Starting /dee2/code/volunteer_pipeline.sh SRR21853434 current disk space = 1550462025728 free memory = 1598859860 SRR21853434 SRAfilesize 649d5046e79c1912ac22daadca58890c SRR21853434.sra SRR21853434.sra file validated SRR21853434 is single end SRR21853434 is conventional basespace SRR21853434 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853434_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.217 32.0 32.0 32.0 32.0 32.0 2 31.40875 32.0 32.0 32.0 32.0 32.0 3 31.511 32.0 32.0 32.0 32.0 32.0 4 31.50525 32.0 32.0 32.0 32.0 32.0 5 31.51225 32.0 32.0 32.0 32.0 32.0 6 34.88 36.0 36.0 36.0 36.0 36.0 7 35.17175 36.0 36.0 36.0 36.0 36.0 8 35.00025 36.0 36.0 36.0 36.0 36.0 9 35.06 36.0 36.0 36.0 36.0 36.0 10-11 35.072375 36.0 36.0 36.0 36.0 36.0 12-13 35.094750000000005 36.0 36.0 36.0 36.0 36.0 14-15 35.148250000000004 36.0 36.0 36.0 36.0 36.0 16-17 35.09925 36.0 36.0 36.0 36.0 36.0 18-19 35.074 36.0 36.0 36.0 36.0 36.0 20-21 35.113249999999994 36.0 36.0 36.0 36.0 36.0 22-23 35.041375 36.0 36.0 36.0 36.0 36.0 24-25 35.092625 36.0 36.0 36.0 36.0 36.0 26-27 34.908500000000004 36.0 36.0 36.0 36.0 36.0 28-29 34.9395 36.0 36.0 36.0 34.0 36.0 30-31 34.964124999999996 36.0 36.0 36.0 32.0 36.0 32-33 34.810249999999996 36.0 36.0 36.0 32.0 36.0 34-35 34.8455 36.0 36.0 36.0 32.0 36.0 36-37 34.77538769384692 36.0 36.0 36.0 32.0 36.0 38-39 34.670460230115054 36.0 36.0 36.0 32.0 36.0 40-41 34.65932966483241 36.0 36.0 36.0 34.0 36.0 42-43 34.787965974480855 36.0 36.0 36.0 32.0 36.0 44-45 34.68764073054791 36.0 36.0 36.0 32.0 36.0 46-47 34.771078308731546 36.0 36.0 36.0 32.0 36.0 48-49 34.684513385038784 36.0 36.0 36.0 32.0 36.0 50-51 34.65911933950463 36.0 36.0 36.0 32.0 36.0 52-53 34.604354354354356 36.0 36.0 36.0 32.0 36.0 54-55 34.566566566566564 36.0 36.0 36.0 32.0 36.0 56-57 34.4268018018018 36.0 36.0 36.0 32.0 36.0 58-59 34.24862362362362 36.0 36.0 36.0 32.0 36.0 60-61 34.428553553553556 36.0 36.0 36.0 32.0 36.0 62-63 34.29892392392392 36.0 36.0 36.0 32.0 36.0 64-65 34.21671671671672 36.0 36.0 36.0 32.0 36.0 66-67 34.19331831831832 36.0 36.0 36.0 32.0 36.0 68-69 34.28328328328328 36.0 36.0 36.0 32.0 36.0 70-71 34.092592592592595 36.0 36.0 36.0 32.0 36.0 72-73 34.233608608608606 36.0 36.0 36.0 32.0 36.0 74-75 34.09934934934935 36.0 36.0 36.0 32.0 36.0 76-77 34.07382382382383 36.0 36.0 36.0 32.0 36.0 78-79 33.97647647647648 36.0 36.0 36.0 32.0 36.0 80-81 33.856231231231234 36.0 36.0 36.0 32.0 36.0 82-83 33.91266266266267 36.0 36.0 36.0 29.5 36.0 84-85 33.88185231539424 36.0 36.0 36.0 29.5 36.0 86-87 33.93391739674593 36.0 36.0 36.0 32.0 36.0 88-89 33.8459324155194 36.0 36.0 36.0 29.5 36.0 90-91 33.65882352941176 36.0 36.0 36.0 27.0 36.0 92-93 33.81501877346683 36.0 36.0 36.0 27.0 36.0 94-95 33.666207759699624 36.0 36.0 36.0 27.0 36.0 96-97 33.73426895796189 36.0 36.0 36.0 27.0 36.0 98-99 33.73181585642401 36.0 36.0 36.0 27.0 36.0 100-101 32.749068496372104 36.0 34.0 36.0 20.5 36.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 11101 1 0.0 11101 2 0.0 11101 3 0.0 11101 4 0.0 11101 5 0.0 11101 6 0.0 11101 7 0.0 11101 8 0.0 11101 9 0.0 11101 10-11 0.0 11101 12-13 0.0 11101 14-15 0.0 11101 16-17 0.0 11101 18-19 0.0 11101 20-21 0.0 11101 22-23 0.0 11101 24-25 0.0 11101 26-27 0.0 11101 28-29 0.0 11101 30-31 0.0 11101 32-33 0.0 11101 34-35 0.0 11101 36-37 0.0 11101 38-39 0.0 11101 40-41 0.0 11101 42-43 0.0 11101 44-45 0.0 11101 46-47 0.0 11101 48-49 0.0 11101 50-51 0.0 11101 52-53 0.0 11101 54-55 0.0 11101 56-57 0.0 11101 58-59 0.0 11101 60-61 0.0 11101 62-63 0.0 11101 64-65 0.0 11101 66-67 0.0 11101 68-69 0.0 11101 70-71 0.0 11101 72-73 0.0 11101 74-75 0.0 11101 76-77 0.0 11101 78-79 0.0 11101 80-81 0.0 11101 82-83 0.0 11101 84-85 0.0 11101 86-87 0.0 11101 88-89 0.0 11101 90-91 0.0 11101 92-93 0.0 11101 94-95 0.0 11101 96-97 0.0 11101 98-99 0.0 11101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 2.0 22 3.0 23 8.0 24 7.0 25 11.0 26 31.0 27 38.0 28 52.0 29 80.0 30 124.0 31 121.0 32 199.0 33 327.0 34 713.0 35 2281.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.51425712856428 12.656328164082039 15.607803901950975 43.2216108054027 2 25.512756378189096 19.809904952476238 29.689844922461226 24.987493746873437 3 25.03751875937969 24.16208104052026 21.585792896448226 29.214607303651825 4 27.163581790895446 28.489244622311155 17.55877938969485 26.788394197098548 5 26.863431715857928 30.940470235117555 19.609804902451224 22.586293146573286 6 23.661051043500127 32.159919537339704 20.165954236861953 24.013075182298216 7 21.38569284642321 17.2336168084042 35.79289644822411 25.587793896948476 8 22.861430715357677 21.410705352676338 23.486743371685844 32.24112056028014 9 22.136068034017008 20.410205102551277 27.66383191595798 29.789894947473737 10-11 26.313156578289142 27.07603801900951 19.609804902451224 27.00100050025013 12-13 24.462231115557778 21.710855427713856 24.899949974987493 28.92696348174087 14-15 25.125062531265634 24.499749874937468 23.149074537268636 27.226113056528263 16-17 25.3751875937969 23.71185592796398 23.54927463731866 27.363681840920464 18-19 25.237618809404704 23.6368184092046 23.536768384192097 27.5887943971986 20-21 26.038019009504755 22.861430715357677 23.574287143571787 27.52626313156578 22-23 26.025512756378188 23.12406203101551 23.88694347173587 26.96348174087044 24-25 25.57528764382191 23.56178089044522 23.28664332166083 27.576288144072038 26-27 25.512756378189096 24.637318659329665 23.59929964982491 26.25062531265633 28-29 25.275137568784395 23.949474737368686 22.936468234117058 27.838919459729865 30-31 24.787393696848426 24.12456228114057 24.062031015507753 27.026013006503252 32-33 26.000500250125064 24.024512256128062 22.811405702851424 27.163581790895446 34-35 25.887943971985994 23.3991995997999 23.486743371685844 27.226113056528263 36-37 25.100050025012504 23.574287143571787 23.43671835917959 27.888944472236116 38-39 25.550275137568786 24.137068534267133 23.036518259129565 27.276138069034516 40-41 26.513256628314156 22.998999499749875 23.19909954977489 27.288644322161083 42-43 25.369026770077557 23.91793845384038 23.68026019514636 27.032774580935705 44-45 25.9819864898674 23.380035026269702 22.854640980735553 27.78333750312735 46-47 25.706780085063798 23.042281711283465 22.54190642982237 28.709031773830375 48-49 26.21966474856142 23.705278959219413 23.867900925694272 26.207155366524894 50-51 25.73179884913685 24.405804353264948 22.75456592444333 27.107830873154864 52-53 26.7017017017017 22.6976976976977 23.285785785785787 27.314814814814813 54-55 26.05105105105105 22.54754754754755 23.56106106106106 27.84034034034034 56-57 25.538038038038035 23.673673673673672 22.67267267267267 28.115615615615614 58-59 26.038538538538536 23.473473473473476 22.15965965965966 28.32832832832833 60-61 26.213713713713716 23.773773773773772 23.21071071071071 26.8018018018018 62-63 25.725725725725724 22.84784784784785 23.71121121121121 27.715215215215217 64-65 25.863363363363362 23.91141141141141 23.035535535535537 27.18968968968969 66-67 25.625625625625624 23.16066066066066 23.485985985985984 27.72772772772773 68-69 25.43793793793794 24.54954954954955 23.323323323323322 26.68918918918919 70-71 26.95195195195195 22.44744744744745 23.123123123123122 27.47747747747748 72-73 26.664164164164166 23.04804804804805 23.16066066066066 27.127127127127125 74-75 25.563063063063062 22.45995995995996 24.474474474474476 27.5025025025025 76-77 26.101101101101097 22.45995995995996 23.3983983983984 28.040540540540544 78-79 26.026026026026027 23.21071071071071 23.81131131131131 26.95195195195195 80-81 25.93843843843844 23.46096096096096 23.073073073073072 27.52752752752753 82-83 26.001001001001 23.623623623623622 23.173173173173172 27.2022022022022 84-85 25.682102628285357 23.11639549436796 23.27909887359199 27.92240300375469 86-87 25.782227784730914 23.51689612015019 22.803504380475594 27.897371714643306 88-89 26.77096370463079 22.828535669586984 23.00375469336671 27.396745932415516 90-91 26.382978723404253 23.35419274092616 23.14142678347935 27.121401752190238 92-93 25.894868585732166 23.67959949937422 23.454317897371716 26.971214017521906 94-95 26.458072590738425 22.703379224030037 23.09136420525657 27.74718397997497 96-97 25.942628084679946 22.72328698484279 23.5249906050357 27.809094325441563 98-99 26.289707750952985 22.287166454891995 23.303684879288436 28.119440914866583 100-101 28.27298050139276 10.167130919220057 28.056329309811208 33.50355926957598 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 0.0 27 1.0 28 3.0 29 3.0 30 3.5 31 5.5 32 9.5 33 14.0 34 16.0 35 21.0 36 30.5 37 42.5 38 59.0 39 75.5 40 82.0 41 109.0 42 128.0 43 129.0 44 143.5 45 148.0 46 154.0 47 167.5 48 161.5 49 147.0 50 144.5 51 127.0 52 119.0 53 126.0 54 113.5 55 106.5 56 101.0 57 100.0 58 107.5 59 98.5 60 89.5 61 86.5 62 84.5 63 87.0 64 83.0 65 77.5 66 72.0 67 76.5 68 74.5 69 55.5 70 56.5 71 59.0 72 53.0 73 47.0 74 41.5 75 36.5 76 27.5 77 19.5 78 19.0 79 15.5 80 11.0 81 12.0 82 7.0 83 3.5 84 3.5 85 1.5 86 1.0 87 1.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.05 5 0.05 6 0.575 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 2.0 36-37 0.0 38-39 0.0 40-41 1.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 1.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 1.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 1.0 96-97 27.0 98-99 329.0 100-101 3638.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62321024868123 99.15 2 0.35167043456417985 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025119316754584273 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 6 0.15 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646303 spots for SRR21853434.sra Written 646303 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra Read 646295 spots for SRR21853434.sra Written 646295 spots for SRR21853434.sra SRR ids: ['SRR21853434.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yl3caa2o SRR21853434.sra spots: 12925908 blocks: [[1, 646295], [646296, 1292590], [1292591, 1938885], [1938886, 2585180], [2585181, 3231475], [3231476, 3877770], [3877771, 4524065], [4524066, 5170360], [5170361, 5816655], [5816656, 6462950], [6462951, 7109245], [7109246, 7755540], [7755541, 8401835], [8401836, 9048130], [9048131, 9694425], [9694426, 10340720], [10340721, 10987015], [10987016, 11633310], [11633311, 12279605], [12279606, 12925908]] SRR21853434 file size 3525774 SRR21853434 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853434 SRR21853434_1.fastq Input file: SRR21853434_1.fastq trimmed: SRR21853434-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:40:02 2024 >> started Fri Dec 6 14:40:09 2024 >> done (7.432s) 12925908 reads processed; of these: 43 ( 0.00%) short reads filtered out after trimming by size control 39679 ( 0.31%) empty reads filtered out after trimming by size control 12886186 (99.69%) reads available; of these: 199 ( 0.00%) trimmed reads available after processing 12885987 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 1 0.00% 23 7 0.00% 24 1 0.00% 25 3 0.00% 26 5 0.00% 27 3 0.00% 28 0 0.00% 29 1 0.00% 30 1 0.00% 31 2 0.00% 32 2 0.00% 33 1 0.00% 34 3 0.00% 35 107 0.00% 36 120 0.00% 37 94 0.00% 38 104 0.00% 39 93 0.00% 40 110 0.00% 41 125 0.00% 42 123 0.00% 43 105 0.00% 44 120 0.00% 45 123 0.00% 46 128 0.00% 47 142 0.00% 48 130 0.00% 49 136 0.00% 50 143 0.00% 51 148 0.00% 52 139 0.00% 53 143 0.00% 54 149 0.00% 55 170 0.00% 56 137 0.00% 57 145 0.00% 58 169 0.00% 59 158 0.00% 60 213 0.00% 61 168 0.00% 62 189 0.00% 63 167 0.00% 64 175 0.00% 65 173 0.00% 66 196 0.00% 67 185 0.00% 68 191 0.00% 69 188 0.00% 70 208 0.00% 71 204 0.00% 72 238 0.00% 73 211 0.00% 74 239 0.00% 75 248 0.00% 76 223 0.00% 77 259 0.00% 78 254 0.00% 79 287 0.00% 80 263 0.00% 81 280 0.00% 82 283 0.00% 83 323 0.00% 84 340 0.00% 85 340 0.00% 86 351 0.00% 87 343 0.00% 88 377 0.00% 89 404 0.00% 90 458 0.00% 91 812 0.01% 92 487 0.00% 93 581 0.00% 94 1083 0.01% 95 3458 0.03% 96 16211 0.13% 97 54331 0.42% 98 212704 1.65% 99 820653 6.37% 100 2717874 21.09% 101 9046720 70.20% 12886186 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=19 prefix-density=0.46 prefix-fanout=1.9 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=27 fanout-score=267.23 fanout-score-rank=1 prefix-density=1.10 prefix-fanout=25.0 sequence=GCCGCCGCCACC Started job on | Dec 06 14:40:26 Started mapping on | Dec 06 14:40:26 Finished on | Dec 06 14:40:48 Mapping speed, Million of reads per hour | 2108.65 Number of input reads | 12886186 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 11855621 Uniquely mapped reads % | 92.00% Average mapped length | 100.28 Number of splices: Total | 3654124 Number of splices: Annotated (sjdb) | 3457360 Number of splices: GT/AG | 3604401 Number of splices: GC/AG | 43837 Number of splices: AT/AC | 1948 Number of splices: Non-canonical | 3938 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.00% Deletion average length | 1.53 Insertion rate per base | 0.00% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 449893 % of reads mapped to multiple loci | 3.49% Number of reads mapped to too many loci | 382806 % of reads mapped to too many loci | 2.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.23% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 580672 580672 580672 N_multimapping 449893 449893 449893 N_noFeature 484660 6285933 5901988 N_ambiguous 179605 16116 12357 UnstrandedReadsAssigned:11191356 PositiveStrandReadsAssigned:5553572 NegativeStrandReadsAssigned:5941276 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853434 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853434-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,886,186 reads, 11,589,421 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52973 SRR21853434.ke.tsv 35125 SRR21853434.se.tsv 88098 total ==> SRR21853434.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 32.6053 4.93002 PNS24249 1928 1829 203.146 15.8704 PNS24246 1044 945 32.6053 4.93002 PNS24248 1044 945 32.6053 4.93002 PNS24244 1471 1372 18.0378 1.87854 PNS24243 293 194 18 13.2575 KQK14069 1603 1504 4936.74 469.013 KQK14071 474 375 439.129 167.322 ==> SRR21853434.se.tsv <== BRADI_1g14170v3 5864 BRADI_1g53295v3 72 BRADI_1g59795v3 189 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 1006 BRADI_1g74790v3 178 BRADI_1g09890v3 4 BRADI_1g77505v3 206 BRADI_1g48960v3 0 SRR21853434 completed mapping pipeline successfully