Starting /dee2/code/volunteer_pipeline.sh SRR21853427 current disk space = 1550459645952 free memory = 1597218044 SRR21853427 SRAfilesize efdcf70a0805320d1f8c72e1b5bbf185 SRR21853427.sra SRR21853427.sra file validated SRR21853427 is single end SRR21853427 is conventional basespace SRR21853427 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853427_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.768 37.0 37.0 37.0 25.0 37.0 2 34.67 37.0 37.0 37.0 25.0 37.0 3 35.2065 37.0 37.0 37.0 25.0 37.0 4 35.4835 37.0 37.0 37.0 37.0 37.0 5 35.6655 37.0 37.0 37.0 37.0 37.0 6 35.671 37.0 37.0 37.0 37.0 37.0 7 35.4 37.0 37.0 37.0 37.0 37.0 8 35.7395 37.0 37.0 37.0 37.0 37.0 9 35.842 37.0 37.0 37.0 37.0 37.0 10-11 35.78375 37.0 37.0 37.0 37.0 37.0 12-13 35.58325 37.0 37.0 37.0 37.0 37.0 14-15 35.64375 37.0 37.0 37.0 37.0 37.0 16-17 35.724000000000004 37.0 37.0 37.0 37.0 37.0 18-19 35.61125 37.0 37.0 37.0 37.0 37.0 20-21 35.6565 37.0 37.0 37.0 37.0 37.0 22-23 35.49825 37.0 37.0 37.0 37.0 37.0 24-25 35.57925 37.0 37.0 37.0 37.0 37.0 26-27 35.44675 37.0 37.0 37.0 37.0 37.0 28-29 35.426500000000004 37.0 37.0 37.0 37.0 37.0 30-31 35.407 37.0 37.0 37.0 37.0 37.0 32-33 35.37325 37.0 37.0 37.0 31.0 37.0 34-35 35.412 37.0 37.0 37.0 37.0 37.0 36-37 35.312406203101546 37.0 37.0 37.0 31.0 37.0 38-39 35.44747373686843 37.0 37.0 37.0 37.0 37.0 40-41 35.35367683841921 37.0 37.0 37.0 37.0 37.0 42-43 35.37018509254627 37.0 37.0 37.0 37.0 37.0 44-45 35.27888944472237 37.0 37.0 37.0 31.0 37.0 46-47 35.36918459229615 37.0 37.0 37.0 37.0 37.0 48-49 35.379189594797396 37.0 37.0 37.0 37.0 37.0 50-51 35.14057028514257 37.0 37.0 37.0 25.0 37.0 52-53 35.25944458343758 37.0 37.0 37.0 31.0 37.0 54-55 35.35751813860395 37.0 37.0 37.0 37.0 37.0 56-57 35.301726294721036 37.0 37.0 37.0 37.0 37.0 58-59 35.25494120590443 37.0 37.0 37.0 31.0 37.0 60-61 35.15186389792345 37.0 37.0 37.0 31.0 37.0 62-63 35.15161371028272 37.0 37.0 37.0 25.0 37.0 64-65 35.23067300475357 37.0 37.0 37.0 25.0 37.0 66-67 35.21718478548601 37.0 37.0 37.0 31.0 37.0 68-69 35.16420525657071 37.0 37.0 37.0 25.0 37.0 70-71 35.07083854818523 37.0 37.0 37.0 25.0 37.0 72-73 34.95619524405507 37.0 37.0 37.0 25.0 37.0 74-75 35.08385481852315 37.0 37.0 37.0 25.0 37.0 76-77 35.06057571964956 37.0 37.0 37.0 25.0 37.0 78-79 35.15168961201502 37.0 37.0 37.0 25.0 37.0 80-81 35.11464330413017 37.0 37.0 37.0 25.0 37.0 82-83 35.15419274092616 37.0 37.0 37.0 25.0 37.0 84-85 35.04881101376721 37.0 37.0 37.0 25.0 37.0 86-87 35.06683354192741 37.0 37.0 37.0 25.0 37.0 88-89 34.98648310387985 37.0 37.0 37.0 25.0 37.0 90-91 35.00249303868193 37.0 37.0 37.0 25.0 37.0 92-93 35.062343515272914 37.0 37.0 37.0 25.0 37.0 94-95 34.994992488733104 37.0 37.0 37.0 25.0 37.0 96-97 35.072992141965585 37.0 37.0 37.0 25.0 37.0 98-99 35.033770923820214 37.0 37.0 37.0 25.0 37.0 100-101 34.99127487667092 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 4.0 23 4.0 24 4.0 25 19.0 26 18.0 27 28.0 28 43.0 29 63.0 30 77.0 31 109.0 32 144.0 33 233.0 34 339.0 35 603.0 36 1965.0 37 344.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.289144572286144 12.681340670335167 17.358679339669834 41.67083541770886 2 25.6838905775076 18.515704154002027 30.445795339412363 25.354609929078016 3 26.263131565782892 23.261630815407706 22.71135567783892 27.763881940970485 4 28.51425712856428 27.838919459729865 18.18409204602301 25.46273136568284 5 28.61430715357679 29.364682341170585 19.78489244622311 22.236118059029515 6 21.785892946473236 33.2416208104052 20.4352176088044 24.537268634317158 7 21.785892946473236 15.43271635817909 36.51825912956478 26.263131565782892 8 23.936968484242122 20.535267633816908 23.986993496748372 31.540770385192594 9 21.91095547773887 19.35967983991996 26.663331665832917 32.06603301650826 10-11 26.125562781390695 26.463231615807903 19.384692346173086 28.026513256628316 12-13 24.899949974987493 20.810405202601302 24.7623811905953 29.52726363181591 14-15 25.46273136568284 22.411205602801402 24.249624812406203 27.876438219109556 16-17 25.71285642821411 22.373686843421712 23.411705852926463 28.501750875437722 18-19 25.550275137568786 23.574287143571787 22.748874437218607 28.12656328164082 20-21 25.60030015007504 22.686343171585793 24.324662331165584 27.388694347173587 22-23 26.088044022011005 23.66183091545773 22.748874437218607 27.501250625312657 24-25 25.962981490745374 23.649324662331164 23.036518259129565 27.351175587793897 26-27 25.937968984492244 23.499249624812407 22.273636818409205 28.289144572286144 28-29 26.43821910955478 23.311655827913956 22.273636818409205 27.97648824412206 30-31 25.437718859429715 24.112056028014006 23.336668334167083 27.113556778389196 32-33 25.812906453226613 23.43671835917959 22.698849424712357 28.05152576288144 34-35 26.688344172086044 23.761880940470235 22.32366183091546 27.226113056528263 36-37 25.53776888444222 23.24912456228114 23.486743371685844 27.726363181590795 38-39 25.78789394697349 23.36168084042021 22.623811905952977 28.226613306653327 40-41 27.301150575287643 22.736368184092047 23.336668334167083 26.625812906453227 42-43 26.300650325162582 22.71135567783892 22.686343171585793 28.301650825412704 44-45 25.287643821910955 23.62431215607804 23.449224612306153 27.63881940970485 46-47 26.738369184592298 22.71135567783892 22.373686843421712 28.176588294147077 48-49 25.175087543771884 23.92446223111556 23.43671835917959 27.463731865932967 50-51 26.500750375187593 23.19909954977489 22.11105552776388 28.189094547273637 52-53 26.79509632224168 23.2424318238679 22.504378283712782 27.45809357017763 54-55 25.794345759319487 22.854640980735553 23.35501626219665 27.995996997748314 56-57 25.65674255691769 24.030522892169127 22.34175631723793 27.970978233675257 58-59 26.257192894671004 22.041531148361273 23.00475356517388 28.696522391793845 60-61 26.294721040780583 23.079809857393045 23.46760070052539 27.157868401300977 62-63 26.64498373780335 22.904678508881663 23.129847385539154 27.32049036777583 64-65 26.970227670753065 22.37928446334751 23.19239429572179 27.45809357017763 66-67 25.659952458401104 23.52058050794445 23.670711872888777 27.14875516076567 68-69 26.583229036295368 23.30413016270338 22.715894868585732 27.396745932415516 70-71 26.5081351689612 23.166458072590736 22.866082603254068 27.459324155193993 72-73 26.14518147684606 22.74092615769712 22.377972465581976 28.735919899874844 74-75 25.619524405506883 23.591989987484354 22.590738423028785 28.197747183979978 76-77 26.0450563204005 23.341677096370464 22.490613266583228 28.122653316645806 78-79 26.583229036295368 23.229036295369212 22.44055068836045 27.74718397997497 80-81 26.896120150187734 23.404255319148938 22.11514392991239 27.584480600750936 82-83 26.595744680851062 23.479349186483102 21.65206508135169 28.272841051314142 84-85 26.320400500625784 23.366708385481854 22.503128911138923 27.80976220275344 86-87 27.25907384230288 22.7909887359199 22.615769712140175 27.334167709637047 88-89 26.545682102628287 23.09136420525657 22.51564455569462 27.847309136420527 90-91 27.049693328326445 23.932907748153713 22.581048942295656 26.436349981224183 92-93 27.616424636955433 22.721582373560338 22.1206810215323 27.541311967951927 94-95 26.69003505257887 23.14722083124687 22.44616925388082 27.71657486229344 96-97 26.613206365117154 22.967046735997997 22.478386167146976 27.94136073173788 98-99 26.460873983739834 21.963922764227643 23.704268292682926 27.87093495934959 100-101 27.67980371108726 9.461738997086336 28.27787149210244 34.58058579972397 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.5 24 1.5 25 1.0 26 1.5 27 1.5 28 1.5 29 1.5 30 5.5 31 10.5 32 11.0 33 14.5 34 18.5 35 22.0 36 31.0 37 44.5 38 51.5 39 68.0 40 87.5 41 102.0 42 119.5 43 131.0 44 139.5 45 156.0 46 159.5 47 134.5 48 121.0 49 126.5 50 131.5 51 131.0 52 126.0 53 107.0 54 100.5 55 106.0 56 89.5 57 90.0 58 97.0 59 88.0 60 90.0 61 90.5 62 93.0 63 87.5 64 87.0 65 93.5 66 86.0 67 93.5 68 91.5 69 77.5 70 68.5 71 66.0 72 69.5 73 60.5 74 45.0 75 40.5 76 37.0 77 28.5 78 24.5 79 16.0 80 10.5 81 8.5 82 4.0 83 1.5 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 1.3 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 2.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 1.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 2.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 1.0 92-93 0.0 94-95 1.0 96-97 27.0 98-99 289.0 100-101 3677.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.825 #Duplication Level Percentage of deduplicated Percentage of total 1 93.9781508126832 88.175 2 5.648814281907807 10.6 3 0.3463895550226485 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02664535038635758 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 10 0.25 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 687012 spots for SRR21853427.sra Written 687012 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra Read 686999 spots for SRR21853427.sra Written 686999 spots for SRR21853427.sra SRR ids: ['SRR21853427.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1na68ctj SRR21853427.sra spots: 13739993 blocks: [[1, 686999], [687000, 1373998], [1373999, 2060997], [2060998, 2747996], [2747997, 3434995], [3434996, 4121994], [4121995, 4808993], [4808994, 5495992], [5495993, 6182991], [6182992, 6869990], [6869991, 7556989], [7556990, 8243988], [8243989, 8930987], [8930988, 9617986], [9617987, 10304985], [10304986, 10991984], [10991985, 11678983], [11678984, 12365982], [12365983, 13052981], [13052982, 13739993]] SRR21853427 file size 3698490 SRR21853427 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853427 SRR21853427_1.fastq Input file: SRR21853427_1.fastq trimmed: SRR21853427-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:29:39 2024 >> started Fri Dec 6 14:29:47 2024 >> done (8.241s) 13739993 reads processed; of these: 23 ( 0.00%) short reads filtered out after trimming by size control 30663 ( 0.22%) empty reads filtered out after trimming by size control 13709307 (99.78%) reads available; of these: 469 ( 0.00%) trimmed reads available after processing 13708838 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 4 0.00% 21 1 0.00% 22 4 0.00% 23 0 0.00% 24 2 0.00% 25 5 0.00% 26 5 0.00% 27 3 0.00% 28 9 0.00% 29 7 0.00% 30 3 0.00% 31 5 0.00% 32 5 0.00% 33 3 0.00% 34 11 0.00% 35 116 0.00% 36 125 0.00% 37 121 0.00% 38 112 0.00% 39 125 0.00% 40 100 0.00% 41 109 0.00% 42 121 0.00% 43 110 0.00% 44 116 0.00% 45 144 0.00% 46 137 0.00% 47 121 0.00% 48 125 0.00% 49 149 0.00% 50 144 0.00% 51 139 0.00% 52 148 0.00% 53 146 0.00% 54 142 0.00% 55 146 0.00% 56 131 0.00% 57 147 0.00% 58 165 0.00% 59 177 0.00% 60 143 0.00% 61 159 0.00% 62 179 0.00% 63 172 0.00% 64 174 0.00% 65 176 0.00% 66 200 0.00% 67 223 0.00% 68 175 0.00% 69 185 0.00% 70 189 0.00% 71 218 0.00% 72 183 0.00% 73 166 0.00% 74 201 0.00% 75 216 0.00% 76 203 0.00% 77 211 0.00% 78 234 0.00% 79 236 0.00% 80 221 0.00% 81 250 0.00% 82 238 0.00% 83 274 0.00% 84 279 0.00% 85 273 0.00% 86 275 0.00% 87 313 0.00% 88 326 0.00% 89 351 0.00% 90 400 0.00% 91 701 0.01% 92 392 0.00% 93 446 0.00% 94 1125 0.01% 95 3683 0.03% 96 19012 0.14% 97 57469 0.42% 98 230034 1.68% 99 900865 6.57% 100 2915977 21.27% 101 9569171 69.80% 13709307 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=23 prefix-density=0.50 prefix-fanout=1.8 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=22 fanout-score=203.61 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=23.3 sequence=CGCCGCCGCCGC Started job on | Dec 06 14:30:03 Started mapping on | Dec 06 14:30:04 Finished on | Dec 06 14:30:21 Mapping speed, Million of reads per hour | 2903.15 Number of input reads | 13709307 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 12954976 Uniquely mapped reads % | 94.50% Average mapped length | 100.23 Number of splices: Total | 4197653 Number of splices: Annotated (sjdb) | 3992536 Number of splices: GT/AG | 4136391 Number of splices: GC/AG | 50752 Number of splices: AT/AC | 2047 Number of splices: Non-canonical | 8463 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.00% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 353830 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 207063 % of reads mapped to too many loci | 1.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.19% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 400501 400501 400501 N_multimapping 353830 353830 353830 N_noFeature 404789 6597064 6594474 N_ambiguous 198021 19988 11120 UnstrandedReadsAssigned:12352166 PositiveStrandReadsAssigned:6337924 NegativeStrandReadsAssigned:6349382 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853427 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853427-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,709,307 reads, 12,659,660 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52973 SRR21853427.ke.tsv 35125 SRR21853427.se.tsv 88098 total ==> SRR21853427.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.000357788 5.37669e-05 PNS24247 1044 945 27.1634 3.61548 PNS24249 1928 1829 183.254 12.6024 PNS24246 1044 945 27.1634 3.61548 PNS24248 1044 945 27.1634 3.61548 PNS24244 1471 1372 10.2557 0.940206 PNS24243 293 194 2 1.29671 KQK14069 1603 1504 1154.41 96.5445 KQK14071 474 375 156.497 52.4914 ==> SRR21853427.se.tsv <== BRADI_1g14170v3 1456 BRADI_1g53295v3 51 BRADI_1g59795v3 159 BRADI_1g07683v3 0 BRADI_1g00485v3 46 BRADI_1g20270v3 1207 BRADI_1g74790v3 143 BRADI_1g09890v3 9 BRADI_1g77505v3 136 BRADI_1g48960v3 0 SRR21853427 completed mapping pipeline successfully