Starting /dee2/code/volunteer_pipeline.sh SRR21853424 current disk space = 1550439407616 free memory = 1599044360 SRR21853424 SRAfilesize 375b31341cb4001fea224474fb68636c SRR21853424.sra SRR21853424.sra file validated SRR21853424 is single end SRR21853424 is conventional basespace SRR21853424 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853424_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.315 37.0 37.0 37.0 37.0 37.0 2 35.7875 37.0 37.0 37.0 37.0 37.0 3 35.985 37.0 37.0 37.0 37.0 37.0 4 35.916 37.0 37.0 37.0 37.0 37.0 5 35.93 37.0 37.0 37.0 37.0 37.0 6 36.044 37.0 37.0 37.0 37.0 37.0 7 35.971 37.0 37.0 37.0 37.0 37.0 8 35.894 37.0 37.0 37.0 37.0 37.0 9 35.9585 37.0 37.0 37.0 37.0 37.0 10-11 35.98225 37.0 37.0 37.0 37.0 37.0 12-13 36.055499999999995 37.0 37.0 37.0 37.0 37.0 14-15 35.905249999999995 37.0 37.0 37.0 37.0 37.0 16-17 35.97775 37.0 37.0 37.0 37.0 37.0 18-19 35.897999999999996 37.0 37.0 37.0 37.0 37.0 20-21 35.876999999999995 37.0 37.0 37.0 37.0 37.0 22-23 35.85525 37.0 37.0 37.0 37.0 37.0 24-25 35.85275 37.0 37.0 37.0 37.0 37.0 26-27 35.69625 37.0 37.0 37.0 37.0 37.0 28-29 35.67775 37.0 37.0 37.0 37.0 37.0 30-31 35.68625 37.0 37.0 37.0 37.0 37.0 32-33 35.686499999999995 37.0 37.0 37.0 37.0 37.0 34-35 35.6255 37.0 37.0 37.0 37.0 37.0 36-37 35.6935967983992 37.0 37.0 37.0 37.0 37.0 38-39 35.78539269634817 37.0 37.0 37.0 37.0 37.0 40-41 35.636318159079536 37.0 37.0 37.0 37.0 37.0 42-43 35.60605302651325 37.0 37.0 37.0 37.0 37.0 44-45 35.5567783891946 37.0 37.0 37.0 37.0 37.0 46-47 35.68734367183592 37.0 37.0 37.0 37.0 37.0 48-49 35.580540270135074 37.0 37.0 37.0 37.0 37.0 50-51 35.56178089044522 37.0 37.0 37.0 37.0 37.0 52-53 35.58629314657328 37.0 37.0 37.0 37.0 37.0 54-55 35.67708854427214 37.0 37.0 37.0 37.0 37.0 56-57 35.67508754377189 37.0 37.0 37.0 37.0 37.0 58-59 35.64707353676839 37.0 37.0 37.0 37.0 37.0 60-61 35.575537768884445 37.0 37.0 37.0 37.0 37.0 62-63 35.524012006003005 37.0 37.0 37.0 37.0 37.0 64-65 35.56753376688344 37.0 37.0 37.0 37.0 37.0 66-67 35.58854427213606 37.0 37.0 37.0 37.0 37.0 68-69 35.62056028014007 37.0 37.0 37.0 37.0 37.0 70-71 35.57003501750876 37.0 37.0 37.0 37.0 37.0 72-73 35.512756378189096 37.0 37.0 37.0 37.0 37.0 74-75 35.470735367683844 37.0 37.0 37.0 37.0 37.0 76-77 35.508004002001 37.0 37.0 37.0 37.0 37.0 78-79 35.55102551275638 37.0 37.0 37.0 37.0 37.0 80-81 35.50125062531266 37.0 37.0 37.0 37.0 37.0 82-83 35.517258629314654 37.0 37.0 37.0 37.0 37.0 84-85 35.59329664832416 37.0 37.0 37.0 37.0 37.0 86-87 35.42271135567784 37.0 37.0 37.0 37.0 37.0 88-89 35.49274637318659 37.0 37.0 37.0 37.0 37.0 90-91 35.455227613806905 37.0 37.0 37.0 37.0 37.0 92-93 35.51025512756378 37.0 37.0 37.0 37.0 37.0 94-95 35.44747373686843 37.0 37.0 37.0 37.0 37.0 96-97 35.32959333922074 37.0 37.0 37.0 37.0 37.0 98-99 35.35038383571931 37.0 37.0 37.0 37.0 37.0 100-101 35.223745439859776 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 2.0 24 2.0 25 10.0 26 16.0 27 19.0 28 27.0 29 46.0 30 70.0 31 108.0 32 118.0 33 174.0 34 221.0 35 456.0 36 2188.0 37 539.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.06503251625813 12.981490745372687 15.582791395697848 41.37068534267134 2 26.538269134567283 18.684342171085543 29.864932466233117 24.912456228114056 3 27.03851925962982 21.135567783891947 22.061030515257627 29.764882441220607 4 27.188594297148573 27.313656828414207 17.38369184592296 28.114057028514257 5 29.214607303651825 28.564282141070535 19.259629814907452 22.961480740370185 6 22.686343171585793 31.040520260130066 19.534767383691847 26.738369184592298 7 21.61080540270135 15.057528764382191 35.24262131065532 28.08904452226113 8 24.337168584292147 18.78439219609805 23.06153076538269 33.81690845422711 9 22.611305652826413 18.78439219609805 27.238619309654826 31.36568284142071 10-11 26.625812906453227 26.013006503251624 18.959479739869938 28.40170085042521 12-13 24.68734367183592 21.135567783891947 24.187093546773387 29.989994997498748 14-15 25.512756378189096 22.311155577788895 23.611805902951478 28.564282141070535 16-17 26.96348174087044 22.52376188094047 22.24862431215608 28.264132066033014 18-19 26.113056528264135 22.698849424712357 22.811405702851424 28.376688344172084 20-21 25.475237618809405 23.336668334167083 22.548774387193596 28.639319659829916 22-23 26.23811905952976 23.24912456228114 22.32366183091546 28.189094547273637 24-25 26.788394197098548 22.736368184092047 23.17408704352176 27.301150575287643 26-27 25.15007503751876 24.16208104052026 23.3991995997999 27.288644322161083 28-29 25.72536268134067 22.436218109054526 23.47423711855928 28.36418209104552 30-31 26.91345672836418 22.011005502751377 23.486743371685844 27.5887943971986 32-33 25.72536268134067 22.823911955977987 24.362181090545274 27.088544272136065 34-35 27.00100050025013 22.52376188094047 22.386193096548272 28.08904452226113 36-37 26.613306653326664 23.08654327163582 22.161080540270135 28.139069534767387 38-39 25.67533766883442 22.36118059029515 23.19909954977489 28.76438219109555 40-41 27.03851925962982 22.586293146573286 22.36118059029515 28.01400700350175 42-43 26.138069034517258 22.873936968484244 23.92446223111556 27.063531765882942 44-45 26.425712856428213 22.886443221610804 21.99849924962481 28.68934467233617 46-47 26.663331665832917 23.536768384192097 21.92346173086543 27.876438219109556 48-49 26.663331665832917 22.998999499749875 22.198599299649825 28.139069534767387 50-51 26.43821910955478 23.36168084042021 22.936468234117058 27.263631815907953 52-53 27.026013006503252 23.6368184092046 21.673336668334166 27.66383191595798 54-55 26.900950475237618 22.36118059029515 23.036518259129565 27.70135067533767 56-57 26.825912956478238 23.224112056028016 22.26113056528264 27.688844422211105 58-59 27.326163081540773 22.661330665332667 22.836418209104554 27.176088044022013 60-61 26.663331665832917 22.11105552776388 23.58679339669835 27.63881940970485 62-63 26.25062531265633 23.08654327163582 22.211105552776388 28.451725862931465 64-65 27.163581790895446 22.123561780890444 21.99849924962481 28.714357178589296 66-67 26.988494247123562 22.723861930965484 22.273636818409205 28.01400700350175 68-69 27.00100050025013 22.0360180090045 22.236118059029515 28.72686343171586 70-71 27.776388194097045 22.136068034017008 22.761380690345174 27.326163081540773 72-73 26.96348174087044 23.24912456228114 22.436218109054526 27.351175587793897 74-75 27.326163081540773 21.98599299649825 22.348674337168582 28.339169584792394 76-77 27.838919459729865 23.23661830915458 21.52326163081541 27.40120060030015 78-79 27.651325662831418 23.09904952476238 21.623311655827916 27.62631315657829 80-81 27.026013006503252 23.28664332166083 21.510755377688845 28.176588294147077 82-83 28.264132066033014 22.623811905952977 21.98599299649825 27.126063031515756 84-85 27.75137568784392 21.335667833916958 22.623811905952977 28.289144572286144 86-87 26.750875437718857 23.149074537268636 21.96098049024512 28.139069534767387 88-89 28.42671335667834 23.386693346673336 21.373186593296648 26.813406703351678 90-91 26.613306653326664 22.461230615307652 22.486243121560783 28.4392196098049 92-93 26.500750375187593 22.36118059029515 22.56128064032016 28.5767883941971 94-95 27.201100550275136 21.785892946473236 22.336168084042022 28.676838419209606 96-97 26.85521211362783 22.96333375046928 21.499186584908024 28.682267550994865 98-99 27.13905437951578 21.54899226771454 22.956014704018255 28.355938648751426 100-101 27.92709298733395 9.514983008958913 27.757182576459684 34.80074142724745 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.5 27 3.0 28 1.5 29 1.0 30 3.5 31 4.5 32 7.5 33 15.0 34 18.0 35 24.0 36 29.0 37 37.5 38 57.0 39 64.0 40 78.0 41 93.5 42 102.5 43 112.5 44 117.0 45 140.5 46 133.5 47 127.0 48 142.0 49 140.5 50 132.0 51 116.0 52 114.0 53 118.0 54 121.0 55 106.0 56 88.5 57 84.5 58 80.5 59 83.5 60 96.5 61 101.5 62 93.0 63 91.0 64 96.5 65 95.0 66 94.5 67 100.0 68 89.5 69 83.0 70 92.5 71 88.5 72 73.0 73 61.0 74 55.0 75 46.0 76 37.5 77 32.5 78 24.5 79 14.0 80 10.0 81 8.5 82 4.0 83 3.5 84 2.5 85 1.5 86 1.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 2.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 1.0 96-97 19.0 98-99 311.0 100-101 3667.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.18241042345277 84.89999999999999 2 7.166123778501629 13.200000000000001 3 0.5700325732899023 1.575 4 0.05428881650380022 0.2 5 0.02714440825190011 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380567 spots for SRR21853424.sra Written 380567 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra Read 380563 spots for SRR21853424.sra Written 380563 spots for SRR21853424.sra SRR ids: ['SRR21853424.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cpwhvznj SRR21853424.sra spots: 7611264 blocks: [[1, 380563], [380564, 761126], [761127, 1141689], [1141690, 1522252], [1522253, 1902815], [1902816, 2283378], [2283379, 2663941], [2663942, 3044504], [3044505, 3425067], [3425068, 3805630], [3805631, 4186193], [4186194, 4566756], [4566757, 4947319], [4947320, 5327882], [5327883, 5708445], [5708446, 6089008], [6089009, 6469571], [6469572, 6850134], [6850135, 7230697], [7230698, 7611264]] SRR21853424 file size 2046881 SRR21853424 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853424 SRR21853424_1.fastq Input file: SRR21853424_1.fastq trimmed: SRR21853424-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:27:40 2024 >> started Fri Dec 6 14:27:43 2024 >> done (3.770s) 7611264 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 13509 ( 0.18%) empty reads filtered out after trimming by size control 7597755 (99.82%) reads available; of these: 284 ( 0.00%) trimmed reads available after processing 7597471 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 1 0.00% 26 1 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 7 0.00% 32 2 0.00% 33 5 0.00% 34 1 0.00% 35 16 0.00% 36 17 0.00% 37 15 0.00% 38 12 0.00% 39 15 0.00% 40 13 0.00% 41 14 0.00% 42 18 0.00% 43 23 0.00% 44 21 0.00% 45 12 0.00% 46 22 0.00% 47 20 0.00% 48 12 0.00% 49 14 0.00% 50 26 0.00% 51 30 0.00% 52 17 0.00% 53 23 0.00% 54 23 0.00% 55 26 0.00% 56 19 0.00% 57 21 0.00% 58 27 0.00% 59 34 0.00% 60 31 0.00% 61 42 0.00% 62 37 0.00% 63 28 0.00% 64 27 0.00% 65 37 0.00% 66 39 0.00% 67 31 0.00% 68 30 0.00% 69 31 0.00% 70 31 0.00% 71 27 0.00% 72 35 0.00% 73 16 0.00% 74 44 0.00% 75 26 0.00% 76 40 0.00% 77 41 0.00% 78 39 0.00% 79 50 0.00% 80 53 0.00% 81 42 0.00% 82 46 0.00% 83 49 0.00% 84 49 0.00% 85 64 0.00% 86 52 0.00% 87 69 0.00% 88 80 0.00% 89 64 0.00% 90 90 0.00% 91 217 0.00% 92 91 0.00% 93 144 0.00% 94 447 0.01% 95 1964 0.03% 96 9974 0.13% 97 30876 0.41% 98 123170 1.62% 99 495471 6.52% 100 1589957 20.93% 101 5343594 70.33% 7597755 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=20 prefix-density=0.54 prefix-fanout=1.8 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=22 fanout-score=228.15 fanout-score-rank=1 prefix-density=1.24 prefix-fanout=24.1 sequence=CGCCGCCGCCGC Started job on | Dec 06 14:28:00 Started mapping on | Dec 06 14:28:00 Finished on | Dec 06 14:28:10 Mapping speed, Million of reads per hour | 2735.19 Number of input reads | 7597755 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 7146594 Uniquely mapped reads % | 94.06% Average mapped length | 100.29 Number of splices: Total | 2247511 Number of splices: Annotated (sjdb) | 2142364 Number of splices: GT/AG | 2215791 Number of splices: GC/AG | 26910 Number of splices: AT/AC | 1088 Number of splices: Non-canonical | 3722 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.00% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 202950 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 150464 % of reads mapped to too many loci | 1.98% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.00% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 248211 248211 248211 N_multimapping 202950 202950 202950 N_noFeature 214260 3634165 3635443 N_ambiguous 108357 11888 5920 UnstrandedReadsAssigned:6823977 PositiveStrandReadsAssigned:3500541 NegativeStrandReadsAssigned:3505231 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853424 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853424-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,597,755 reads, 7,002,510 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,022 rounds 52973 SRR21853424.ke.tsv 35125 SRR21853424.se.tsv 88098 total ==> SRR21853424.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 7.24586 1.74093 PNS24249 1928 1829 84.9693 10.548 PNS24246 1044 945 7.24586 1.74093 PNS24248 1044 945 7.24586 1.74093 PNS24244 1471 1372 10.2932 1.7034 PNS24243 293 194 4 4.68145 KQK14069 1603 1504 468.855 70.7804 KQK14071 474 375 75.1183 45.4817 ==> SRR21853424.se.tsv <== BRADI_1g14170v3 569 BRADI_1g53295v3 20 BRADI_1g59795v3 62 BRADI_1g07683v3 0 BRADI_1g00485v3 26 BRADI_1g20270v3 683 BRADI_1g74790v3 82 BRADI_1g09890v3 5 BRADI_1g77505v3 72 BRADI_1g48960v3 0 SRR21853424 completed mapping pipeline successfully