Starting /dee2/code/volunteer_pipeline.sh SRR21853432 current disk space = 1550471987200 free memory = 1599714320 SRR21853432 SRAfilesize e9b00c9d8355900238873308e992c2ef SRR21853432.sra SRR21853432.sra file validated SRR21853432 is single end SRR21853432 is conventional basespace SRR21853432 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853432_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.03725 37.0 37.0 37.0 25.0 37.0 2 34.99275 37.0 37.0 37.0 25.0 37.0 3 35.50975 37.0 37.0 37.0 37.0 37.0 4 35.64075 37.0 37.0 37.0 37.0 37.0 5 35.74975 37.0 37.0 37.0 37.0 37.0 6 35.89925 37.0 37.0 37.0 37.0 37.0 7 35.64375 37.0 37.0 37.0 37.0 37.0 8 35.65925 37.0 37.0 37.0 37.0 37.0 9 35.83925 37.0 37.0 37.0 37.0 37.0 10-11 35.833749999999995 37.0 37.0 37.0 37.0 37.0 12-13 35.87025 37.0 37.0 37.0 37.0 37.0 14-15 35.751 37.0 37.0 37.0 37.0 37.0 16-17 35.783500000000004 37.0 37.0 37.0 37.0 37.0 18-19 35.6915 37.0 37.0 37.0 37.0 37.0 20-21 35.73675 37.0 37.0 37.0 37.0 37.0 22-23 35.76 37.0 37.0 37.0 37.0 37.0 24-25 35.64525 37.0 37.0 37.0 37.0 37.0 26-27 35.5745 37.0 37.0 37.0 37.0 37.0 28-29 35.66375 37.0 37.0 37.0 37.0 37.0 30-31 35.614999999999995 37.0 37.0 37.0 37.0 37.0 32-33 35.516000000000005 37.0 37.0 37.0 37.0 37.0 34-35 35.601 37.0 37.0 37.0 37.0 37.0 36-37 35.57067800850638 37.0 37.0 37.0 37.0 37.0 38-39 35.68876657493119 37.0 37.0 37.0 37.0 37.0 40-41 35.51038278709032 37.0 37.0 37.0 37.0 37.0 42-43 35.556417312984735 37.0 37.0 37.0 37.0 37.0 44-45 35.53715286464849 37.0 37.0 37.0 37.0 37.0 46-47 35.4758568926695 37.0 37.0 37.0 37.0 37.0 48-49 35.471103327495626 37.0 37.0 37.0 37.0 37.0 50-51 35.47710783087315 37.0 37.0 37.0 37.0 37.0 52-53 35.3930447835877 37.0 37.0 37.0 37.0 37.0 54-55 35.49774774774775 37.0 37.0 37.0 37.0 37.0 56-57 35.3968968968969 37.0 37.0 37.0 37.0 37.0 58-59 35.370870870870874 37.0 37.0 37.0 37.0 37.0 60-61 35.45595595595596 37.0 37.0 37.0 37.0 37.0 62-63 35.38838838838839 37.0 37.0 37.0 37.0 37.0 64-65 35.332332332332335 37.0 37.0 37.0 37.0 37.0 66-67 35.302878598247815 37.0 37.0 37.0 31.0 37.0 68-69 35.30162703379224 37.0 37.0 37.0 31.0 37.0 70-71 35.318397997496874 37.0 37.0 37.0 31.0 37.0 72-73 35.11414267834793 37.0 37.0 37.0 25.0 37.0 74-75 35.18873591989987 37.0 37.0 37.0 25.0 37.0 76-77 35.10838548185231 37.0 37.0 37.0 25.0 37.0 78-79 35.162953692115146 37.0 37.0 37.0 25.0 37.0 80-81 35.22208312468703 37.0 37.0 37.0 31.0 37.0 82-83 35.24236354531798 37.0 37.0 37.0 31.0 37.0 84-85 35.10590886329494 37.0 37.0 37.0 25.0 37.0 86-87 35.25616850018328 37.0 37.0 37.0 31.0 37.0 88-89 35.09942016514873 37.0 37.0 37.0 25.0 37.0 90-91 35.31062124248497 37.0 37.0 37.0 31.0 37.0 92-93 35.260020040080164 37.0 37.0 37.0 31.0 37.0 94-95 35.18015534953646 37.0 37.0 37.0 31.0 37.0 96-97 35.0526493267317 37.0 37.0 37.0 25.0 37.0 98-99 35.14312536498669 37.0 37.0 37.0 25.0 37.0 100-101 35.13388670546715 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 6.0 24 5.0 25 6.0 26 12.0 27 29.0 28 36.0 29 54.0 30 84.0 31 119.0 32 127.0 33 191.0 34 307.0 35 550.0 36 2049.0 37 420.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.74655991993996 12.95971978984238 15.186389792344258 43.107330497873406 2 25.157868148522354 19.550391513008336 30.79060368779995 24.501136650669363 3 26.51988991743808 22.34175631723793 21.591193395046286 29.54716037027771 4 28.04603452589442 28.971728796597446 17.91343507630723 25.068801601200903 5 28.271203402551915 28.74655991993996 19.96497373029772 23.01726294721041 6 23.667750813109834 32.27420565424068 20.240180135101326 23.817863397548162 7 19.764823617713283 16.91268451338504 35.70177633224919 27.62071553665249 8 24.093069802351764 22.54190642982237 23.617713284963724 29.74731048286215 9 22.9672254190643 20.8656492369277 27.570678008506377 28.596447335501622 10-11 25.73179884913685 27.120340255191394 20.115086314736054 27.032774580935705 12-13 24.893670252689517 21.828871653740308 24.655991993995496 28.621466099574683 14-15 24.756067050287715 23.692769577182887 24.31823867900926 27.23292469352014 16-17 25.65674255691769 24.093069802351764 23.229922441831373 27.020265198899175 18-19 26.09457092819615 24.405804353264948 22.39179384538404 27.107830873154864 20-21 25.40655491618714 23.742807105328996 23.855391543657746 26.99524643482612 22-23 25.819364523392547 23.692769577182887 23.229922441831373 27.257943457593193 24-25 25.569176882662 23.39254440830623 23.767825869402053 27.270452839629723 26-27 25.869402051538653 24.280710532899676 23.00475356517388 26.845133850387793 28-29 25.381536152114087 23.455091318488865 23.517638228671505 27.645734300725543 30-31 24.530898173630224 23.95546659994996 23.63022266700025 27.88341255941956 32-33 26.745058794095574 24.48086064548411 22.34175631723793 26.432324243182386 34-35 26.057042782086565 23.742807105328996 23.53014761070803 26.670002501876404 36-37 25.444083062296723 23.380035026269702 23.54265699274456 27.633224918689013 38-39 25.806855141356017 24.130597948461347 24.080560420315237 25.9819864898674 40-41 25.83187390542907 23.46760070052539 22.81711283462597 27.88341255941956 42-43 25.906930197648236 23.517638228671505 22.604453340005005 27.970978233675257 44-45 26.044533400050035 24.11808856642482 22.654490868151115 27.18288716537403 46-47 25.781836377282964 23.46760070052539 23.067300475356518 27.683262446835126 48-49 26.56992744558419 24.00550412809607 22.779584688516387 26.64498373780335 50-51 25.268951713785338 23.692769577182887 23.667750813109834 27.370527895921942 52-53 25.73179884913685 23.29246935201401 22.742056542406804 28.233675256442332 54-55 26.05105105105105 23.64864864864865 22.785285285285287 27.515015015015017 56-57 27.114614614614613 24.261761761761765 22.67267267267267 25.95095095095095 58-59 26.026026026026027 23.073073073073072 23.923923923923923 26.976976976976978 60-61 25.43793793793794 22.27227227227227 23.836336336336338 28.453453453453452 62-63 26.38888888888889 23.41091091091091 23.1981981981982 27.002002002002 64-65 26.313813813813812 23.34834834834835 23.123123123123122 27.214714714714717 66-67 25.844806007509387 23.779724655819777 22.866082603254068 27.50938673341677 68-69 26.558197747183982 22.478097622027533 23.14142678347935 27.822277847309135 70-71 26.14518147684606 22.966207759699625 23.2540675844806 27.63454317897372 72-73 26.157697121401753 23.46683354192741 22.778473091364205 27.59699624530663 74-75 26.72090112640801 23.804755944931163 23.153942428035045 26.320400500625784 76-77 25.732165206508135 23.85481852315394 22.44055068836045 27.972465581977474 78-79 25.519399249061326 23.454317897371716 22.97872340425532 28.04755944931164 80-81 26.50225338007011 23.184777165748624 24.173760640961444 26.139208813219827 82-83 25.863795693540307 23.347521281922884 22.183274912368553 28.605408112168252 84-85 26.239359038557836 23.197295943915876 23.547821732598898 27.01552328492739 86-87 26.367847752597974 22.761988230875172 23.550770001252033 27.319394015274824 88-89 27.213525360050095 22.629931120851595 22.492172824045085 27.664370695053226 90-91 26.252505010020037 23.296593186372746 23.49699398797595 26.95390781563126 92-93 26.01452905811623 23.08366733466934 22.833166332665332 28.068637274549097 94-95 27.0107742420446 22.826359308444 22.80130293159609 27.36156351791531 96-97 26.76780341023069 22.417251755265795 23.382647943831493 27.432296890672013 98-99 27.492370295015263 22.482197355035606 23.003560528992878 27.021871820956257 100-101 28.801123946300343 9.631595379331877 27.864502029347488 33.702778645020295 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 3.5 29 5.0 30 3.5 31 5.5 32 12.0 33 17.5 34 22.5 35 29.5 36 36.0 37 41.5 38 56.5 39 77.5 40 95.0 41 113.5 42 125.5 43 137.5 44 152.5 45 164.5 46 164.0 47 158.0 48 156.0 49 142.5 50 128.0 51 121.0 52 118.0 53 103.0 54 91.0 55 83.5 56 76.5 57 89.5 58 89.5 59 88.5 60 86.0 61 74.0 62 82.0 63 86.5 64 85.5 65 82.5 66 84.0 67 86.0 68 87.0 69 75.5 70 61.0 71 65.0 72 63.0 73 50.5 74 42.5 75 42.5 76 37.5 77 29.5 78 21.0 79 15.5 80 10.5 81 5.0 82 4.5 83 6.0 84 3.5 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 1.0250000000000001 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.075 14-15 0.075 16-17 0.075 18-19 0.075 20-21 0.075 22-23 0.075 24-25 0.075 26-27 0.075 28-29 0.075 30-31 0.075 32-33 0.075 34-35 0.075 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 3.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 1.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 1.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 1.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 1.0 88-89 1.0 90-91 0.0 92-93 1.0 94-95 0.0 96-97 25.0 98-99 314.0 100-101 3652.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.975 #Duplication Level Percentage of deduplicated Percentage of total 1 92.98198440440979 86.45 2 6.560903468674375 12.2 3 0.4302231782737295 1.2 4 0.0 0.0 5 0.0 0.0 6 0.026888948642108095 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 6 0.15 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0125 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.05 70-71 0.0 0.0 0.0 0.0 0.05 72-73 0.0 0.0 0.0 0.0 0.05 74-75 0.0 0.0 0.0 0.0 0.05 76-77 0.0 0.0 0.0 0.0 0.05 78-79 0.0 0.0 0.0 0.0 0.05 80-81 0.0 0.0 0.0 0.0 0.05 82-83 0.0 0.0 0.0 0.0 0.05 84-85 0.0 0.0 0.0 0.0 0.05 86-87 0.0 0.0 0.0 0.0 0.05 88-89 0.0 0.0 0.0 0.0 0.05 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540514 spots for SRR21853432.sra Written 540514 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra Read 540503 spots for SRR21853432.sra Written 540503 spots for SRR21853432.sra SRR ids: ['SRR21853432.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0jmr97wd SRR21853432.sra spots: 10810071 blocks: [[1, 540503], [540504, 1081006], [1081007, 1621509], [1621510, 2162012], [2162013, 2702515], [2702516, 3243018], [3243019, 3783521], [3783522, 4324024], [4324025, 4864527], [4864528, 5405030], [5405031, 5945533], [5945534, 6486036], [6486037, 7026539], [7026540, 7567042], [7567043, 8107545], [8107546, 8648048], [8648049, 9188551], [9188552, 9729054], [9729055, 10269557], [10269558, 10810071]] SRR21853432 file size 2906555 SRR21853432 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853432 SRR21853432_1.fastq Input file: SRR21853432_1.fastq trimmed: SRR21853432-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:45:35 2024 >> started Fri Dec 6 14:45:43 2024 >> done (8.051s) 10810071 reads processed; of these: 38 ( 0.00%) short reads filtered out after trimming by size control 28765 ( 0.27%) empty reads filtered out after trimming by size control 10781268 (99.73%) reads available; of these: 480 ( 0.00%) trimmed reads available after processing 10780788 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 4 0.00% 23 7 0.00% 24 4 0.00% 25 4 0.00% 26 5 0.00% 27 4 0.00% 28 4 0.00% 29 7 0.00% 30 9 0.00% 31 6 0.00% 32 8 0.00% 33 8 0.00% 34 4 0.00% 35 160 0.00% 36 157 0.00% 37 177 0.00% 38 185 0.00% 39 191 0.00% 40 182 0.00% 41 216 0.00% 42 160 0.00% 43 174 0.00% 44 153 0.00% 45 174 0.00% 46 173 0.00% 47 172 0.00% 48 174 0.00% 49 194 0.00% 50 197 0.00% 51 189 0.00% 52 202 0.00% 53 205 0.00% 54 204 0.00% 55 208 0.00% 56 200 0.00% 57 194 0.00% 58 227 0.00% 59 192 0.00% 60 247 0.00% 61 245 0.00% 62 244 0.00% 63 205 0.00% 64 278 0.00% 65 225 0.00% 66 250 0.00% 67 290 0.00% 68 255 0.00% 69 261 0.00% 70 260 0.00% 71 282 0.00% 72 242 0.00% 73 241 0.00% 74 259 0.00% 75 275 0.00% 76 308 0.00% 77 288 0.00% 78 333 0.00% 79 312 0.00% 80 343 0.00% 81 330 0.00% 82 299 0.00% 83 333 0.00% 84 359 0.00% 85 363 0.00% 86 380 0.00% 87 390 0.00% 88 414 0.00% 89 415 0.00% 90 513 0.00% 91 770 0.01% 92 476 0.00% 93 615 0.01% 94 1003 0.01% 95 3029 0.03% 96 14574 0.14% 97 46216 0.43% 98 183441 1.70% 99 703968 6.53% 100 2316315 21.48% 101 7496681 69.53% 10781268 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=23 prefix-density=0.40 prefix-fanout=1.9 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=283.63 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=25.0 sequence=CGCCGCCGCCGA Started job on | Dec 06 14:46:00 Started mapping on | Dec 06 14:46:00 Finished on | Dec 06 14:46:15 Mapping speed, Million of reads per hour | 2587.50 Number of input reads | 10781268 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 10005071 Uniquely mapped reads % | 92.80% Average mapped length | 100.29 Number of splices: Total | 3143694 Number of splices: Annotated (sjdb) | 2970268 Number of splices: GT/AG | 3099413 Number of splices: GC/AG | 37917 Number of splices: AT/AC | 1626 Number of splices: Non-canonical | 4738 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.00% Deletion average length | 1.75 Insertion rate per base | 0.00% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 370327 % of reads mapped to multiple loci | 3.43% Number of reads mapped to too many loci | 272710 % of reads mapped to too many loci | 2.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.81% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 405870 405870 405870 N_multimapping 370327 370327 370327 N_noFeature 403848 5304771 4974348 N_ambiguous 151585 12486 10370 UnstrandedReadsAssigned:9449638 PositiveStrandReadsAssigned:4687814 NegativeStrandReadsAssigned:5020353 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853432 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853432-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,781,268 reads, 9,735,419 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,030 rounds 52973 SRR21853432.ke.tsv 35125 SRR21853432.se.tsv 88098 total ==> SRR21853432.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 27.5857 5.66725 PNS24247 1044 945 12.5305 2.28008 PNS24249 1928 1829 156.614 14.7241 PNS24246 1044 945 12.5305 2.28008 PNS24248 1044 945 12.5305 2.28008 PNS24244 1471 1372 12.2089 1.53015 PNS24243 293 194 14 12.4091 KQK14069 1603 1504 4541.21 519.203 KQK14071 474 375 428.704 196.58 ==> SRR21853432.se.tsv <== BRADI_1g14170v3 5437 BRADI_1g53295v3 75 BRADI_1g59795v3 162 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 785 BRADI_1g74790v3 150 BRADI_1g09890v3 3 BRADI_1g77505v3 120 BRADI_1g48960v3 0 SRR21853432 completed mapping pipeline successfully