Starting /dee2/code/volunteer_pipeline.sh SRR21853435 current disk space = 1550449278976 free memory = 1599685352 SRR21853435 SRAfilesize 64143131b30be1ea8379c13617c7b450 SRR21853435.sra SRR21853435.sra file validated SRR21853435 is single end SRR21853435 is conventional basespace SRR21853435 read1 length is 42-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853435_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 42-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.4945 37.0 37.0 37.0 37.0 37.0 2 35.7625 37.0 37.0 37.0 37.0 37.0 3 35.9255 37.0 37.0 37.0 37.0 37.0 4 35.9645 37.0 37.0 37.0 37.0 37.0 5 36.055 37.0 37.0 37.0 37.0 37.0 6 36.1385 37.0 37.0 37.0 37.0 37.0 7 36.0205 37.0 37.0 37.0 37.0 37.0 8 36.111 37.0 37.0 37.0 37.0 37.0 9 36.076 37.0 37.0 37.0 37.0 37.0 10-11 36.086 37.0 37.0 37.0 37.0 37.0 12-13 36.07325 37.0 37.0 37.0 37.0 37.0 14-15 36.0265 37.0 37.0 37.0 37.0 37.0 16-17 36.11025 37.0 37.0 37.0 37.0 37.0 18-19 35.936 37.0 37.0 37.0 37.0 37.0 20-21 35.907 37.0 37.0 37.0 37.0 37.0 22-23 36.00925 37.0 37.0 37.0 37.0 37.0 24-25 36.00125 37.0 37.0 37.0 37.0 37.0 26-27 35.832 37.0 37.0 37.0 37.0 37.0 28-29 35.778999999999996 37.0 37.0 37.0 37.0 37.0 30-31 35.7795 37.0 37.0 37.0 37.0 37.0 32-33 35.8695 37.0 37.0 37.0 37.0 37.0 34-35 35.928749999999994 37.0 37.0 37.0 37.0 37.0 36-37 35.81125 37.0 37.0 37.0 37.0 37.0 38-39 35.817750000000004 37.0 37.0 37.0 37.0 37.0 40-41 35.81275 37.0 37.0 37.0 37.0 37.0 42-43 35.77584714928732 37.0 37.0 37.0 37.0 37.0 44-45 35.76669167291823 37.0 37.0 37.0 37.0 37.0 46-47 35.74143535883971 37.0 37.0 37.0 37.0 37.0 48-49 35.66116529132283 37.0 37.0 37.0 37.0 37.0 50-51 35.69167291822956 37.0 37.0 37.0 37.0 37.0 52-53 35.761190297574394 37.0 37.0 37.0 37.0 37.0 54-55 35.63415853963491 37.0 37.0 37.0 37.0 37.0 56-57 35.67741935483871 37.0 37.0 37.0 37.0 37.0 58-59 35.75418854713678 37.0 37.0 37.0 37.0 37.0 60-61 35.728932233058266 37.0 37.0 37.0 37.0 37.0 62-63 35.74043510877719 37.0 37.0 37.0 37.0 37.0 64-65 35.708427106776696 37.0 37.0 37.0 37.0 37.0 66-67 35.70967741935484 37.0 37.0 37.0 37.0 37.0 68-69 35.70892723180795 37.0 37.0 37.0 37.0 37.0 70-71 35.71667916979245 37.0 37.0 37.0 37.0 37.0 72-73 35.65716429107277 37.0 37.0 37.0 37.0 37.0 74-75 35.586896724181045 37.0 37.0 37.0 37.0 37.0 76-77 35.56989247311828 37.0 37.0 37.0 37.0 37.0 78-79 35.67916979244811 37.0 37.0 37.0 37.0 37.0 80-81 35.613903475868966 37.0 37.0 37.0 37.0 37.0 82-83 35.653163290822704 37.0 37.0 37.0 37.0 37.0 84-85 35.627906976744185 37.0 37.0 37.0 37.0 37.0 86-87 35.613903475868966 37.0 37.0 37.0 37.0 37.0 88-89 35.53320133435059 37.0 37.0 37.0 37.0 37.0 90-91 35.562281140570285 37.0 37.0 37.0 37.0 37.0 92-93 35.658829414707355 37.0 37.0 37.0 37.0 37.0 94-95 35.56978489244622 37.0 37.0 37.0 37.0 37.0 96-97 35.482835770502334 37.0 37.0 37.0 37.0 37.0 98-99 35.47752023866788 37.0 37.0 37.0 37.0 37.0 100-101 35.51055314094919 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 6.0 26 10.0 27 20.0 28 28.0 29 43.0 30 56.0 31 78.0 32 125.0 33 162.0 34 234.0 35 457.0 36 2111.0 37 667.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.675 12.575 15.475 43.275000000000006 2 26.775 17.8 30.525000000000002 24.9 3 26.775 23.200000000000003 21.625 28.4 4 25.7 28.999999999999996 17.775 27.525 5 27.450000000000003 30.375000000000004 20.474999999999998 21.7 6 22.2 32.725 20.5 24.575 7 20.7 15.65 37.475 26.174999999999997 8 22.85 20.575 24.775 31.8 9 22.575 20.65 28.575 28.199999999999996 10-11 26.05 26.937499999999996 19.325 27.6875 12-13 24.5375 21.7375 25.75 27.975 14-15 24.2875 23.7875 24.2625 27.6625 16-17 25.35 23.05 23.2625 28.3375 18-19 25.162499999999998 24.0375 23.799999999999997 27.0 20-21 24.6875 23.825 23.5875 27.900000000000002 22-23 25.3 24.087500000000002 23.5375 27.075 24-25 24.7375 24.1125 23.625 27.525 26-27 25.587500000000002 23.849999999999998 22.875 27.6875 28-29 25.8125 23.9125 23.5 26.775 30-31 24.5 24.224999999999998 23.25 28.025 32-33 25.4875 24.025 23.4625 27.025 34-35 26.75 24.175 22.112499999999997 26.9625 36-37 24.725 23.625 24.0375 27.6125 38-39 26.650000000000002 23.95 22.0875 27.3125 40-41 25.575 24.15 23.3 26.974999999999998 42-43 25.95324415551944 23.67795974496812 22.452806600825102 27.91598949868734 44-45 25.543885971492873 24.01850462615654 22.66816704176044 27.769442360590148 46-47 26.19404851212803 23.80595148787197 22.73068267066767 27.26931732933233 48-49 25.03125781445361 24.218554638659665 23.13078269567392 27.619404851212803 50-51 25.78144536134033 23.005751437859466 23.88097024256064 27.33183295823956 52-53 25.468867216804203 22.680670167541887 23.305826456614152 28.54463615903976 54-55 25.593898474618655 23.493373343335833 23.268317079269817 27.644411102775695 56-57 25.593898474618655 23.893473368342086 22.61815453863466 27.894473618404604 58-59 25.1937984496124 23.10577644411103 22.95573893473368 28.744686171542888 60-61 25.893973493373345 23.3183295823956 23.78094523630908 27.00675168792198 62-63 25.906476619154787 23.280820205051263 23.755938984746187 27.056764191047762 64-65 26.156539134783696 23.330832708177045 23.543385846461614 26.969242310577645 66-67 26.006501625406354 23.068267066766694 22.968242060515127 27.956989247311824 68-69 27.106776694173547 23.23080770192548 22.43060765191298 27.231807951987996 70-71 25.806451612903224 23.168292073018254 23.69342335583896 27.33183295823956 72-73 24.8062015503876 23.36834208552138 23.355838959739934 28.469617404351087 74-75 25.656414103525883 24.74368592148037 22.943235808952238 26.65666416604151 76-77 26.669167291822955 23.20580145036259 23.48087021755439 26.644161040260066 78-79 24.90622655663916 23.618404601150285 22.80570142535634 28.66966741685421 80-81 26.506626656664167 23.593398349587396 22.73068267066767 27.169292323080768 82-83 25.6064016004001 23.868467116779193 22.80570142535634 27.719429857464366 84-85 26.331582895723933 23.118279569892472 23.168292073018254 27.38184546136534 86-87 25.668917229307326 23.793448362090523 23.443360840210055 27.094273568392097 88-89 26.43491309240965 23.908965862198325 23.03363761410529 26.62248343128673 90-91 25.83791895947974 22.473736868434216 23.54927463731866 28.139069534767387 92-93 26.125562781390695 23.374187093546773 22.923961980990494 27.576288144072038 94-95 26.988494247123562 23.19909954977489 22.698849424712357 27.113556778389196 96-97 26.354648980102613 22.525341008634715 24.427480916030532 26.692529095232135 98-99 25.986342943854325 22.812341932220537 24.17804754678806 27.023267577137077 100-101 28.044971892567144 10.32167395377889 28.96627108057464 32.667083073079326 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 1.0 27 2.0 28 2.5 29 3.0 30 4.5 31 5.5 32 8.5 33 18.5 34 26.5 35 31.0 36 42.0 37 46.0 38 52.5 39 75.5 40 92.0 41 100.5 42 118.0 43 137.5 44 154.0 45 163.0 46 160.0 47 162.0 48 158.0 49 141.0 50 138.0 51 137.5 52 121.0 53 101.5 54 92.5 55 98.0 56 98.0 57 87.5 58 77.0 59 82.5 60 89.5 61 81.0 62 85.0 63 85.5 64 88.5 65 95.5 66 84.5 67 83.5 68 78.0 69 69.5 70 67.5 71 58.0 72 52.5 73 53.5 74 45.0 75 34.0 76 31.5 77 25.5 78 21.0 79 15.0 80 6.5 81 2.5 82 3.0 83 3.5 84 2.0 85 1.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 42-43 1.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 1.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 18.0 98-99 333.0 100-101 3647.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.7 #Duplication Level Percentage of deduplicated Percentage of total 1 92.61057173678533 85.85000000000001 2 7.011866235167206 13.0 3 0.35059331175836034 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.026968716289104636 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 13 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277591 spots for SRR21853435.sra Written 277591 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra Read 277590 spots for SRR21853435.sra Written 277590 spots for SRR21853435.sra SRR ids: ['SRR21853435.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t7fahhtf SRR21853435.sra spots: 5551801 blocks: [[1, 277590], [277591, 555180], [555181, 832770], [832771, 1110360], [1110361, 1387950], [1387951, 1665540], [1665541, 1943130], [1943131, 2220720], [2220721, 2498310], [2498311, 2775900], [2775901, 3053490], [3053491, 3331080], [3331081, 3608670], [3608671, 3886260], [3886261, 4163850], [4163851, 4441440], [4441441, 4719030], [4719031, 4996620], [4996621, 5274210], [5274211, 5551801]] SRR21853435 file size 1492427 SRR21853435 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853435 SRR21853435_1.fastq Input file: SRR21853435_1.fastq trimmed: SRR21853435-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:40:22 2024 >> started Fri Dec 6 14:40:25 2024 >> done (2.798s) 5551801 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 18185 ( 0.33%) empty reads filtered out after trimming by size control 5533608 (99.67%) reads available; of these: 206 ( 0.00%) trimmed reads available after processing 5533402 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 2 0.00% 26 1 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 4 0.00% 33 7 0.00% 34 1 0.00% 35 22 0.00% 36 27 0.00% 37 23 0.00% 38 27 0.00% 39 19 0.00% 40 25 0.00% 41 24 0.00% 42 19 0.00% 43 28 0.00% 44 17 0.00% 45 29 0.00% 46 31 0.00% 47 36 0.00% 48 23 0.00% 49 28 0.00% 50 27 0.00% 51 30 0.00% 52 29 0.00% 53 19 0.00% 54 31 0.00% 55 23 0.00% 56 26 0.00% 57 35 0.00% 58 39 0.00% 59 29 0.00% 60 43 0.00% 61 26 0.00% 62 38 0.00% 63 37 0.00% 64 30 0.00% 65 47 0.00% 66 43 0.00% 67 30 0.00% 68 37 0.00% 69 36 0.00% 70 33 0.00% 71 40 0.00% 72 51 0.00% 73 34 0.00% 74 46 0.00% 75 46 0.00% 76 57 0.00% 77 35 0.00% 78 49 0.00% 79 44 0.00% 80 53 0.00% 81 61 0.00% 82 47 0.00% 83 52 0.00% 84 42 0.00% 85 51 0.00% 86 60 0.00% 87 68 0.00% 88 80 0.00% 89 77 0.00% 90 114 0.00% 91 220 0.00% 92 107 0.00% 93 121 0.00% 94 403 0.01% 95 1364 0.02% 96 7470 0.13% 97 24383 0.44% 98 95551 1.73% 99 365718 6.61% 100 1204354 21.76% 101 3831724 69.24% 5533608 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=21 prefix-density=0.34 prefix-fanout=1.9 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=292.50 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=25.8 sequence=GCCGCCGCCACC Started job on | Dec 06 14:40:48 Started mapping on | Dec 06 14:40:48 Finished on | Dec 06 14:40:55 Mapping speed, Million of reads per hour | 2845.86 Number of input reads | 5533608 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 5172911 Uniquely mapped reads % | 93.48% Average mapped length | 100.30 Number of splices: Total | 1654179 Number of splices: Annotated (sjdb) | 1566430 Number of splices: GT/AG | 1631148 Number of splices: GC/AG | 20048 Number of splices: AT/AC | 939 Number of splices: Non-canonical | 2044 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.91 Insertion rate per base | 0.00% Insertion average length | 1.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 161364 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 136112 % of reads mapped to too many loci | 2.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.80% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 199333 199333 199333 N_multimapping 161364 161364 161364 N_noFeature 209242 2682738 2631044 N_ambiguous 79365 6401 5219 UnstrandedReadsAssigned:4884304 PositiveStrandReadsAssigned:2483772 NegativeStrandReadsAssigned:2536648 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853435 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853435-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,533,608 reads, 5,033,046 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52973 SRR21853435.ke.tsv 35125 SRR21853435.se.tsv 88098 total ==> SRR21853435.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 21.2252 8.40454 PNS24247 1044 945 5.83333 2.04584 PNS24249 1928 1829 46.2905 8.38813 PNS24246 1044 945 5.83333 2.04584 PNS24248 1044 945 5.83333 2.04584 PNS24244 1471 1372 9.98425 2.41184 PNS24243 293 194 9 15.3755 KQK14069 1603 1504 3078.2 678.321 KQK14071 474 375 313.625 277.183 ==> SRR21853435.se.tsv <== BRADI_1g14170v3 3680 BRADI_1g53295v3 20 BRADI_1g59795v3 88 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 470 BRADI_1g74790v3 51 BRADI_1g09890v3 4 BRADI_1g77505v3 68 BRADI_1g48960v3 0 SRR21853435 completed mapping pipeline successfully