Starting /dee2/code/volunteer_pipeline.sh SRR21853430 current disk space = 1550509281280 free memory = 1600041296 SRR21853430 SRAfilesize 525c8073863071dd639b9186003dc651 SRR21853430.sra SRR21853430.sra file validated SRR21853430 is single end SRR21853430 is conventional basespace SRR21853430 read1 length is 79-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853430_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 79-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.241 37.0 37.0 37.0 25.0 37.0 2 34.978 37.0 37.0 37.0 37.0 37.0 3 35.7705 37.0 37.0 37.0 37.0 37.0 4 35.802 37.0 37.0 37.0 37.0 37.0 5 35.7785 37.0 37.0 37.0 37.0 37.0 6 35.845 37.0 37.0 37.0 37.0 37.0 7 35.6695 37.0 37.0 37.0 37.0 37.0 8 35.8375 37.0 37.0 37.0 37.0 37.0 9 35.8635 37.0 37.0 37.0 37.0 37.0 10-11 35.9555 37.0 37.0 37.0 37.0 37.0 12-13 35.95275 37.0 37.0 37.0 37.0 37.0 14-15 36.0265 37.0 37.0 37.0 37.0 37.0 16-17 35.9685 37.0 37.0 37.0 37.0 37.0 18-19 35.92225 37.0 37.0 37.0 37.0 37.0 20-21 35.9095 37.0 37.0 37.0 37.0 37.0 22-23 35.8705 37.0 37.0 37.0 37.0 37.0 24-25 35.755250000000004 37.0 37.0 37.0 37.0 37.0 26-27 35.75975 37.0 37.0 37.0 37.0 37.0 28-29 35.73425 37.0 37.0 37.0 37.0 37.0 30-31 35.6575 37.0 37.0 37.0 37.0 37.0 32-33 35.7095 37.0 37.0 37.0 37.0 37.0 34-35 35.681 37.0 37.0 37.0 37.0 37.0 36-37 35.67425 37.0 37.0 37.0 37.0 37.0 38-39 35.63225 37.0 37.0 37.0 37.0 37.0 40-41 35.604749999999996 37.0 37.0 37.0 37.0 37.0 42-43 35.63875 37.0 37.0 37.0 37.0 37.0 44-45 35.6925 37.0 37.0 37.0 37.0 37.0 46-47 35.603 37.0 37.0 37.0 37.0 37.0 48-49 35.603750000000005 37.0 37.0 37.0 37.0 37.0 50-51 35.60525 37.0 37.0 37.0 37.0 37.0 52-53 35.563 37.0 37.0 37.0 37.0 37.0 54-55 35.573 37.0 37.0 37.0 37.0 37.0 56-57 35.539249999999996 37.0 37.0 37.0 37.0 37.0 58-59 35.622249999999994 37.0 37.0 37.0 37.0 37.0 60-61 35.57899999999999 37.0 37.0 37.0 37.0 37.0 62-63 35.4195 37.0 37.0 37.0 37.0 37.0 64-65 35.3535 37.0 37.0 37.0 37.0 37.0 66-67 35.532250000000005 37.0 37.0 37.0 37.0 37.0 68-69 35.5035 37.0 37.0 37.0 37.0 37.0 70-71 35.41675 37.0 37.0 37.0 37.0 37.0 72-73 35.294 37.0 37.0 37.0 31.0 37.0 74-75 35.471000000000004 37.0 37.0 37.0 37.0 37.0 76-77 35.372749999999996 37.0 37.0 37.0 37.0 37.0 78-79 35.348749999999995 37.0 37.0 37.0 37.0 37.0 80-81 35.39434858714679 37.0 37.0 37.0 37.0 37.0 82-83 35.391445722861434 37.0 37.0 37.0 37.0 37.0 84-85 35.30140070035017 37.0 37.0 37.0 31.0 37.0 86-87 35.337168584292144 37.0 37.0 37.0 31.0 37.0 88-89 35.33191595797899 37.0 37.0 37.0 37.0 37.0 90-91 35.23686843421711 37.0 37.0 37.0 31.0 37.0 92-93 35.32182182182182 37.0 37.0 37.0 37.0 37.0 94-95 35.26451451451452 37.0 37.0 37.0 31.0 37.0 96-97 35.27489561399818 37.0 37.0 37.0 37.0 37.0 98-99 35.4425850642119 37.0 37.0 37.0 37.0 37.0 100-101 35.33547599299604 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 4.0 23 4.0 24 4.0 25 9.0 26 10.0 27 14.0 28 38.0 29 48.0 30 82.0 31 96.0 32 137.0 33 173.0 34 246.0 35 494.0 36 2131.0 37 506.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.5 13.125 17.275 40.1 2 25.73678861788618 20.198170731707318 31.021341463414636 23.04369918699187 3 27.1 23.275000000000002 22.925 26.700000000000003 4 26.1 30.525000000000002 19.525000000000002 23.849999999999998 5 26.950000000000003 31.4 20.1 21.55 6 22.225 33.475 20.825 23.474999999999998 7 21.075 16.125 38.1 24.7 8 21.8 22.2 25.775 30.225 9 21.475 20.974999999999998 28.825 28.725 10-11 25.3125 28.1 20.825 25.7625 12-13 24.762500000000003 22.287499999999998 25.8625 27.0875 14-15 24.2875 24.85 25.45 25.412499999999998 16-17 24.3125 24.2 25.224999999999998 26.2625 18-19 23.9125 25.474999999999998 24.725 25.887500000000003 20-21 23.5875 25.324999999999996 24.8 26.2875 22-23 25.8125 24.275 23.4625 26.450000000000003 24-25 25.8 24.2875 24.65 25.2625 26-27 24.3125 25.25 24.3875 26.05 28-29 24.8125 24.65 24.3125 26.224999999999998 30-31 24.525 25.45 24.0375 25.9875 32-33 24.925 25.324999999999996 24.5 25.25 34-35 25.2125 24.712500000000002 23.5625 26.5125 36-37 23.5125 25.3 24.087500000000002 27.1 38-39 25.3125 24.875 24.224999999999998 25.587500000000002 40-41 26.0625 24.025 24.875 25.0375 42-43 23.2875 25.25 24.95 26.5125 44-45 24.349999999999998 24.637500000000003 24.0 27.0125 46-47 25.5375 24.837500000000002 23.474999999999998 26.150000000000002 48-49 24.4 25.4625 23.825 26.3125 50-51 25.474999999999998 24.8 24.6875 25.0375 52-53 25.55 23.200000000000003 24.85 26.400000000000002 54-55 24.6125 24.725 24.712500000000002 25.95 56-57 24.925 25.575 24.425 25.074999999999996 58-59 24.7 24.2 24.8625 26.237500000000004 60-61 25.2125 24.9 24.0125 25.874999999999996 62-63 25.775 24.8625 23.425 25.937500000000004 64-65 25.025 24.5375 24.337500000000002 26.1 66-67 25.05 24.675 24.349999999999998 25.924999999999997 68-69 24.587500000000002 25.45 23.7375 26.224999999999998 70-71 25.2625 25.424999999999997 23.75 25.5625 72-73 25.0625 24.675 25.0375 25.224999999999998 74-75 25.637500000000003 25.575 23.175 25.6125 76-77 25.337500000000002 24.625 24.087500000000002 25.95 78-79 25.4625 25.35 24.3875 24.8 80-81 25.51887971992998 24.06851712928232 24.456114028507127 25.95648912228057 82-83 25.175087543771884 25.625312656328163 23.54927463731866 25.65032516258129 84-85 24.73736868434217 24.449724862431214 24.68734367183592 26.125562781390695 86-87 25.41270635317659 25.275137568784395 23.82441220610305 25.48774387193597 88-89 26.450725362681343 24.72486243121561 23.149074537268636 25.67533766883442 90-91 25.387693846923458 25.937968984492244 23.611805902951478 25.062531265632813 92-93 25.150150150150154 24.737237237237235 24.436936936936938 25.675675675675674 94-95 24.61211211211211 24.83733733733734 24.174174174174173 26.376376376376378 96-97 25.05951635133442 25.109635384037087 23.756421501065027 26.074426763563462 98-99 26.22595847662718 23.95873137179977 24.16252706661572 25.65278308495733 100-101 26.320769594701147 10.62923829049046 29.411764705882355 33.638227408926035 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 2.0 24 2.5 25 1.5 26 2.0 27 5.0 28 6.5 29 9.5 30 9.5 31 6.5 32 14.5 33 32.0 34 33.5 35 29.0 36 41.5 37 46.0 38 63.0 39 85.5 40 103.5 41 131.0 42 152.5 43 162.0 44 188.5 45 196.5 46 179.5 47 186.0 48 174.0 49 153.5 50 140.0 51 125.0 52 125.0 53 118.0 54 102.0 55 93.5 56 88.0 57 87.0 58 89.0 59 76.0 60 60.5 61 70.5 62 72.0 63 67.5 64 71.5 65 70.5 66 67.5 67 66.5 68 60.0 69 55.5 70 50.5 71 42.5 72 38.5 73 28.0 74 25.0 75 27.0 76 21.0 77 13.5 78 11.0 79 7.5 80 4.0 81 3.5 82 2.5 83 2.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.6 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 79 1.0 80 0.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 2.0 92 0.0 93 0.0 94 0.0 95 1.0 96 9.0 97 26.0 98 69.0 99 274.0 100 893.0 101 2724.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.975 #Duplication Level Percentage of deduplicated Percentage of total 1 92.90131755848347 86.375 2 6.668459263242807 12.4 3 0.4033342296316214 1.125 4 0.026888948642108095 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973617 spots for SRR21853430.sra Written 973617 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra Read 973606 spots for SRR21853430.sra Written 973606 spots for SRR21853430.sra SRR ids: ['SRR21853430.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ag59ecmt SRR21853430.sra spots: 19472131 blocks: [[1, 973606], [973607, 1947212], [1947213, 2920818], [2920819, 3894424], [3894425, 4868030], [4868031, 5841636], [5841637, 6815242], [6815243, 7788848], [7788849, 8762454], [8762455, 9736060], [9736061, 10709666], [10709667, 11683272], [11683273, 12656878], [12656879, 13630484], [13630485, 14604090], [14604091, 15577696], [15577697, 16551302], [16551303, 17524908], [17524909, 18498514], [18498515, 19472131]] SRR21853430 file size 5245905 SRR21853430 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853430 SRR21853430_1.fastq Input file: SRR21853430_1.fastq trimmed: SRR21853430-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:36:33 2024 >> started Fri Dec 6 14:36:43 2024 >> done (10.194s) 19472131 reads processed; of these: 14 ( 0.00%) short reads filtered out after trimming by size control 36095 ( 0.19%) empty reads filtered out after trimming by size control 19436022 (99.81%) reads available; of these: 458 ( 0.00%) trimmed reads available after processing 19435564 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 2 0.00% 21 1 0.00% 22 2 0.00% 23 4 0.00% 24 2 0.00% 25 4 0.00% 26 4 0.00% 27 4 0.00% 28 4 0.00% 29 4 0.00% 30 7 0.00% 31 5 0.00% 32 13 0.00% 33 6 0.00% 34 12 0.00% 35 69 0.00% 36 61 0.00% 37 69 0.00% 38 76 0.00% 39 71 0.00% 40 82 0.00% 41 94 0.00% 42 68 0.00% 43 100 0.00% 44 91 0.00% 45 84 0.00% 46 79 0.00% 47 98 0.00% 48 91 0.00% 49 120 0.00% 50 80 0.00% 51 93 0.00% 52 113 0.00% 53 122 0.00% 54 112 0.00% 55 130 0.00% 56 111 0.00% 57 108 0.00% 58 151 0.00% 59 137 0.00% 60 148 0.00% 61 154 0.00% 62 164 0.00% 63 151 0.00% 64 167 0.00% 65 157 0.00% 66 156 0.00% 67 183 0.00% 68 144 0.00% 69 151 0.00% 70 165 0.00% 71 139 0.00% 72 144 0.00% 73 173 0.00% 74 155 0.00% 75 168 0.00% 76 173 0.00% 77 185 0.00% 78 207 0.00% 79 234 0.00% 80 181 0.00% 81 209 0.00% 82 193 0.00% 83 207 0.00% 84 257 0.00% 85 276 0.00% 86 271 0.00% 87 273 0.00% 88 280 0.00% 89 329 0.00% 90 489 0.00% 91 979 0.01% 92 421 0.00% 93 555 0.00% 94 1216 0.01% 95 5057 0.03% 96 27809 0.14% 97 92245 0.47% 98 359416 1.85% 99 1302670 6.70% 100 4440799 22.85% 101 13196086 67.89% 19436022 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.10 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=256.44 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=23.5 sequence=CGCCGCCGCCGA Started job on | Dec 06 14:37:01 Started mapping on | Dec 06 14:37:01 Finished on | Dec 06 14:37:39 Mapping speed, Million of reads per hour | 1841.31 Number of input reads | 19436022 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17727631 Uniquely mapped reads % | 91.21% Average mapped length | 100.27 Number of splices: Total | 6106393 Number of splices: Annotated (sjdb) | 5784202 Number of splices: GT/AG | 6025145 Number of splices: GC/AG | 69995 Number of splices: AT/AC | 3628 Number of splices: Non-canonical | 7625 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.00% Deletion average length | 1.75 Insertion rate per base | 0.00% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 536546 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 422702 % of reads mapped to too many loci | 2.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1171845 1171845 1171845 N_multimapping 536546 536546 536546 N_noFeature 797830 9150274 9136030 N_ambiguous 271546 17147 17285 UnstrandedReadsAssigned:16658255 PositiveStrandReadsAssigned:8560210 NegativeStrandReadsAssigned:8574316 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853430 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853430-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,436,022 reads, 17,199,992 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52973 SRR21853430.ke.tsv 35125 SRR21853430.se.tsv 88098 total ==> SRR21853430.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 1.23127 0.148118 PNS24247 1044 945 71.3912 7.60661 PNS24249 1928 1829 174 9.57884 PNS24246 1044 945 71.3912 7.60661 PNS24248 1044 945 71.3912 7.60661 PNS24244 1471 1372 63.5956 4.66714 PNS24243 293 194 24 12.4563 KQK14069 1603 1504 5379.18 360.12 KQK14071 474 375 978.734 262.792 ==> SRR21853430.se.tsv <== BRADI_1g14170v3 7043 BRADI_1g53295v3 134 BRADI_1g59795v3 400 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 283 BRADI_1g74790v3 154 BRADI_1g09890v3 1 BRADI_1g77505v3 309 BRADI_1g48960v3 0 SRR21853430 completed mapping pipeline successfully