Starting /dee2/code/volunteer_pipeline.sh SRR21853431 current disk space = 1550443958272 free memory = 1598667420 SRR21853431 SRAfilesize ab54fbcfa6a479e0764f5b0ec0e03c32 SRR21853431.sra SRR21853431.sra file validated SRR21853431 is single end SRR21853431 is conventional basespace SRR21853431 read1 length is 85-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853431_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 85-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.448 37.0 37.0 37.0 37.0 37.0 2 34.94575 37.0 37.0 37.0 25.0 37.0 3 35.7345 37.0 37.0 37.0 37.0 37.0 4 35.918 37.0 37.0 37.0 37.0 37.0 5 35.949 37.0 37.0 37.0 37.0 37.0 6 35.9535 37.0 37.0 37.0 37.0 37.0 7 35.7625 37.0 37.0 37.0 37.0 37.0 8 35.968 37.0 37.0 37.0 37.0 37.0 9 35.928 37.0 37.0 37.0 37.0 37.0 10-11 36.072500000000005 37.0 37.0 37.0 37.0 37.0 12-13 35.9525 37.0 37.0 37.0 37.0 37.0 14-15 35.93425 37.0 37.0 37.0 37.0 37.0 16-17 35.914 37.0 37.0 37.0 37.0 37.0 18-19 35.881249999999994 37.0 37.0 37.0 37.0 37.0 20-21 35.94375 37.0 37.0 37.0 37.0 37.0 22-23 35.856 37.0 37.0 37.0 37.0 37.0 24-25 35.92125 37.0 37.0 37.0 37.0 37.0 26-27 35.7965 37.0 37.0 37.0 37.0 37.0 28-29 35.84025 37.0 37.0 37.0 37.0 37.0 30-31 35.76049999999999 37.0 37.0 37.0 37.0 37.0 32-33 35.73175 37.0 37.0 37.0 37.0 37.0 34-35 35.841499999999996 37.0 37.0 37.0 37.0 37.0 36-37 35.7205 37.0 37.0 37.0 37.0 37.0 38-39 35.82325 37.0 37.0 37.0 37.0 37.0 40-41 35.689499999999995 37.0 37.0 37.0 37.0 37.0 42-43 35.72325 37.0 37.0 37.0 37.0 37.0 44-45 35.6395 37.0 37.0 37.0 37.0 37.0 46-47 35.75175 37.0 37.0 37.0 37.0 37.0 48-49 35.646249999999995 37.0 37.0 37.0 37.0 37.0 50-51 35.70325 37.0 37.0 37.0 37.0 37.0 52-53 35.668499999999995 37.0 37.0 37.0 37.0 37.0 54-55 35.59525 37.0 37.0 37.0 37.0 37.0 56-57 35.602500000000006 37.0 37.0 37.0 37.0 37.0 58-59 35.6865 37.0 37.0 37.0 37.0 37.0 60-61 35.546 37.0 37.0 37.0 37.0 37.0 62-63 35.64625 37.0 37.0 37.0 37.0 37.0 64-65 35.591 37.0 37.0 37.0 37.0 37.0 66-67 35.641999999999996 37.0 37.0 37.0 37.0 37.0 68-69 35.44525 37.0 37.0 37.0 37.0 37.0 70-71 35.56175 37.0 37.0 37.0 37.0 37.0 72-73 35.34175 37.0 37.0 37.0 37.0 37.0 74-75 35.565 37.0 37.0 37.0 37.0 37.0 76-77 35.39475 37.0 37.0 37.0 37.0 37.0 78-79 35.5035 37.0 37.0 37.0 37.0 37.0 80-81 35.533249999999995 37.0 37.0 37.0 37.0 37.0 82-83 35.47725 37.0 37.0 37.0 37.0 37.0 84-85 35.4195 37.0 37.0 37.0 37.0 37.0 86-87 35.437359339834956 37.0 37.0 37.0 37.0 37.0 88-89 35.525381345336335 37.0 37.0 37.0 37.0 37.0 90-91 35.525006720782024 37.0 37.0 37.0 37.0 37.0 92-93 35.44837788751974 37.0 37.0 37.0 37.0 37.0 94-95 35.46651808253811 37.0 37.0 37.0 37.0 37.0 96-97 35.45887322589999 37.0 37.0 37.0 37.0 37.0 98-99 35.47271978895963 37.0 37.0 37.0 37.0 37.0 100-101 35.35042375845556 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 1.0 23 2.0 24 2.0 25 6.0 26 11.0 27 18.0 28 23.0 29 53.0 30 70.0 31 93.0 32 135.0 33 169.0 34 237.0 35 472.0 36 2201.0 37 504.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.199999999999996 15.8 16.775000000000002 39.225 2 24.269377382465056 20.78780177890724 32.32528589580686 22.61753494282084 3 23.825 25.275 24.474999999999998 26.424999999999997 4 26.174999999999997 30.325000000000003 19.725 23.775 5 27.325 32.95 20.724999999999998 19.0 6 21.975 33.45 22.8 21.775 7 19.425 18.35 38.975 23.25 8 21.875 23.175 26.3 28.65 9 20.599999999999998 22.650000000000002 30.099999999999998 26.650000000000002 10-11 25.5 29.8875 21.0 23.6125 12-13 22.525000000000002 24.6125 26.85 26.0125 14-15 23.400000000000002 25.2 25.7125 25.687500000000004 16-17 24.1625 25.3 25.974999999999998 24.5625 18-19 23.474999999999998 26.375 25.4625 24.6875 20-21 23.325000000000003 25.874999999999996 26.8125 23.9875 22-23 24.0625 26.8375 25.85 23.25 24-25 25.412499999999998 26.125 24.4875 23.974999999999998 26-27 23.0625 26.950000000000003 25.587500000000002 24.4 28-29 23.925 25.5 25.687500000000004 24.887500000000003 30-31 23.825 26.8625 25.874999999999996 23.4375 32-33 24.2375 26.174999999999997 24.75 24.837500000000002 34-35 24.2375 25.3 25.362499999999997 25.1 36-37 22.3625 26.987499999999997 27.462500000000002 23.1875 38-39 23.1125 27.075 25.137500000000003 24.675 40-41 24.05 26.8 24.95 24.2 42-43 23.525 27.200000000000003 25.7 23.575 44-45 23.2125 25.937500000000004 25.837500000000002 25.0125 46-47 24.8625 25.775 25.0 24.3625 48-49 24.4375 25.887500000000003 25.55 24.125 50-51 24.212500000000002 26.0125 25.5625 24.212500000000002 52-53 24.0125 25.8125 25.775 24.4 54-55 23.7375 25.05 26.724999999999998 24.4875 56-57 23.8625 26.474999999999998 25.5 24.1625 58-59 22.675 26.174999999999997 26.125 25.025 60-61 24.0625 26.3625 24.9375 24.637500000000003 62-63 24.0 27.150000000000002 24.875 23.974999999999998 64-65 23.549999999999997 26.8125 25.374999999999996 24.2625 66-67 23.6125 26.637499999999996 25.7 24.05 68-69 22.725 27.8625 24.762500000000003 24.65 70-71 24.3 26.5625 25.25 23.8875 72-73 22.912499999999998 26.950000000000003 25.924999999999997 24.212500000000002 74-75 24.212500000000002 25.275 26.174999999999997 24.337500000000002 76-77 24.075 25.374999999999996 26.2125 24.337500000000002 78-79 23.925 26.650000000000002 26.3625 23.0625 80-81 24.2875 25.8625 25.887500000000003 23.962500000000002 82-83 25.124999999999996 25.5375 24.7375 24.6 84-85 24.025 26.7125 25.674999999999997 23.5875 86-87 23.218304576144035 26.281570392598148 26.669167291822955 23.830957739434858 88-89 25.10627656914228 25.243810952738183 26.25656414103526 23.393348337084273 90-91 24.137068534267133 25.82541270635318 25.56278139069535 24.474737368684345 92-93 23.13274114850494 26.810959589640937 25.672463405479796 24.38383585637433 94-95 23.626579902390187 26.454761606807658 25.779001376548617 24.139657114253534 96-97 24.571070757670633 25.76080150281778 25.948653725735753 23.71947401377583 98-99 24.034552845528456 25.165142276422763 26.5625 24.23780487804878 100-101 24.67448963189198 12.120237903873974 31.586561646037616 31.618710818196433 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 9.0 1 5.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 0.5 27 2.0 28 3.5 29 6.0 30 9.0 31 13.0 32 18.0 33 21.0 34 34.0 35 48.5 36 51.5 37 62.5 38 91.0 39 121.0 40 132.5 41 145.0 42 175.0 43 199.0 44 212.5 45 212.5 46 208.5 47 213.0 48 210.0 49 197.0 50 173.0 51 155.0 52 142.0 53 119.0 54 102.0 55 94.0 56 94.0 57 79.5 58 64.0 59 63.0 60 58.0 61 48.0 62 41.5 63 42.5 64 47.5 65 44.0 66 37.5 67 38.0 68 29.5 69 22.5 70 24.5 71 20.5 72 15.0 73 10.0 74 9.0 75 10.0 76 7.0 77 5.0 78 3.0 79 2.0 80 1.0 81 0.5 82 0.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 2.0 91 0.0 92 1.0 93 0.0 94 1.0 95 1.0 96 3.0 97 15.0 98 80.0 99 295.0 100 981.0 101 2620.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.57499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.94649194649195 84.2 2 7.17990717990718 13.15 3 0.7917007917007918 2.175 4 0.0 0.0 5 0.027300027300027303 0.125 6 0.027300027300027303 0.15 7 0.0 0.0 8 0.027300027300027303 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 8 0.2 TruSeq Adapter, Index 7 (97% over 35bp) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 6 0.15 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258403 spots for SRR21853431.sra Written 1258403 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra Read 1258391 spots for SRR21853431.sra Written 1258391 spots for SRR21853431.sra SRR ids: ['SRR21853431.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lix3p5ij SRR21853431.sra spots: 25167832 blocks: [[1, 1258391], [1258392, 2516782], [2516783, 3775173], [3775174, 5033564], [5033565, 6291955], [6291956, 7550346], [7550347, 8808737], [8808738, 10067128], [10067129, 11325519], [11325520, 12583910], [12583911, 13842301], [13842302, 15100692], [15100693, 16359083], [16359084, 17617474], [17617475, 18875865], [18875866, 20134256], [20134257, 21392647], [21392648, 22651038], [22651039, 23909429], [23909430, 25167832]] SRR21853431 file size 6782440 SRR21853431 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853431 SRR21853431_1.fastq Input file: SRR21853431_1.fastq trimmed: SRR21853431-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:39:15 2024 >> started Fri Dec 6 14:39:26 2024 >> done (11.592s) 25167832 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 55574 ( 0.22%) empty reads filtered out after trimming by size control 25112250 (99.78%) reads available; of these: 344 ( 0.00%) trimmed reads available after processing 25111906 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 21 3 0.00% 22 1 0.00% 23 3 0.00% 24 6 0.00% 25 4 0.00% 26 3 0.00% 27 3 0.00% 28 7 0.00% 29 2 0.00% 30 3 0.00% 31 6 0.00% 32 3 0.00% 33 5 0.00% 34 6 0.00% 35 37 0.00% 36 44 0.00% 37 62 0.00% 38 49 0.00% 39 63 0.00% 40 62 0.00% 41 86 0.00% 42 56 0.00% 43 59 0.00% 44 73 0.00% 45 58 0.00% 46 88 0.00% 47 84 0.00% 48 108 0.00% 49 79 0.00% 50 108 0.00% 51 121 0.00% 52 109 0.00% 53 108 0.00% 54 96 0.00% 55 110 0.00% 56 137 0.00% 57 105 0.00% 58 149 0.00% 59 150 0.00% 60 182 0.00% 61 199 0.00% 62 199 0.00% 63 196 0.00% 64 204 0.00% 65 210 0.00% 66 235 0.00% 67 257 0.00% 68 200 0.00% 69 234 0.00% 70 255 0.00% 71 248 0.00% 72 222 0.00% 73 297 0.00% 74 353 0.00% 75 310 0.00% 76 345 0.00% 77 330 0.00% 78 357 0.00% 79 355 0.00% 80 381 0.00% 81 422 0.00% 82 421 0.00% 83 391 0.00% 84 571 0.00% 85 612 0.00% 86 596 0.00% 87 702 0.00% 88 715 0.00% 89 702 0.00% 90 1039 0.00% 91 1583 0.01% 92 1020 0.00% 93 1341 0.01% 94 2059 0.01% 95 6490 0.03% 96 36754 0.15% 97 131063 0.52% 98 491795 1.96% 99 1717496 6.84% 100 6137150 24.44% 101 16571503 65.99% 25112250 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=18 prefix-density=0.18 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=3 fanout-score=7.15 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.4 sequence=ACCTCCTCCAGCTCCTT Started job on | Dec 06 14:39:43 Started mapping on | Dec 06 14:39:43 Finished on | Dec 06 14:40:12 Mapping speed, Million of reads per hour | 3117.38 Number of input reads | 25112250 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 23672641 Uniquely mapped reads % | 94.27% Average mapped length | 100.24 Number of splices: Total | 8774150 Number of splices: Annotated (sjdb) | 8304705 Number of splices: GT/AG | 8654007 Number of splices: GC/AG | 107330 Number of splices: AT/AC | 5322 Number of splices: Non-canonical | 7491 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.50 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 693547 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 390411 % of reads mapped to too many loci | 1.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.19% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 746062 746062 746062 N_multimapping 693547 693547 693547 N_noFeature 1436310 12454762 12316487 N_ambiguous 390193 26589 29273 UnstrandedReadsAssigned:21846138 PositiveStrandReadsAssigned:11191290 NegativeStrandReadsAssigned:11326881 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853431 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853431-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,112,250 reads, 22,682,210 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,221 rounds 52973 SRR21853431.ke.tsv 35125 SRR21853431.se.tsv 88098 total ==> SRR21853431.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 44.9388 4.33826 PNS24247 1044 945 100.142 8.5626 PNS24249 1928 1829 84.4318 3.73003 PNS24246 1044 945 100.142 8.5626 PNS24248 1044 945 100.142 8.5626 PNS24244 1471 1372 120.202 7.07912 PNS24243 293 194 59 24.5737 KQK14069 1603 1504 7116.69 382.34 KQK14071 474 375 1987.55 428.259 ==> SRR21853431.se.tsv <== BRADI_1g14170v3 10581 BRADI_1g53295v3 154 BRADI_1g59795v3 1006 BRADI_1g07683v3 0 BRADI_1g00485v3 58 BRADI_1g20270v3 2067 BRADI_1g74790v3 193 BRADI_1g09890v3 7 BRADI_1g77505v3 620 BRADI_1g48960v3 0 SRR21853431 completed mapping pipeline successfully