 284 0.00% 90 331 0.00% 91 828 0.01% 92 344 0.00% 93 490 0.00% 94 885 0.01% 95 3314 0.02% 96 17704 0.13% 97 57235 0.42% 98 224253 1.63% 99 897729 6.54% 100 2924319 21.30% 101 9590632 69.87% 13726293 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=21 prefix-density=0.51 prefix-fanout=1.8 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.15 sequence-density-rank=17 fanout-score=159.82 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=23.4 sequence=GCCGCCGCCACCCT Started job on | Dec 06 14:28:39 Started mapping on | Dec 06 14:28:39 Finished on | Dec 06 14:29:03 Mapping speed, Million of reads per hour | 2058.94 Number of input reads | 13726293 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 11923923 Uniquely mapped reads % | 86.87% Average mapped length | 100.25 Number of splices: Total | 3877787 Number of splices: Annotated (sjdb) | 3688076 Number of splices: GT/AG | 3820513 Number of splices: GC/AG | 47307 Number of splices: AT/AC | 1934 Number of splices: Non-canonical | 8033 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 2.44 Insertion rate per base | 0.00% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 841037 % of reads mapped to multiple loci | 6.13% Number of reads mapped to too many loci | 696888 % of reads mapped to too many loci | 5.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.13% % of reads unmapped: other | 0.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 961333 961333 961333 N_multimapping 841037 841037 841037 N_noFeature 425468 6202692 5992167 N_ambiguous 181627 17756 10503 UnstrandedReadsAssigned:11316828 PositiveStrandReadsAssigned:5703475 NegativeStrandReadsAssigned:5921253 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853423 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853423-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,726,293 reads, 11,775,434 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52973 SRR21853423.ke.tsv 35125 SRR21853423.se.tsv 88098 total ==> SRR21853423.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 21.9407 3.12584 PNS24249 1928 1829 153.602 11.3065 PNS24246 1044 945 21.9407 3.12584 PNS24248 1044 945 21.9407 3.12584 PNS24244 1471 1372 14.5757 1.43028 PNS24243 293 194 4 2.77591 KQK14069 1603 1504 879.843 78.7597 KQK14071 474 375 67.2929 24.1593 ==> SRR21853423.se.tsv <== BRADI_1g14170v3 1029 BRADI_1g53295v3 48 BRADI_1g59795v3 135 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 1122 BRADI_1g74790v3 140 BRADI_1g09890v3 9 BRADI_1g77505v3 146 BRADI_1g48960v3 0 SRR21853423 completed mapping pipeline successfully