Starting /dee2/code/volunteer_pipeline.sh SRR21853433 current disk space = 1550462025728 free memory = 1598854916 SRR21853433 SRAfilesize 0e09f5ab97a94b6c3370516463a2fed4 SRR21853433.sra SRR21853433.sra file validated SRR21853433 is single end SRR21853433 is conventional basespace SRR21853433 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853433_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.6395 37.0 37.0 37.0 25.0 37.0 2 35.34475 37.0 37.0 37.0 37.0 37.0 3 35.63575 37.0 37.0 37.0 37.0 37.0 4 35.92825 37.0 37.0 37.0 37.0 37.0 5 35.87125 37.0 37.0 37.0 37.0 37.0 6 35.81875 37.0 37.0 37.0 37.0 37.0 7 35.76375 37.0 37.0 37.0 37.0 37.0 8 35.75825 37.0 37.0 37.0 37.0 37.0 9 35.90025 37.0 37.0 37.0 37.0 37.0 10-11 35.922250000000005 37.0 37.0 37.0 37.0 37.0 12-13 35.83775 37.0 37.0 37.0 37.0 37.0 14-15 35.838 37.0 37.0 37.0 37.0 37.0 16-17 35.761250000000004 37.0 37.0 37.0 37.0 37.0 18-19 35.8665 37.0 37.0 37.0 37.0 37.0 20-21 35.79875 37.0 37.0 37.0 37.0 37.0 22-23 35.790499999999994 37.0 37.0 37.0 37.0 37.0 24-25 35.6515 37.0 37.0 37.0 37.0 37.0 26-27 35.635999999999996 37.0 37.0 37.0 37.0 37.0 28-29 35.561 37.0 37.0 37.0 37.0 37.0 30-31 35.63975 37.0 37.0 37.0 37.0 37.0 32-33 35.5085 37.0 37.0 37.0 37.0 37.0 34-35 35.6265 37.0 37.0 37.0 37.0 37.0 36-37 35.541645822911455 37.0 37.0 37.0 37.0 37.0 38-39 35.640730547910934 37.0 37.0 37.0 37.0 37.0 40-41 35.60495371528647 37.0 37.0 37.0 37.0 37.0 42-43 35.49393814630242 37.0 37.0 37.0 37.0 37.0 44-45 35.41829329329329 37.0 37.0 37.0 37.0 37.0 46-47 35.48035535535536 37.0 37.0 37.0 37.0 37.0 48-49 35.23598598598599 37.0 37.0 37.0 31.0 37.0 50-51 35.357607607607605 37.0 37.0 37.0 31.0 37.0 52-53 35.41516516516516 37.0 37.0 37.0 31.0 37.0 54-55 35.34234234234234 37.0 37.0 37.0 31.0 37.0 56-57 35.3480980980981 37.0 37.0 37.0 31.0 37.0 58-59 35.32132132132132 37.0 37.0 37.0 31.0 37.0 60-61 35.15294117647059 37.0 37.0 37.0 25.0 37.0 62-63 35.17399039736075 37.0 37.0 37.0 25.0 37.0 64-65 35.266399599399094 37.0 37.0 37.0 31.0 37.0 66-67 35.25115277474188 37.0 37.0 37.0 25.0 37.0 68-69 35.23841723015277 37.0 37.0 37.0 25.0 37.0 70-71 35.16428750313048 37.0 37.0 37.0 25.0 37.0 72-73 35.11845730027548 37.0 37.0 37.0 25.0 37.0 74-75 35.03130139567891 37.0 37.0 37.0 25.0 37.0 76-77 35.06088699574042 37.0 37.0 37.0 25.0 37.0 78-79 34.922826359308445 37.0 37.0 37.0 25.0 37.0 80-81 34.97569531445753 37.0 37.0 37.0 25.0 37.0 82-83 34.782761212728644 37.0 37.0 37.0 25.0 37.0 84-85 35.050112753695814 37.0 37.0 37.0 25.0 37.0 86-87 34.91455775494863 37.0 37.0 37.0 25.0 37.0 88-89 34.8599348534202 37.0 37.0 37.0 25.0 37.0 90-91 34.58431470809321 37.0 37.0 37.0 25.0 37.0 92-93 34.725563909774436 37.0 37.0 37.0 25.0 37.0 94-95 34.640573733154646 37.0 37.0 37.0 25.0 37.0 96-97 34.6481346658655 37.0 37.0 37.0 25.0 37.0 98-99 34.587452364696645 37.0 37.0 37.0 25.0 37.0 100-101 34.589275929113015 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 2.0 24 5.0 25 10.0 26 12.0 27 25.0 28 31.0 29 52.0 30 77.0 31 121.0 32 165.0 33 222.0 34 358.0 35 694.0 36 1886.0 37 337.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.539769884942473 12.156078039019508 13.581790895447723 44.7223611805903 2 26.78169542385596 19.579894973743436 29.03225806451613 24.60615153788447 3 25.819364523392547 21.94145609206905 22.316737553164874 29.92244183137353 4 29.00725181295324 27.881970492623154 17.404351087771943 25.70642660665166 5 26.881720430107524 29.957489372343087 19.604901225306325 23.55588897224306 6 23.605901475368842 32.208052013003254 20.68017004251063 23.50587646911728 7 21.680420105026258 17.20430107526882 34.7586896724181 26.356589147286826 8 22.9057264316079 22.405601400350086 23.905976494123532 30.782695673918482 9 22.73068267066767 21.255313828457115 27.906976744186046 28.107026756689173 10-11 26.206551637909474 26.25656414103526 19.91747936984246 27.619404851212803 12-13 24.85621405351338 21.230307576894223 25.28132033008252 28.632158039509875 14-15 24.5311327831958 23.793448362090523 24.243560890222557 27.431857964491122 16-17 25.03125781445361 23.34333583395849 23.905976494123532 27.719429857464366 18-19 25.18129532383096 24.20605151287822 23.418354588647162 27.19429857464366 20-21 25.656414103525883 24.043510877719427 23.34333583395849 26.9567391847962 22-23 25.468867216804203 24.568642160540136 23.280820205051263 26.6816704176044 24-25 25.04376094023506 24.406101525381345 23.40585146286572 27.144286071517882 26-27 24.343585896474117 24.418604651162788 23.193298324581146 28.044511127781945 28-29 26.056514128532132 23.53088272068017 23.0432608152038 27.369342335583895 30-31 24.343585896474117 23.80595148787197 24.8062015503876 27.04426106526632 32-33 25.09377344336084 24.356089022255563 24.031007751937985 26.51912978244561 34-35 25.03125781445361 23.755938984746187 22.95573893473368 28.257064266066518 36-37 25.54096310193871 24.102564102564102 22.76422764227642 27.592245153220762 38-39 25.594195646735052 24.11808856642482 22.879659744808606 27.408056042031525 40-41 26.419814861145856 22.854640980735553 23.78033525143858 26.945208906680012 42-43 25.797572876266734 23.80833229075441 22.99512073063931 27.398974102339547 44-45 25.89162808159179 23.276185708922537 22.637967713677888 28.19421849580778 46-47 25.804029533224877 23.33875610061319 23.213615317231888 27.643599048930046 48-49 25.8008008008008 23.11061061061061 23.56106106106106 27.52752752752753 50-51 25.125125125125123 24.74974974974975 22.57257257257257 27.55255255255255 52-53 26.313813813813812 23.5985985985986 23.123123123123122 26.964464464464466 54-55 26.876876876876878 22.8978978978979 23.61111111111111 26.614114114114113 56-57 25.563063063063062 23.673673673673672 23.81131131131131 26.95195195195195 58-59 25.725725725725724 22.972972972972975 23.21071071071071 28.09059059059059 60-61 25.957446808510635 22.97872340425532 23.792240300375468 27.271589486858574 62-63 25.935661534610087 23.23194392289398 23.219426711728627 27.612967830767303 64-65 26.877816725087634 23.798197295943915 22.25838758137206 27.065598397596396 66-67 25.491423563290343 24.101665205959684 23.46312758232127 26.9437836484287 68-69 25.945404457801153 23.340846481342346 23.25319308790383 27.460555972952665 70-71 26.145755071374904 23.716503881793138 22.9526671675432 27.18507387928876 72-73 25.544703230653642 22.61457550713749 23.415977961432507 28.424743300776356 74-75 26.875391358797746 23.95742016280526 22.47964934251722 26.687539135879774 76-77 26.183913806063643 23.11450764219494 23.30243046855425 27.399148083187168 78-79 25.945878226008517 22.550739163117015 22.9892257579554 28.514156852919072 80-81 25.945878226008517 22.92658481583563 23.415184164369833 27.712352793786017 82-83 26.998246053620644 22.851415685291908 23.139564019042847 27.0107742420446 84-85 25.319468804810825 24.36732648459033 22.613380105236782 27.699824605362068 86-87 26.158857429215736 23.202204961162614 23.477825106489604 27.161112503132046 88-89 26.797795038837386 22.41292909045352 23.552994237033325 27.23628163367577 90-91 26.02104735655224 22.425457278877474 23.415184164369833 28.138311200200448 92-93 26.57894736842105 22.99498746867168 22.91979949874687 27.506265664160402 94-95 26.38175209926056 23.31119187868154 23.073066800350922 27.233989221706985 96-97 26.31974921630094 22.733542319749215 23.54858934169279 27.398119122257054 98-99 26.942610462163536 21.406805485017774 24.08583037074657 27.56475368207212 100-101 28.409270061485103 10.97272583950812 26.943086867412898 33.67491723159388 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 2.0 27 2.5 28 4.5 29 6.0 30 6.0 31 7.0 32 9.5 33 13.5 34 20.0 35 26.0 36 33.0 37 43.0 38 64.5 39 75.5 40 82.5 41 97.0 42 124.0 43 132.0 44 142.5 45 159.5 46 163.5 47 157.0 48 135.0 49 138.0 50 141.0 51 142.5 52 131.5 53 121.5 54 107.5 55 90.0 56 95.0 57 96.5 58 89.0 59 89.0 60 89.5 61 88.0 62 90.0 63 80.0 64 80.0 65 88.0 66 86.0 67 74.5 68 64.5 69 73.5 70 71.0 71 61.5 72 67.0 73 58.0 74 38.0 75 34.0 76 35.0 77 27.5 78 14.5 79 9.5 80 11.5 81 8.0 82 3.0 83 3.0 84 2.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.025 3 0.075 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.01250625312656328 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.012512512512512512 46-47 0.012512512512512512 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 2.0 36-37 1.0 38-39 0.0 40-41 0.0 42-43 1.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 1.0 60-61 0.0 62-63 1.0 64-65 0.0 66-67 1.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 2.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 1.0 92-93 0.0 94-95 1.0 96-97 16.0 98-99 350.0 100-101 3623.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.825 #Duplication Level Percentage of deduplicated Percentage of total 1 94.8325863432639 89.925 2 4.877405747429475 9.25 3 0.29000790930661746 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154818 spots for SRR21853433.sra Written 154818 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra Read 154800 spots for SRR21853433.sra Written 154800 spots for SRR21853433.sra SRR ids: ['SRR21853433.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lysv69ew SRR21853433.sra spots: 3096018 blocks: [[1, 154800], [154801, 309600], [309601, 464400], [464401, 619200], [619201, 774000], [774001, 928800], [928801, 1083600], [1083601, 1238400], [1238401, 1393200], [1393201, 1548000], [1548001, 1702800], [1702801, 1857600], [1857601, 2012400], [2012401, 2167200], [2167201, 2322000], [2322001, 2476800], [2476801, 2631600], [2631601, 2786400], [2786401, 2941200], [2941201, 3096018]] SRR21853433 file size 831684 SRR21853433 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853433 SRR21853433_1.fastq Input file: SRR21853433_1.fastq trimmed: SRR21853433-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:39:44 2024 >> started Fri Dec 6 14:39:45 2024 >> done (1.751s) 3096018 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 5883 ( 0.19%) empty reads filtered out after trimming by size control 3090127 (99.81%) reads available; of these: 232 ( 0.01%) trimmed reads available after processing 3089895 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 0 0.00% 29 3 0.00% 30 0 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 6 0.00% 35 28 0.00% 36 32 0.00% 37 22 0.00% 38 24 0.00% 39 24 0.00% 40 30 0.00% 41 38 0.00% 42 37 0.00% 43 36 0.00% 44 24 0.00% 45 24 0.00% 46 25 0.00% 47 29 0.00% 48 24 0.00% 49 27 0.00% 50 32 0.00% 51 30 0.00% 52 33 0.00% 53 33 0.00% 54 27 0.00% 55 30 0.00% 56 30 0.00% 57 39 0.00% 58 40 0.00% 59 45 0.00% 60 35 0.00% 61 36 0.00% 62 48 0.00% 63 32 0.00% 64 26 0.00% 65 43 0.00% 66 38 0.00% 67 47 0.00% 68 40 0.00% 69 38 0.00% 70 41 0.00% 71 34 0.00% 72 45 0.00% 73 60 0.00% 74 45 0.00% 75 58 0.00% 76 54 0.00% 77 30 0.00% 78 47 0.00% 79 68 0.00% 80 64 0.00% 81 69 0.00% 82 52 0.00% 83 45 0.00% 84 62 0.00% 85 55 0.00% 86 61 0.00% 87 77 0.00% 88 68 0.00% 89 78 0.00% 90 104 0.00% 91 168 0.01% 92 90 0.00% 93 141 0.00% 94 235 0.01% 95 779 0.03% 96 3976 0.13% 97 12943 0.42% 98 51548 1.67% 99 200912 6.50% 100 659320 21.34% 101 2157632 69.82% 3090127 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=24 prefix-density=0.41 prefix-fanout=1.9 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=288.28 fanout-score-rank=1 prefix-density=1.11 prefix-fanout=25.4 sequence=GCCGCCGCCACC Started job on | Dec 06 14:40:02 Started mapping on | Dec 06 14:40:02 Finished on | Dec 06 14:40:09 Mapping speed, Million of reads per hour | 1589.21 Number of input reads | 3090127 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 2858493 Uniquely mapped reads % | 92.50% Average mapped length | 100.34 Number of splices: Total | 879250 Number of splices: Annotated (sjdb) | 831476 Number of splices: GT/AG | 866951 Number of splices: GC/AG | 10822 Number of splices: AT/AC | 459 Number of splices: Non-canonical | 1018 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.00% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 105498 % of reads mapped to multiple loci | 3.41% Number of reads mapped to too many loci | 87248 % of reads mapped to too many loci | 2.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.00% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 126136 126136 126136 N_multimapping 105498 105498 105498 N_noFeature 114699 1522660 1413329 N_ambiguous 43545 3634 2996 UnstrandedReadsAssigned:2700249 PositiveStrandReadsAssigned:1332199 NegativeStrandReadsAssigned:1442168 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853433 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853433-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,090,127 reads, 2,784,445 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,007 rounds 52973 SRR21853433.ke.tsv 35125 SRR21853433.se.tsv 88098 total ==> SRR21853433.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 7.20349 4.6168 PNS24249 1928 1829 40.6957 13.4761 PNS24246 1044 945 7.20349 4.6168 PNS24248 1044 945 7.20349 4.6168 PNS24244 1471 1372 11.6938 5.16219 PNS24243 293 194 5 15.6099 KQK14069 1603 1504 1279.87 515.403 KQK14071 474 375 96.4692 155.807 ==> SRR21853433.se.tsv <== BRADI_1g14170v3 1456 BRADI_1g53295v3 16 BRADI_1g59795v3 48 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 245 BRADI_1g74790v3 50 BRADI_1g09890v3 1 BRADI_1g77505v3 39 BRADI_1g48960v3 0 SRR21853433 completed mapping pipeline successfully