Starting /dee2/code/volunteer_pipeline.sh SRR21853426 current disk space = 1550448050176 free memory = 1597936084 SRR21853426 SRAfilesize 1c6e829c52d93ef9da3af171217efcc6 SRR21853426.sra SRR21853426.sra file validated SRR21853426 is single end SRR21853426 is conventional basespace SRR21853426 read1 length is 88-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853426_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 88-101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.232 37.0 37.0 37.0 25.0 37.0 2 35.6755 37.0 37.0 37.0 37.0 37.0 3 35.7655 37.0 37.0 37.0 37.0 37.0 4 35.9055 37.0 37.0 37.0 37.0 37.0 5 36.018 37.0 37.0 37.0 37.0 37.0 6 35.9865 37.0 37.0 37.0 37.0 37.0 7 35.813 37.0 37.0 37.0 37.0 37.0 8 35.9475 37.0 37.0 37.0 37.0 37.0 9 35.9145 37.0 37.0 37.0 37.0 37.0 10-11 35.98175 37.0 37.0 37.0 37.0 37.0 12-13 36.01175 37.0 37.0 37.0 37.0 37.0 14-15 35.924 37.0 37.0 37.0 37.0 37.0 16-17 35.828500000000005 37.0 37.0 37.0 37.0 37.0 18-19 35.861999999999995 37.0 37.0 37.0 37.0 37.0 20-21 35.795 37.0 37.0 37.0 37.0 37.0 22-23 35.875249999999994 37.0 37.0 37.0 37.0 37.0 24-25 35.726749999999996 37.0 37.0 37.0 37.0 37.0 26-27 35.72425 37.0 37.0 37.0 37.0 37.0 28-29 35.75175 37.0 37.0 37.0 37.0 37.0 30-31 35.7355 37.0 37.0 37.0 37.0 37.0 32-33 35.7125 37.0 37.0 37.0 37.0 37.0 34-35 35.711 37.0 37.0 37.0 37.0 37.0 36-37 35.68075 37.0 37.0 37.0 37.0 37.0 38-39 35.694 37.0 37.0 37.0 37.0 37.0 40-41 35.711749999999995 37.0 37.0 37.0 37.0 37.0 42-43 35.67575 37.0 37.0 37.0 37.0 37.0 44-45 35.524 37.0 37.0 37.0 37.0 37.0 46-47 35.70875 37.0 37.0 37.0 37.0 37.0 48-49 35.54375 37.0 37.0 37.0 37.0 37.0 50-51 35.583 37.0 37.0 37.0 37.0 37.0 52-53 35.591499999999996 37.0 37.0 37.0 37.0 37.0 54-55 35.497249999999994 37.0 37.0 37.0 37.0 37.0 56-57 35.564750000000004 37.0 37.0 37.0 37.0 37.0 58-59 35.55625 37.0 37.0 37.0 37.0 37.0 60-61 35.568 37.0 37.0 37.0 37.0 37.0 62-63 35.587 37.0 37.0 37.0 37.0 37.0 64-65 35.54475 37.0 37.0 37.0 37.0 37.0 66-67 35.52175 37.0 37.0 37.0 37.0 37.0 68-69 35.4745 37.0 37.0 37.0 37.0 37.0 70-71 35.6095 37.0 37.0 37.0 37.0 37.0 72-73 35.49925 37.0 37.0 37.0 37.0 37.0 74-75 35.508 37.0 37.0 37.0 37.0 37.0 76-77 35.4245 37.0 37.0 37.0 37.0 37.0 78-79 35.37375 37.0 37.0 37.0 37.0 37.0 80-81 35.539500000000004 37.0 37.0 37.0 37.0 37.0 82-83 35.444 37.0 37.0 37.0 37.0 37.0 84-85 35.515249999999995 37.0 37.0 37.0 37.0 37.0 86-87 35.400000000000006 37.0 37.0 37.0 37.0 37.0 88-89 35.39806657914478 37.0 37.0 37.0 37.0 37.0 90-91 35.49249624812406 37.0 37.0 37.0 37.0 37.0 92-93 35.40620310155077 37.0 37.0 37.0 37.0 37.0 94-95 35.467850888166126 37.0 37.0 37.0 37.0 37.0 96-97 35.36458853643222 37.0 37.0 37.0 37.0 37.0 98-99 35.32061636513004 37.0 37.0 37.0 31.0 37.0 100-101 35.2210075787134 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 1.0 23 6.0 24 4.0 25 9.0 26 11.0 27 32.0 28 37.0 29 38.0 30 54.0 31 75.0 32 129.0 33 190.0 34 282.0 35 484.0 36 2101.0 37 544.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.950000000000003 11.450000000000001 18.8 41.8 2 27.825 18.475 29.925 23.775 3 27.975 23.075000000000003 21.75 27.200000000000003 4 27.650000000000002 27.85 18.675 25.825 5 29.675 29.049999999999997 19.35 21.925 6 21.825 33.125 18.35 26.700000000000003 7 21.525 15.35 37.15 25.974999999999998 8 23.400000000000002 18.875 24.625 33.1 9 22.15 21.075 26.224999999999998 30.55 10-11 26.187500000000004 25.8125 19.5875 28.4125 12-13 24.525 20.6125 25.85 29.012500000000003 14-15 25.05 22.575 24.462500000000002 27.9125 16-17 24.95 22.6875 23.599999999999998 28.762500000000003 18-19 26.2875 22.8875 23.150000000000002 27.675 20-21 25.4625 23.4125 23.150000000000002 27.975 22-23 25.474999999999998 23.275000000000002 22.475 28.775000000000002 24-25 25.825 23.7125 22.8875 27.575 26-27 26.3 24.2625 22.2125 27.224999999999998 28-29 26.625 23.8375 22.8625 26.674999999999997 30-31 24.887500000000003 23.849999999999998 23.1875 28.075 32-33 25.887500000000003 24.275 22.0125 27.825 34-35 26.150000000000002 23.3125 23.4625 27.075 36-37 25.275 24.1875 22.3 28.237499999999997 38-39 26.137500000000003 23.825 22.825 27.212500000000002 40-41 25.937500000000004 22.8 22.8 28.462500000000002 42-43 25.4875 23.962500000000002 23.3125 27.237499999999997 44-45 26.3625 23.4125 22.275 27.950000000000003 46-47 26.400000000000002 23.775 21.6625 28.1625 48-49 25.775 23.35 22.875 28.000000000000004 50-51 26.375 22.75 22.8 28.075 52-53 26.05 23.8375 21.4375 28.675 54-55 26.450000000000003 23.3 22.912499999999998 27.3375 56-57 26.8625 22.6 22.412499999999998 28.125 58-59 25.825 23.1625 23.075000000000003 27.9375 60-61 25.637500000000003 23.2625 22.8625 28.237499999999997 62-63 27.3125 23.1375 22.425 27.125 64-65 26.325 22.45 22.925 28.299999999999997 66-67 26.237500000000004 23.075000000000003 22.400000000000002 28.287499999999998 68-69 26.337500000000002 23.5 21.8625 28.299999999999997 70-71 27.487499999999997 22.787499999999998 22.325 27.400000000000002 72-73 26.137500000000003 23.0375 21.85 28.975 74-75 26.400000000000002 22.4875 23.4875 27.625 76-77 26.650000000000002 22.5875 22.675 28.0875 78-79 25.624999999999996 23.2125 22.8125 28.349999999999998 80-81 27.1375 22.4875 22.45 27.925 82-83 27.187499999999996 22.400000000000002 22.537499999999998 27.875 84-85 26.6 22.162499999999998 22.775000000000002 28.462500000000002 86-87 26.087500000000002 23.5125 21.15 29.25 88-89 27.265908238529818 22.490311288911112 21.827728466058257 28.416052006500813 90-91 26.738369184592298 22.973986993496748 22.63631815907954 27.651325662831418 92-93 27.138569284642323 23.011505752876438 22.07353676838419 27.776388194097045 94-95 27.207905929447087 22.729547160370277 21.603702777082813 28.458844133099824 96-97 27.053079619429145 22.684026039058587 22.346019028542813 27.916875312969452 98-99 26.31712580931827 22.838644153865683 22.41970293258855 28.424527104227497 100-101 27.653283535636476 10.317460317460316 27.342047930283226 34.68720821661998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.0 23 1.5 24 1.5 25 0.0 26 0.0 27 1.5 28 3.5 29 5.0 30 7.0 31 12.0 32 17.5 33 17.0 34 20.5 35 24.0 36 26.0 37 40.5 38 50.0 39 61.5 40 95.0 41 114.0 42 112.5 43 117.0 44 131.0 45 140.0 46 138.5 47 145.0 48 137.0 49 120.0 50 119.0 51 116.5 52 106.5 53 95.5 54 97.5 55 104.5 56 102.0 57 95.5 58 89.5 59 92.0 60 98.0 61 98.0 62 93.0 63 98.0 64 94.0 65 83.5 66 87.5 67 93.0 68 92.0 69 86.5 70 82.5 71 81.5 72 73.0 73 63.0 74 53.0 75 47.0 76 37.5 77 22.0 78 23.5 79 16.0 80 5.0 81 5.0 82 4.5 83 2.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 1.0 94 0.0 95 1.0 96 4.0 97 14.0 98 79.0 99 269.0 100 834.0 101 2796.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.35 #Duplication Level Percentage of deduplicated Percentage of total 1 92.3389279913373 85.275 2 7.038440714672442 13.0 3 0.6226312939902545 1.725 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.05 9 0.0 0.0 0.0 0.0 0.05 10-11 0.0 0.0 0.0 0.0 0.05 12-13 0.0 0.0 0.0 0.0 0.05 14-15 0.0 0.0 0.0 0.0 0.05 16-17 0.0 0.0 0.0 0.0 0.05 18-19 0.0 0.0 0.0 0.0 0.05 20-21 0.0 0.0 0.0 0.0 0.05 22-23 0.0 0.0 0.0 0.0 0.05 24-25 0.0 0.0 0.0 0.0 0.05 26-27 0.0 0.0 0.0 0.0 0.05 28-29 0.0 0.0 0.0 0.0 0.05 30-31 0.0 0.0 0.0 0.0 0.05 32-33 0.0 0.0 0.0 0.0 0.05 34-35 0.0 0.0 0.0 0.0 0.05 36-37 0.0 0.0 0.0 0.0 0.05 38-39 0.0 0.0 0.0 0.0 0.05 40-41 0.0 0.0 0.0 0.0 0.05 42-43 0.0 0.0 0.0 0.0 0.05 44-45 0.0 0.0 0.0 0.0 0.05 46-47 0.0 0.0 0.0 0.0 0.05 48-49 0.0 0.0 0.0 0.0 0.05 50-51 0.0 0.0 0.0 0.0 0.05 52-53 0.0 0.0 0.0 0.0 0.05 54-55 0.0 0.0 0.0 0.0 0.05 56-57 0.0 0.0 0.0 0.0 0.05 58-59 0.0 0.0 0.0 0.0 0.05 60-61 0.0 0.0 0.0 0.0 0.05 62-63 0.0 0.0 0.0 0.0 0.05 64-65 0.0 0.0 0.0 0.0 0.05 66-67 0.0 0.0 0.0 0.0 0.05 68-69 0.0 0.0 0.0 0.0 0.05 70-71 0.0 0.0 0.0 0.0 0.05 72-73 0.0 0.0 0.0 0.0 0.05 74-75 0.0 0.0 0.0 0.0 0.05 76-77 0.0 0.0 0.0 0.0 0.05 78-79 0.0 0.0 0.0 0.0 0.05 80-81 0.0 0.0 0.0 0.0 0.05 82-83 0.0 0.0 0.0 0.0 0.05 84-85 0.0 0.0 0.0 0.0 0.05 86-87 0.0 0.0 0.0 0.0 0.05 88-89 0.0 0.0 0.0 0.0 0.05 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388239 spots for SRR21853426.sra Written 388239 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra Read 388220 spots for SRR21853426.sra Written 388220 spots for SRR21853426.sra SRR ids: ['SRR21853426.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7a7sc2r2 SRR21853426.sra spots: 7764419 blocks: [[1, 388220], [388221, 776440], [776441, 1164660], [1164661, 1552880], [1552881, 1941100], [1941101, 2329320], [2329321, 2717540], [2717541, 3105760], [3105761, 3493980], [3493981, 3882200], [3882201, 4270420], [4270421, 4658640], [4658641, 5046860], [5046861, 5435080], [5435081, 5823300], [5823301, 6211520], [6211521, 6599740], [6599741, 6987960], [6987961, 7376180], [7376181, 7764419]] SRR21853426 file size 2087863 SRR21853426 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853426 SRR21853426_1.fastq Input file: SRR21853426_1.fastq trimmed: SRR21853426-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:28:27 2024 >> started Fri Dec 6 14:28:32 2024 >> done (4.359s) 7764419 reads processed; of these: 4 ( 0.00%) short reads filtered out after trimming by size control 10128 ( 0.13%) empty reads filtered out after trimming by size control 7754287 (99.87%) reads available; of these: 299 ( 0.00%) trimmed reads available after processing 7753988 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 3 0.00% 26 1 0.00% 27 1 0.00% 28 2 0.00% 29 1 0.00% 30 3 0.00% 31 3 0.00% 32 2 0.00% 33 7 0.00% 34 4 0.00% 35 38 0.00% 36 29 0.00% 37 36 0.00% 38 25 0.00% 39 19 0.00% 40 25 0.00% 41 46 0.00% 42 24 0.00% 43 29 0.00% 44 24 0.00% 45 32 0.00% 46 30 0.00% 47 40 0.00% 48 37 0.00% 49 37 0.00% 50 26 0.00% 51 39 0.00% 52 34 0.00% 53 40 0.00% 54 30 0.00% 55 35 0.00% 56 29 0.00% 57 36 0.00% 58 47 0.00% 59 39 0.00% 60 50 0.00% 61 47 0.00% 62 43 0.00% 63 39 0.00% 64 39 0.00% 65 41 0.00% 66 41 0.00% 67 50 0.00% 68 52 0.00% 69 39 0.00% 70 45 0.00% 71 45 0.00% 72 67 0.00% 73 49 0.00% 74 48 0.00% 75 59 0.00% 76 59 0.00% 77 63 0.00% 78 56 0.00% 79 49 0.00% 80 52 0.00% 81 67 0.00% 82 59 0.00% 83 66 0.00% 84 76 0.00% 85 70 0.00% 86 68 0.00% 87 96 0.00% 88 96 0.00% 89 119 0.00% 90 122 0.00% 91 285 0.00% 92 115 0.00% 93 172 0.00% 94 552 0.01% 95 1960 0.03% 96 10504 0.14% 97 31781 0.41% 98 128354 1.66% 99 506880 6.54% 100 1637562 21.12% 101 5433393 70.07% 7754287 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=24 prefix-density=0.50 prefix-fanout=1.8 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.14 sequence-density-rank=16 fanout-score=201.01 fanout-score-rank=1 prefix-density=1.21 prefix-fanout=23.3 sequence=CGCCGCCGCCGC Started job on | Dec 06 14:28:47 Started mapping on | Dec 06 14:28:47 Finished on | Dec 06 14:29:00 Mapping speed, Million of reads per hour | 2147.34 Number of input reads | 7754287 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 7343129 Uniquely mapped reads % | 94.70% Average mapped length | 100.27 Number of splices: Total | 2331831 Number of splices: Annotated (sjdb) | 2218648 Number of splices: GT/AG | 2298914 Number of splices: GC/AG | 27550 Number of splices: AT/AC | 1111 Number of splices: Non-canonical | 4256 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 2.40 Insertion rate per base | 0.00% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 196142 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 118368 % of reads mapped to too many loci | 1.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.03% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 215016 215016 215016 N_multimapping 196142 196142 196142 N_noFeature 226173 3750681 3723050 N_ambiguous 113211 12095 6241 UnstrandedReadsAssigned:7003745 PositiveStrandReadsAssigned:3580353 NegativeStrandReadsAssigned:3613838 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853426 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853426-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,754,287 reads, 7,181,748 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,029 rounds 52973 SRR21853426.ke.tsv 35125 SRR21853426.se.tsv 88098 total ==> SRR21853426.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 8.49241 2.0008 PNS24249 1928 1829 98.9002 12.0389 PNS24246 1044 945 8.49241 2.0008 PNS24248 1044 945 8.49241 2.0008 PNS24244 1471 1372 2.62258 0.425577 PNS24243 293 194 3 3.44289 KQK14069 1603 1504 646.404 95.6886 KQK14071 474 375 83.071 49.3199 ==> SRR21853426.se.tsv <== BRADI_1g14170v3 794 BRADI_1g53295v3 33 BRADI_1g59795v3 91 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 624 BRADI_1g74790v3 101 BRADI_1g09890v3 5 BRADI_1g77505v3 71 BRADI_1g48960v3 0 SRR21853426 completed mapping pipeline successfully