Starting /dee2/code/volunteer_pipeline.sh SRR21853429 current disk space = 1550506426368 free memory = 1352520836 SRR21853429 SRAfilesize 277a11dbe0ef00211bf46b75cae4fa19 SRR21853429.sra SRR21853429.sra file validated SRR21853429 is single end SRR21853429 is conventional basespace SRR21853429 read1 length is 78-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853429_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 78-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.3475 37.0 37.0 37.0 37.0 37.0 2 34.8635 37.0 37.0 37.0 25.0 37.0 3 35.717 37.0 37.0 37.0 37.0 37.0 4 35.8285 37.0 37.0 37.0 37.0 37.0 5 35.893 37.0 37.0 37.0 37.0 37.0 6 35.8155 37.0 37.0 37.0 37.0 37.0 7 35.6195 37.0 37.0 37.0 37.0 37.0 8 35.792 37.0 37.0 37.0 37.0 37.0 9 35.883 37.0 37.0 37.0 37.0 37.0 10-11 35.8925 37.0 37.0 37.0 37.0 37.0 12-13 35.867 37.0 37.0 37.0 37.0 37.0 14-15 35.854749999999996 37.0 37.0 37.0 37.0 37.0 16-17 35.932 37.0 37.0 37.0 37.0 37.0 18-19 35.83225 37.0 37.0 37.0 37.0 37.0 20-21 35.871750000000006 37.0 37.0 37.0 37.0 37.0 22-23 35.87225 37.0 37.0 37.0 37.0 37.0 24-25 35.745999999999995 37.0 37.0 37.0 37.0 37.0 26-27 35.68925 37.0 37.0 37.0 37.0 37.0 28-29 35.733000000000004 37.0 37.0 37.0 37.0 37.0 30-31 35.62575 37.0 37.0 37.0 37.0 37.0 32-33 35.69375 37.0 37.0 37.0 37.0 37.0 34-35 35.662 37.0 37.0 37.0 37.0 37.0 36-37 35.59475 37.0 37.0 37.0 37.0 37.0 38-39 35.692 37.0 37.0 37.0 37.0 37.0 40-41 35.6425 37.0 37.0 37.0 37.0 37.0 42-43 35.579499999999996 37.0 37.0 37.0 37.0 37.0 44-45 35.53925 37.0 37.0 37.0 37.0 37.0 46-47 35.626999999999995 37.0 37.0 37.0 37.0 37.0 48-49 35.407 37.0 37.0 37.0 37.0 37.0 50-51 35.49525 37.0 37.0 37.0 37.0 37.0 52-53 35.477999999999994 37.0 37.0 37.0 37.0 37.0 54-55 35.47525 37.0 37.0 37.0 37.0 37.0 56-57 35.4225 37.0 37.0 37.0 37.0 37.0 58-59 35.498 37.0 37.0 37.0 37.0 37.0 60-61 35.49025 37.0 37.0 37.0 37.0 37.0 62-63 35.438 37.0 37.0 37.0 37.0 37.0 64-65 35.372 37.0 37.0 37.0 37.0 37.0 66-67 35.509249999999994 37.0 37.0 37.0 37.0 37.0 68-69 35.361000000000004 37.0 37.0 37.0 37.0 37.0 70-71 35.38075 37.0 37.0 37.0 37.0 37.0 72-73 35.28675 37.0 37.0 37.0 31.0 37.0 74-75 35.34475 37.0 37.0 37.0 37.0 37.0 76-77 35.26025 37.0 37.0 37.0 31.0 37.0 78-79 35.39730388847212 37.0 37.0 37.0 37.0 37.0 80-81 35.388347086771695 37.0 37.0 37.0 37.0 37.0 82-83 35.308577144286076 37.0 37.0 37.0 37.0 37.0 84-85 35.25306326581645 37.0 37.0 37.0 31.0 37.0 86-87 35.26531632908227 37.0 37.0 37.0 37.0 37.0 88-89 35.31532883220805 37.0 37.0 37.0 37.0 37.0 90-91 35.2525631407852 37.0 37.0 37.0 31.0 37.0 92-93 35.24781195298824 37.0 37.0 37.0 31.0 37.0 94-95 35.25756439109777 37.0 37.0 37.0 37.0 37.0 96-97 35.139907272051836 37.0 37.0 37.0 25.0 37.0 98-99 35.201822214288086 37.0 37.0 37.0 31.0 37.0 100-101 35.22794560869416 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 1.0 23 3.0 24 0.0 25 8.0 26 18.0 27 23.0 28 36.0 29 60.0 30 90.0 31 95.0 32 138.0 33 189.0 34 230.0 35 525.0 36 2108.0 37 473.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.725 14.475 18.375 39.425 2 26.36501516683519 19.565217391304348 30.23255813953488 23.837209302325583 3 26.674999999999997 23.400000000000002 22.725 27.200000000000003 4 26.200000000000003 29.25 19.025 25.525 5 27.825 30.0 20.8 21.375 6 23.125 31.674999999999997 20.775 24.425 7 20.5 17.175 39.15 23.175 8 21.2 21.125 26.55 31.125000000000004 9 21.725 21.675 27.025 29.575000000000003 10-11 24.975 27.8375 21.15 26.0375 12-13 23.8375 21.9375 26.2125 28.012500000000003 14-15 24.05 23.4875 25.3 27.1625 16-17 24.337500000000002 24.3125 24.75 26.6 18-19 25.35 24.8125 23.9 25.937500000000004 20-21 24.75 24.587500000000002 24.6125 26.05 22-23 24.6875 25.05 24.675 25.587500000000002 24-25 24.3125 24.0625 25.887500000000003 25.7375 26-27 24.5 25.9625 23.525 26.0125 28-29 24.0375 24.525 24.675 26.7625 30-31 24.474999999999998 25.837500000000002 24.45 25.2375 32-33 24.837500000000002 24.575 24.5 26.087500000000002 34-35 25.2 24.0625 24.9875 25.75 36-37 24.0625 24.95 25.25 25.7375 38-39 25.825 24.1875 24.3 25.687500000000004 40-41 25.4375 24.2 24.375 25.9875 42-43 25.137500000000003 25.624999999999996 23.0625 26.174999999999997 44-45 24.65 24.925 24.75 25.674999999999997 46-47 24.7375 24.712500000000002 24.6875 25.8625 48-49 24.962500000000002 24.349999999999998 25.55 25.137500000000003 50-51 25.75 24.075 23.9 26.275 52-53 25.162499999999998 24.775 24.2 25.8625 54-55 25.4375 24.375 24.4375 25.75 56-57 25.724999999999998 24.0625 24.975 25.2375 58-59 25.5 25.1 23.95 25.45 60-61 24.962500000000002 24.375 25.275 25.387500000000003 62-63 25.7 23.5125 24.0 26.787499999999998 64-65 26.237500000000004 23.925 23.9875 25.85 66-67 25.387500000000003 23.9875 25.224999999999998 25.4 68-69 24.5125 24.5125 25.074999999999996 25.900000000000002 70-71 24.9875 24.4375 24.75 25.825 72-73 25.025 24.0125 24.65 26.3125 74-75 25.324999999999996 24.5625 24.8625 25.25 76-77 25.937500000000004 24.45 23.9 25.7125 78-79 25.715714464308036 23.71546443305413 25.728216027003377 24.840605075634453 80-81 25.393848462115532 24.518629657414355 24.343585896474117 25.743935983995996 82-83 25.393848462115532 24.681170292573142 24.256064016004 25.668917229307326 84-85 25.343835958989747 24.981245311327832 23.980995248812203 25.693923480870218 86-87 25.95648912228057 24.668667166791696 24.218554638659665 25.156289072268066 88-89 25.406351587896975 24.60615153788447 24.168542135533883 25.818954738684667 90-91 25.268817204301076 23.818454613653415 25.55638909727432 25.35633908477119 92-93 26.25656414103526 24.33108277069267 24.01850462615654 25.393848462115532 94-95 25.76894223555889 24.15603900975244 24.36859214803701 25.70642660665166 96-97 24.39299123904881 24.20525657071339 24.993742177722154 26.408010012515643 98-99 25.441381938270034 23.30750666836022 24.501460688428807 26.749650704940937 100-101 25.555555555555554 11.31455399061033 30.0 33.129890453834115 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 4.0 2 0.5 3 0.0 4 1.0 5 2.5 6 1.5 7 0.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.0 26 1.5 27 2.5 28 2.5 29 5.5 30 7.5 31 7.0 32 11.0 33 15.5 34 20.0 35 29.5 36 38.5 37 54.0 38 69.5 39 88.5 40 121.0 41 134.5 42 141.5 43 153.0 44 175.0 45 194.5 46 188.0 47 177.0 48 163.5 49 167.0 50 152.0 51 119.5 52 126.0 53 136.0 54 124.5 55 106.5 56 91.0 57 76.5 58 75.5 59 71.0 60 70.0 61 79.5 62 62.5 63 57.5 64 63.5 65 56.5 66 63.0 67 75.0 68 63.0 69 57.5 70 53.0 71 40.0 72 40.0 73 26.5 74 21.5 75 25.5 76 21.5 77 18.0 78 14.5 79 10.0 80 7.0 81 6.5 82 4.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.0999999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 2.0 96 4.0 97 14.0 98 85.0 99 236.0 100 926.0 101 2732.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.0 #Duplication Level Percentage of deduplicated Percentage of total 1 92.30978260869566 84.925 2 7.119565217391305 13.100000000000001 3 0.46195652173913043 1.275 4 0.08152173913043478 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02717391304347826 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 16 0.4 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra Read 938397 spots for SRR21853429.sra Written 938397 spots for SRR21853429.sra Read 938378 spots for SRR21853429.sra Written 938378 spots for SRR21853429.sra SRR ids: ['SRR21853429.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_chthv4s0 SRR21853429.sra spots: 18767579 blocks: [[1, 938378], [938379, 1876756], [1876757, 2815134], [2815135, 3753512], [3753513, 4691890], [4691891, 5630268], [5630269, 6568646], [6568647, 7507024], [7507025, 8445402], [8445403, 9383780], [9383781, 10322158], [10322159, 11260536], [11260537, 12198914], [12198915, 13137292], [13137293, 14075670], [14075671, 15014048], [15014049, 15952426], [15952427, 16890804], [16890805, 17829182], [17829183, 18767579]] SRR21853429 file size 5055857 SRR21853429 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853429 SRR21853429_1.fastq Input file: SRR21853429_1.fastq trimmed: SRR21853429-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:37:17 2024 >> started Fri Dec 6 14:37:27 2024 >> done (9.753s) 18767579 reads processed; of these: 9 ( 0.00%) short reads filtered out after trimming by size control 19092 ( 0.10%) empty reads filtered out after trimming by size control 18748478 (99.90%) reads available; of these: 549 ( 0.00%) trimmed reads available after processing 18747929 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 5 0.00% 24 5 0.00% 25 5 0.00% 26 4 0.00% 27 5 0.00% 28 5 0.00% 29 9 0.00% 30 8 0.00% 31 11 0.00% 32 5 0.00% 33 6 0.00% 34 8 0.00% 35 61 0.00% 36 80 0.00% 37 76 0.00% 38 105 0.00% 39 107 0.00% 40 73 0.00% 41 91 0.00% 42 75 0.00% 43 88 0.00% 44 101 0.00% 45 78 0.00% 46 126 0.00% 47 106 0.00% 48 123 0.00% 49 117 0.00% 50 117 0.00% 51 125 0.00% 52 134 0.00% 53 117 0.00% 54 118 0.00% 55 140 0.00% 56 118 0.00% 57 144 0.00% 58 130 0.00% 59 116 0.00% 60 148 0.00% 61 180 0.00% 62 170 0.00% 63 170 0.00% 64 147 0.00% 65 131 0.00% 66 157 0.00% 67 165 0.00% 68 183 0.00% 69 171 0.00% 70 173 0.00% 71 183 0.00% 72 163 0.00% 73 165 0.00% 74 190 0.00% 75 180 0.00% 76 191 0.00% 77 215 0.00% 78 263 0.00% 79 247 0.00% 80 194 0.00% 81 200 0.00% 82 244 0.00% 83 215 0.00% 84 231 0.00% 85 231 0.00% 86 272 0.00% 87 283 0.00% 88 290 0.00% 89 331 0.00% 90 430 0.00% 91 924 0.00% 92 455 0.00% 93 514 0.00% 94 1195 0.01% 95 4842 0.03% 96 25799 0.14% 97 87338 0.47% 98 342487 1.83% 99 1246182 6.65% 100 4245599 22.65% 101 12783880 68.19% 18748478 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=175.88 fanout-score-rank=11 prefix-density=0.79 prefix-fanout=22.0 sequence=GCCGCCGCCGCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=377.47 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=25.9 sequence=CGCCGCCGCCGG Started job on | Dec 06 14:37:49 Started mapping on | Dec 06 14:37:49 Finished on | Dec 06 14:38:31 Mapping speed, Million of reads per hour | 1607.01 Number of input reads | 18748478 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 16836213 Uniquely mapped reads % | 89.80% Average mapped length | 100.26 Number of splices: Total | 5639139 Number of splices: Annotated (sjdb) | 5338465 Number of splices: GT/AG | 5564825 Number of splices: GC/AG | 62874 Number of splices: AT/AC | 3323 Number of splices: Non-canonical | 8117 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.74 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 545426 % of reads mapped to multiple loci | 2.91% Number of reads mapped to too many loci | 524979 % of reads mapped to too many loci | 2.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.05% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1366839 1366839 1366839 N_multimapping 545426 545426 545426 N_noFeature 762623 8685862 8691207 N_ambiguous 254066 16392 17341 UnstrandedReadsAssigned:15819524 PositiveStrandReadsAssigned:8133959 NegativeStrandReadsAssigned:8127665 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853429 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853429-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,748,478 reads, 16,365,645 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52973 SRR21853429.ke.tsv 35125 SRR21853429.se.tsv 88098 total ==> SRR21853429.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 61.4585 6.94786 PNS24249 1928 1829 266.578 15.5708 PNS24246 1044 945 61.4585 6.94786 PNS24248 1044 945 61.4585 6.94786 PNS24244 1471 1372 45.0464 3.50758 PNS24243 293 194 20 11.0136 KQK14069 1603 1504 5774.59 410.179 KQK14071 474 375 885.001 252.123 ==> SRR21853429.se.tsv <== BRADI_1g14170v3 7450 BRADI_1g53295v3 395 BRADI_1g59795v3 353 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 196 BRADI_1g74790v3 348 BRADI_1g09890v3 0 BRADI_1g77505v3 241 BRADI_1g48960v3 0 SRR21853429 completed mapping pipeline successfully