Starting /dee2/code/volunteer_pipeline.sh SRR21853425 current disk space = 1550446247936 free memory = 1598506440 SRR21853425 SRAfilesize f14a96b747298ff536c24f3f7d7a5eae SRR21853425.sra SRR21853425.sra file validated SRR21853425 is single end SRR21853425 is conventional basespace SRR21853425 read1 length is 54-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853425_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 54-101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.807 37.0 37.0 37.0 25.0 37.0 2 34.62625 37.0 37.0 37.0 25.0 37.0 3 35.316 37.0 37.0 37.0 37.0 37.0 4 35.505 37.0 37.0 37.0 37.0 37.0 5 35.7545 37.0 37.0 37.0 37.0 37.0 6 35.662 37.0 37.0 37.0 37.0 37.0 7 35.392 37.0 37.0 37.0 37.0 37.0 8 35.8055 37.0 37.0 37.0 37.0 37.0 9 35.72 37.0 37.0 37.0 37.0 37.0 10-11 35.80575 37.0 37.0 37.0 37.0 37.0 12-13 35.71325 37.0 37.0 37.0 37.0 37.0 14-15 35.7325 37.0 37.0 37.0 37.0 37.0 16-17 35.6625 37.0 37.0 37.0 37.0 37.0 18-19 35.61725 37.0 37.0 37.0 37.0 37.0 20-21 35.569500000000005 37.0 37.0 37.0 37.0 37.0 22-23 35.641 37.0 37.0 37.0 37.0 37.0 24-25 35.55225 37.0 37.0 37.0 37.0 37.0 26-27 35.479 37.0 37.0 37.0 37.0 37.0 28-29 35.42400000000001 37.0 37.0 37.0 37.0 37.0 30-31 35.41375 37.0 37.0 37.0 37.0 37.0 32-33 35.39575 37.0 37.0 37.0 37.0 37.0 34-35 35.420500000000004 37.0 37.0 37.0 37.0 37.0 36-37 35.354749999999996 37.0 37.0 37.0 37.0 37.0 38-39 35.284 37.0 37.0 37.0 31.0 37.0 40-41 35.37525 37.0 37.0 37.0 37.0 37.0 42-43 35.272499999999994 37.0 37.0 37.0 31.0 37.0 44-45 35.30575 37.0 37.0 37.0 37.0 37.0 46-47 35.29675 37.0 37.0 37.0 37.0 37.0 48-49 35.241249999999994 37.0 37.0 37.0 31.0 37.0 50-51 35.241 37.0 37.0 37.0 31.0 37.0 52-53 35.39725 37.0 37.0 37.0 37.0 37.0 54-55 35.3480512628157 37.0 37.0 37.0 31.0 37.0 56-57 35.34758689672418 37.0 37.0 37.0 31.0 37.0 58-59 35.19104776194048 37.0 37.0 37.0 31.0 37.0 60-61 35.25031257814454 37.0 37.0 37.0 31.0 37.0 62-63 35.242060515128784 37.0 37.0 37.0 25.0 37.0 64-65 35.270567641910475 37.0 37.0 37.0 31.0 37.0 66-67 35.10327581895474 37.0 37.0 37.0 25.0 37.0 68-69 35.06576644161041 37.0 37.0 37.0 25.0 37.0 70-71 34.98499624906226 37.0 37.0 37.0 25.0 37.0 72-73 35.12628157039259 37.0 37.0 37.0 25.0 37.0 74-75 35.13278319579895 37.0 37.0 37.0 25.0 37.0 76-77 35.08802200550137 37.0 37.0 37.0 25.0 37.0 78-79 35.02575643910978 37.0 37.0 37.0 25.0 37.0 80-81 35.100775193798455 37.0 37.0 37.0 25.0 37.0 82-83 35.127031757939484 37.0 37.0 37.0 25.0 37.0 84-85 35.11827956989247 37.0 37.0 37.0 25.0 37.0 86-87 35.14003500875219 37.0 37.0 37.0 25.0 37.0 88-89 35.15378844711178 37.0 37.0 37.0 25.0 37.0 90-91 35.04926231557889 37.0 37.0 37.0 25.0 37.0 92-93 35.11236236236236 37.0 37.0 37.0 25.0 37.0 94-95 35.00375469336671 37.0 37.0 37.0 25.0 37.0 96-97 34.95193430608829 37.0 37.0 37.0 25.0 37.0 98-99 35.05923433789536 37.0 37.0 37.0 25.0 37.0 100-101 35.015714940705486 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 11.0 25 18.0 26 19.0 27 23.0 28 33.0 29 82.0 30 91.0 31 120.0 32 155.0 33 183.0 34 301.0 35 638.0 36 1957.0 37 365.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.099999999999998 12.5 15.85 41.55 2 26.09688054780624 18.94496576211007 28.988080142023843 25.97007354805985 3 26.275 23.875 21.975 27.875 4 30.275000000000002 26.900000000000002 16.1 26.724999999999998 5 29.275000000000002 28.599999999999998 19.0 23.125 6 22.875 31.624999999999996 19.475 26.025 7 20.575 15.125 37.55 26.75 8 23.65 18.875 24.525 32.95 9 21.9 20.474999999999998 27.0 30.625000000000004 10-11 26.650000000000002 25.7875 18.95 28.6125 12-13 23.974999999999998 20.525 25.4875 30.012499999999996 14-15 24.962500000000002 23.474999999999998 23.125 28.4375 16-17 25.7375 23.1125 23.175 27.975 18-19 24.675 22.95 23.4625 28.9125 20-21 26.187500000000004 23.875 22.25 27.6875 22-23 26.3 22.35 22.912499999999998 28.4375 24-25 26.924999999999997 22.7375 23.1125 27.224999999999998 26-27 26.25 23.200000000000003 22.875 27.675 28-29 26.8375 23.3625 22.275 27.525 30-31 25.75 22.675 23.625 27.950000000000003 32-33 25.587500000000002 24.2625 22.400000000000002 27.750000000000004 34-35 26.6125 23.25 22.2125 27.925 36-37 26.237500000000004 24.712500000000002 21.525 27.525 38-39 25.4 23.1875 22.975 28.4375 40-41 26.400000000000002 23.375 22.3125 27.9125 42-43 26.187500000000004 23.7125 23.200000000000003 26.900000000000002 44-45 27.3125 22.525000000000002 21.7375 28.425 46-47 27.075 23.65 22.3375 26.937499999999996 48-49 25.8 23.025000000000002 23.2625 27.9125 50-51 26.375 23.1375 22.3625 28.125 52-53 26.625 22.925 21.8 28.65 54-55 26.078259782472806 23.1278909863733 22.365295661957745 28.42855356919615 56-57 26.669167291822955 22.843210802700675 23.355838959739934 27.131782945736433 58-59 26.819204801200303 22.768192048012004 22.843210802700675 27.569392348087025 60-61 26.456614153538382 23.305826456614152 23.48087021755439 26.756689172293076 62-63 27.38184546136534 21.75543885971493 23.468367091772944 27.394348587146787 64-65 27.131782945736433 22.468117029257314 22.643160790197552 27.7569392348087 66-67 25.64391097774444 24.043510877719427 22.53063265816454 27.781945486371594 68-69 27.031757939484873 23.40585146286572 21.99299824956239 27.569392348087025 70-71 27.44436109027257 22.568142035508878 21.842960740185045 28.14453613403351 72-73 26.469117279319832 23.50587646911728 22.455613903475868 27.569392348087025 74-75 27.156789197299325 22.693173293323333 21.9679919979995 28.182045511377847 76-77 26.331582895723933 22.680670167541887 22.930732683170792 28.057014253563388 78-79 26.056514128532132 23.605901475368842 22.280570142535634 28.057014253563388 80-81 26.531632908227053 24.06851712928232 22.005501375343837 27.394348587146787 82-83 27.219304826206553 22.73068267066767 22.118029507376843 27.93198299574894 84-85 26.994248562140534 22.793198299574893 22.66816704176044 27.544386096524132 86-87 27.25681420355089 23.10577644411103 22.31807951987997 27.319329832458116 88-89 27.33183295823956 22.780695173793447 22.74318579644911 27.144286071517882 90-91 27.28182045511378 22.43060765191298 22.605651412853213 27.68192048012003 92-93 26.876876876876878 23.736236236236234 21.634134134134133 27.75275275275275 94-95 27.19649561952441 22.615769712140175 22.377972465581976 27.80976220275344 96-97 26.907177752724536 22.673180508580735 22.497807841663537 27.92183389703119 98-99 27.33265720081136 22.477180527383368 22.692697768762677 27.497464503042597 100-101 28.83865939204988 10.007794232268122 27.092751363990647 34.06079501169135 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 3.5 29 5.0 30 3.0 31 2.5 32 5.5 33 10.0 34 13.5 35 21.0 36 32.5 37 41.0 38 55.0 39 74.0 40 87.0 41 105.0 42 118.0 43 122.5 44 138.5 45 152.5 46 149.0 47 136.0 48 129.0 49 133.0 50 130.0 51 113.5 52 112.0 53 106.0 54 99.0 55 91.5 56 87.0 57 95.0 58 90.5 59 97.0 60 99.0 61 95.0 62 98.5 63 94.0 64 88.5 65 93.5 66 92.0 67 89.5 68 92.0 69 95.0 70 84.0 71 74.5 72 71.5 73 59.5 74 56.0 75 44.5 76 29.5 77 26.0 78 21.5 79 15.5 80 11.0 81 5.0 82 3.0 83 1.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.425 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 3.0 92 0.0 93 1.0 94 0.0 95 2.0 96 3.0 97 19.0 98 54.0 99 284.0 100 851.0 101 2782.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.25 #Duplication Level Percentage of deduplicated Percentage of total 1 93.2975871313673 87.0 2 6.3002680965147455 11.75 3 0.37533512064343166 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026809651474530835 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 8 0.2 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754740 spots for SRR21853425.sra Written 754740 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra Read 754721 spots for SRR21853425.sra Written 754721 spots for SRR21853425.sra SRR ids: ['SRR21853425.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m1lh73u_ SRR21853425.sra spots: 15094439 blocks: [[1, 754721], [754722, 1509442], [1509443, 2264163], [2264164, 3018884], [3018885, 3773605], [3773606, 4528326], [4528327, 5283047], [5283048, 6037768], [6037769, 6792489], [6792490, 7547210], [7547211, 8301931], [8301932, 9056652], [9056653, 9811373], [9811374, 10566094], [10566095, 11320815], [11320816, 12075536], [12075537, 12830257], [12830258, 13584978], [13584979, 14339699], [14339700, 15094439]] SRR21853425 file size 4064947 SRR21853425 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853425 SRR21853425_1.fastq Input file: SRR21853425_1.fastq trimmed: SRR21853425-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:28:24 2024 >> started Fri Dec 6 14:28:31 2024 >> done (7.742s) 15094439 reads processed; of these: 7 ( 0.00%) short reads filtered out after trimming by size control 43197 ( 0.29%) empty reads filtered out after trimming by size control 15051235 (99.71%) reads available; of these: 457 ( 0.00%) trimmed reads available after processing 15050778 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 3 0.00% 24 7 0.00% 25 8 0.00% 26 4 0.00% 27 3 0.00% 28 6 0.00% 29 6 0.00% 30 5 0.00% 31 9 0.00% 32 2 0.00% 33 10 0.00% 34 8 0.00% 35 66 0.00% 36 84 0.00% 37 64 0.00% 38 89 0.00% 39 76 0.00% 40 66 0.00% 41 71 0.00% 42 84 0.00% 43 73 0.00% 44 103 0.00% 45 82 0.00% 46 101 0.00% 47 96 0.00% 48 104 0.00% 49 84 0.00% 50 107 0.00% 51 105 0.00% 52 120 0.00% 53 110 0.00% 54 113 0.00% 55 116 0.00% 56 110 0.00% 57 90 0.00% 58 103 0.00% 59 130 0.00% 60 128 0.00% 61 147 0.00% 62 124 0.00% 63 162 0.00% 64 129 0.00% 65 146 0.00% 66 168 0.00% 67 161 0.00% 68 133 0.00% 69 149 0.00% 70 116 0.00% 71 155 0.00% 72 153 0.00% 73 156 0.00% 74 154 0.00% 75 154 0.00% 76 184 0.00% 77 166 0.00% 78 164 0.00% 79 209 0.00% 80 174 0.00% 81 213 0.00% 82 217 0.00% 83 182 0.00% 84 197 0.00% 85 238 0.00% 86 236 0.00% 87 273 0.00% 88 278 0.00% 89 323 0.00% 90 382 0.00% 91 719 0.00% 92 299 0.00% 93 382 0.00% 94 1196 0.01% 95 3971 0.03% 96 20811 0.14% 97 61797 0.41% 98 248081 1.65% 99 986562 6.55% 100 3164912 21.03% 101 10554303 70.12% 15051235 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=21 prefix-density=0.41 prefix-fanout=2.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=23 fanout-score=219.77 fanout-score-rank=1 prefix-density=1.21 prefix-fanout=23.8 sequence=CGCCGCCGCCGC Started job on | Dec 06 14:28:47 Started mapping on | Dec 06 14:28:47 Finished on | Dec 06 14:29:07 Mapping speed, Million of reads per hour | 2709.22 Number of input reads | 15051235 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 14142427 Uniquely mapped reads % | 93.96% Average mapped length | 100.26 Number of splices: Total | 4517578 Number of splices: Annotated (sjdb) | 4304356 Number of splices: GT/AG | 4452277 Number of splices: GC/AG | 54869 Number of splices: AT/AC | 2207 Number of splices: Non-canonical | 8225 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.00% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 407086 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 288703 % of reads mapped to too many loci | 1.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.12% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 501722 501722 501722 N_multimapping 407086 407086 407086 N_noFeature 428095 7177678 7210875 N_ambiguous 215081 22586 11898 UnstrandedReadsAssigned:13499251 PositiveStrandReadsAssigned:6942163 NegativeStrandReadsAssigned:6919654 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853425 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853425-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,051,235 reads, 13,843,058 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52973 SRR21853425.ke.tsv 35125 SRR21853425.se.tsv 88098 total ==> SRR21853425.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 30.6138 3.70898 PNS24249 1928 1829 167.871 10.5082 PNS24246 1044 945 30.6138 3.70898 PNS24248 1044 945 30.6138 3.70898 PNS24244 1471 1372 6.28763 0.524687 PNS24243 293 194 7 4.13109 KQK14069 1603 1504 862.427 65.6512 KQK14071 474 375 120.382 36.7534 ==> SRR21853425.se.tsv <== BRADI_1g14170v3 1145 BRADI_1g53295v3 41 BRADI_1g59795v3 165 BRADI_1g07683v3 0 BRADI_1g00485v3 26 BRADI_1g20270v3 1361 BRADI_1g74790v3 191 BRADI_1g09890v3 8 BRADI_1g77505v3 164 BRADI_1g48960v3 0 SRR21853425 completed mapping pipeline successfully