Starting /dee2/code/volunteer_pipeline.sh SRR21853428 current disk space = 1550471819264 free memory = 1385991728 SRR21853428 SRAfilesize 7884f5e880c2c8459bf5e724589526d4 SRR21853428.sra SRR21853428.sra file validated SRR21853428 is single end SRR21853428 is conventional basespace SRR21853428 read1 length is 95-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853428_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 95-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.313 37.0 37.0 37.0 37.0 37.0 2 34.7615 37.0 37.0 37.0 25.0 37.0 3 35.731 37.0 37.0 37.0 37.0 37.0 4 35.762 37.0 37.0 37.0 37.0 37.0 5 35.957 37.0 37.0 37.0 37.0 37.0 6 35.9375 37.0 37.0 37.0 37.0 37.0 7 35.6725 37.0 37.0 37.0 37.0 37.0 8 35.8525 37.0 37.0 37.0 37.0 37.0 9 35.902 37.0 37.0 37.0 37.0 37.0 10-11 36.019 37.0 37.0 37.0 37.0 37.0 12-13 35.97975 37.0 37.0 37.0 37.0 37.0 14-15 35.923500000000004 37.0 37.0 37.0 37.0 37.0 16-17 35.95725 37.0 37.0 37.0 37.0 37.0 18-19 35.894999999999996 37.0 37.0 37.0 37.0 37.0 20-21 35.923249999999996 37.0 37.0 37.0 37.0 37.0 22-23 35.932 37.0 37.0 37.0 37.0 37.0 24-25 35.90325 37.0 37.0 37.0 37.0 37.0 26-27 35.76875 37.0 37.0 37.0 37.0 37.0 28-29 35.708 37.0 37.0 37.0 37.0 37.0 30-31 35.570750000000004 37.0 37.0 37.0 37.0 37.0 32-33 35.642 37.0 37.0 37.0 37.0 37.0 34-35 35.55475 37.0 37.0 37.0 37.0 37.0 36-37 35.67775 37.0 37.0 37.0 37.0 37.0 38-39 35.622 37.0 37.0 37.0 37.0 37.0 40-41 35.504 37.0 37.0 37.0 37.0 37.0 42-43 35.52725 37.0 37.0 37.0 37.0 37.0 44-45 35.435500000000005 37.0 37.0 37.0 37.0 37.0 46-47 35.46975 37.0 37.0 37.0 37.0 37.0 48-49 35.367999999999995 37.0 37.0 37.0 37.0 37.0 50-51 35.430499999999995 37.0 37.0 37.0 37.0 37.0 52-53 35.3485 37.0 37.0 37.0 37.0 37.0 54-55 35.3655 37.0 37.0 37.0 37.0 37.0 56-57 35.340500000000006 37.0 37.0 37.0 31.0 37.0 58-59 35.373999999999995 37.0 37.0 37.0 37.0 37.0 60-61 35.302499999999995 37.0 37.0 37.0 37.0 37.0 62-63 35.12325 37.0 37.0 37.0 25.0 37.0 64-65 35.175250000000005 37.0 37.0 37.0 25.0 37.0 66-67 35.156000000000006 37.0 37.0 37.0 25.0 37.0 68-69 34.98925 37.0 37.0 37.0 25.0 37.0 70-71 34.8495 37.0 37.0 37.0 25.0 37.0 72-73 35.0175 37.0 37.0 37.0 25.0 37.0 74-75 34.9185 37.0 37.0 37.0 25.0 37.0 76-77 34.91075 37.0 37.0 37.0 25.0 37.0 78-79 34.886250000000004 37.0 37.0 37.0 25.0 37.0 80-81 34.94825 37.0 37.0 37.0 25.0 37.0 82-83 34.75375 37.0 37.0 37.0 25.0 37.0 84-85 34.7315 37.0 37.0 37.0 25.0 37.0 86-87 34.80625 37.0 37.0 37.0 25.0 37.0 88-89 34.67975 37.0 37.0 37.0 25.0 37.0 90-91 34.6985 37.0 37.0 37.0 25.0 37.0 92-93 34.61075 37.0 37.0 37.0 25.0 37.0 94-95 34.59625 37.0 37.0 37.0 25.0 37.0 96-97 34.55231589221535 37.0 37.0 37.0 25.0 37.0 98-99 34.608426229318724 37.0 37.0 37.0 25.0 37.0 100-101 34.36126059507339 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 3.0 21 3.0 22 5.0 23 15.0 24 8.0 25 12.0 26 22.0 27 26.0 28 37.0 29 64.0 30 69.0 31 118.0 32 159.0 33 213.0 34 286.0 35 512.0 36 1990.0 37 457.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.500000000000004 14.224999999999998 21.875 36.4 2 24.061866125760652 21.044624746450307 31.05983772819473 23.83367139959432 3 25.6 23.474999999999998 27.150000000000002 23.775 4 25.775 26.724999999999998 22.0 25.5 5 26.775 31.5 23.825 17.9 6 21.099999999999998 33.575 23.525 21.8 7 18.675 19.075 40.150000000000006 22.1 8 21.425 23.125 27.500000000000004 27.950000000000003 9 21.0 22.325 30.625000000000004 26.05 10-11 25.0 29.25 22.662499999999998 23.0875 12-13 22.525000000000002 24.212500000000002 28.1125 25.15 14-15 22.7375 26.1625 27.775 23.325000000000003 16-17 23.2125 24.825 26.8375 25.124999999999996 18-19 23.3125 25.4875 28.175 23.025000000000002 20-21 23.6375 25.424999999999997 26.625 24.3125 22-23 23.200000000000003 26.487500000000004 26.5375 23.775 24-25 22.35 25.2375 27.400000000000002 25.0125 26-27 23.6375 25.074999999999996 27.3125 23.974999999999998 28-29 22.9375 25.75 26.650000000000002 24.6625 30-31 23.4875 25.0625 27.8875 23.5625 32-33 23.1125 25.55 27.800000000000004 23.5375 34-35 23.0375 25.874999999999996 27.05 24.0375 36-37 22.15 26.6 27.025 24.224999999999998 38-39 23.1875 26.3 26.200000000000003 24.3125 40-41 23.95 25.3125 26.775 23.962500000000002 42-43 23.375 26.5125 26.424999999999997 23.6875 44-45 23.75 26.150000000000002 26.875 23.225 46-47 24.0 24.587500000000002 27.187499999999996 24.224999999999998 48-49 22.9625 25.337500000000002 26.924999999999997 24.775 50-51 23.1125 25.55 27.287499999999998 24.05 52-53 24.025 25.337500000000002 25.95 24.6875 54-55 23.125 25.3 26.987499999999997 24.587500000000002 56-57 22.7125 25.587500000000002 26.987499999999997 24.712500000000002 58-59 24.675 25.3125 26.5625 23.45 60-61 23.9875 25.6125 26.187500000000004 24.212500000000002 62-63 23.525 25.362499999999997 26.737499999999997 24.375 64-65 24.0125 25.775 27.1125 23.1 66-67 22.7375 26.1625 26.8625 24.2375 68-69 24.087500000000002 26.125 25.900000000000002 23.8875 70-71 24.95 24.825 26.674999999999997 23.549999999999997 72-73 24.725 26.5 25.074999999999996 23.7 74-75 24.675 25.275 25.424999999999997 24.625 76-77 24.5625 25.924999999999997 25.775 23.7375 78-79 24.375 25.1 26.900000000000002 23.625 80-81 24.4375 25.374999999999996 26.1 24.087500000000002 82-83 25.0375 25.424999999999997 26.25 23.2875 84-85 24.0625 25.7625 26.375 23.799999999999997 86-87 24.7875 25.2625 26.387500000000003 23.5625 88-89 24.675 24.6 26.637499999999996 24.087500000000002 90-91 25.2375 25.4 25.4375 23.925 92-93 24.637500000000003 25.4375 26.575 23.35 94-95 24.875 25.35 25.75 24.025 96-97 26.004757731313383 25.21597596093652 24.740202829598097 24.039063478152 98-99 24.350690485240087 23.89459014316483 27.974154313949068 23.780565057646015 100-101 26.965065502183407 11.041796631316283 31.862133499688085 30.131004366812224 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 119.0 1 83.0 2 40.0 3 22.5 4 9.0 5 6.0 6 8.0 7 8.0 8 4.0 9 1.5 10 1.0 11 2.0 12 2.0 13 1.0 14 0.5 15 1.0 16 1.0 17 1.0 18 2.5 19 2.0 20 0.5 21 0.0 22 1.0 23 1.5 24 1.0 25 2.0 26 3.0 27 3.0 28 2.5 29 4.0 30 9.5 31 12.0 32 10.5 33 11.5 34 22.0 35 38.0 36 48.5 37 50.5 38 65.0 39 84.0 40 91.0 41 105.0 42 115.0 43 126.5 44 129.0 45 134.0 46 149.0 47 151.0 48 154.0 49 158.5 50 163.5 51 159.5 52 147.0 53 150.0 54 153.5 55 123.0 56 93.5 57 98.0 58 107.0 59 89.5 60 75.0 61 80.0 62 74.0 63 61.0 64 58.5 65 55.0 66 50.0 67 55.5 68 50.5 69 40.0 70 36.5 71 31.5 72 27.5 73 19.5 74 15.0 75 12.5 76 7.5 77 8.5 78 10.0 79 6.0 80 1.5 81 2.0 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.4000000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 95 2.0 96 9.0 97 11.0 98 63.0 99 243.0 100 932.0 101 2740.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.275 #Duplication Level Percentage of deduplicated Percentage of total 1 91.79947841205448 79.2 2 7.505070993914807 12.950000000000001 3 0.49261083743842365 1.275 4 0.08693132425383947 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.057954216169226316 0.7250000000000001 >50 0.028977108084613158 1.9 >100 0.028977108084613158 3.65 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 146 3.65 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 76 1.9 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 18 0.44999999999999996 TruSeq Adapter, Index 7 (97% over 35bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCGCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964611 spots for SRR21853428.sra Written 964611 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra Read 964599 spots for SRR21853428.sra Written 964599 spots for SRR21853428.sra SRR ids: ['SRR21853428.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ufyhmyoh SRR21853428.sra spots: 19291992 blocks: [[1, 964599], [964600, 1929198], [1929199, 2893797], [2893798, 3858396], [3858397, 4822995], [4822996, 5787594], [5787595, 6752193], [6752194, 7716792], [7716793, 8681391], [8681392, 9645990], [9645991, 10610589], [10610590, 11575188], [11575189, 12539787], [12539788, 13504386], [13504387, 14468985], [14468986, 15433584], [15433585, 16398183], [16398184, 17362782], [17362783, 18327381], [18327382, 19291992]] SRR21853428 file size 5197540 SRR21853428 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853428 SRR21853428_1.fastq Input file: SRR21853428_1.fastq trimmed: SRR21853428-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:30:05 2024 >> started Fri Dec 6 14:30:16 2024 >> done (10.348s) 19291992 reads processed; of these: 13 ( 0.00%) short reads filtered out after trimming by size control 128223 ( 0.66%) empty reads filtered out after trimming by size control 19163756 (99.34%) reads available; of these: 531 ( 0.00%) trimmed reads available after processing 19163225 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 1 0.00% 21 2 0.00% 22 6 0.00% 23 11 0.00% 24 9 0.00% 25 9 0.00% 26 11 0.00% 27 16 0.00% 28 7 0.00% 29 4 0.00% 30 10 0.00% 31 10 0.00% 32 10 0.00% 33 11 0.00% 34 7 0.00% 35 51 0.00% 36 45 0.00% 37 60 0.00% 38 83 0.00% 39 75 0.00% 40 87 0.00% 41 77 0.00% 42 95 0.00% 43 74 0.00% 44 64 0.00% 45 69 0.00% 46 90 0.00% 47 73 0.00% 48 83 0.00% 49 66 0.00% 50 85 0.00% 51 105 0.00% 52 117 0.00% 53 77 0.00% 54 105 0.00% 55 108 0.00% 56 121 0.00% 57 126 0.00% 58 120 0.00% 59 132 0.00% 60 139 0.00% 61 233 0.00% 62 175 0.00% 63 164 0.00% 64 138 0.00% 65 156 0.00% 66 146 0.00% 67 185 0.00% 68 159 0.00% 69 158 0.00% 70 137 0.00% 71 171 0.00% 72 206 0.00% 73 186 0.00% 74 198 0.00% 75 206 0.00% 76 210 0.00% 77 215 0.00% 78 215 0.00% 79 255 0.00% 80 255 0.00% 81 256 0.00% 82 281 0.00% 83 311 0.00% 84 326 0.00% 85 349 0.00% 86 349 0.00% 87 374 0.00% 88 337 0.00% 89 457 0.00% 90 536 0.00% 91 1653 0.01% 92 751 0.00% 93 852 0.00% 94 1307 0.01% 95 4639 0.02% 96 25392 0.13% 97 85585 0.45% 98 335301 1.75% 99 1232818 6.43% 100 4549437 23.74% 101 12916223 67.40% 19163756 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=20 prefix-density=0.25 prefix-fanout=2.2 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=14.55 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=1.6 sequence=GGCTCCCCATCCGACCCGTCTTGAAACACGGACCAAGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGGAAGCTGACGAGCGGGAGGCCCTCACGGGCCGCACCGCTGGCCGACCCTGATCTTCTGTGAAGGGTTCGAGTTGGAGCACGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAA Started job on | Dec 06 14:30:41 Started mapping on | Dec 06 14:30:41 Finished on | Dec 06 14:32:09 Mapping speed, Million of reads per hour | 783.97 Number of input reads | 19163756 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 14441376 Uniquely mapped reads % | 75.36% Average mapped length | 100.22 Number of splices: Total | 4734082 Number of splices: Annotated (sjdb) | 4483601 Number of splices: GT/AG | 4671800 Number of splices: GC/AG | 52118 Number of splices: AT/AC | 2716 Number of splices: Non-canonical | 7448 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.00% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1158530 % of reads mapped to multiple loci | 6.05% Number of reads mapped to too many loci | 1267001 % of reads mapped to too many loci | 6.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.97% % of reads unmapped: other | 1.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3563850 3563850 3563850 N_multimapping 1158530 1158530 1158530 N_noFeature 613599 7291748 7508235 N_ambiguous 282757 13438 15897 UnstrandedReadsAssigned:13545020 PositiveStrandReadsAssigned:7136190 NegativeStrandReadsAssigned:6917244 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853428 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853428-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,163,756 reads, 15,335,336 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,265 rounds 52973 SRR21853428.ke.tsv 35125 SRR21853428.se.tsv 88098 total ==> SRR21853428.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 149.433 18.1065 PNS24247 1044 945 20.91 2.24406 PNS24249 1928 1829 44.8956 2.48944 PNS24246 1044 945 20.91 2.24406 PNS24248 1044 945 20.91 2.24406 PNS24244 1471 1372 108.941 8.05286 PNS24243 293 194 5 2.61385 KQK14069 1603 1504 5487.04 370 KQK14071 474 375 1668.05 451.116 ==> SRR21853428.se.tsv <== BRADI_1g14170v3 7857 BRADI_1g53295v3 131 BRADI_1g59795v3 382 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 144 BRADI_1g74790v3 188 BRADI_1g09890v3 0 BRADI_1g77505v3 318 BRADI_1g48960v3 0 SRR21853428 completed mapping pipeline successfully