Starting /dee2/code/volunteer_pipeline.sh SRR21853436 current disk space = 1550412804096 free memory = 1323206944 SRR21853436 SRAfilesize 8e06b5e7773c17645b5ada09ddb1024c SRR21853436.sra SRR21853436.sra file validated SRR21853436 is single end SRR21853436 is conventional basespace SRR21853436 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853436_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.156 37.0 37.0 37.0 25.0 37.0 2 34.73075 37.0 37.0 37.0 25.0 37.0 3 35.568 37.0 37.0 37.0 37.0 37.0 4 35.7705 37.0 37.0 37.0 37.0 37.0 5 35.8445 37.0 37.0 37.0 37.0 37.0 6 35.8725 37.0 37.0 37.0 37.0 37.0 7 35.721 37.0 37.0 37.0 37.0 37.0 8 35.8275 37.0 37.0 37.0 37.0 37.0 9 35.8375 37.0 37.0 37.0 37.0 37.0 10-11 35.96725 37.0 37.0 37.0 37.0 37.0 12-13 35.9415 37.0 37.0 37.0 37.0 37.0 14-15 35.843999999999994 37.0 37.0 37.0 37.0 37.0 16-17 35.8655 37.0 37.0 37.0 37.0 37.0 18-19 35.918000000000006 37.0 37.0 37.0 37.0 37.0 20-21 35.849000000000004 37.0 37.0 37.0 37.0 37.0 22-23 35.79325 37.0 37.0 37.0 37.0 37.0 24-25 35.724000000000004 37.0 37.0 37.0 37.0 37.0 26-27 35.70425 37.0 37.0 37.0 37.0 37.0 28-29 35.752 37.0 37.0 37.0 37.0 37.0 30-31 35.617000000000004 37.0 37.0 37.0 37.0 37.0 32-33 35.73025 37.0 37.0 37.0 37.0 37.0 34-35 35.6755 37.0 37.0 37.0 37.0 37.0 36-37 35.63763763763764 37.0 37.0 37.0 37.0 37.0 38-39 35.722972972972975 37.0 37.0 37.0 37.0 37.0 40-41 35.62462462462462 37.0 37.0 37.0 37.0 37.0 42-43 35.67842842842843 37.0 37.0 37.0 37.0 37.0 44-45 35.565565565565564 37.0 37.0 37.0 37.0 37.0 46-47 35.63463463463464 37.0 37.0 37.0 37.0 37.0 48-49 35.520270270270274 37.0 37.0 37.0 37.0 37.0 50-51 35.57482482482482 37.0 37.0 37.0 37.0 37.0 52-53 35.57496871088861 37.0 37.0 37.0 37.0 37.0 54-55 35.55168961201502 37.0 37.0 37.0 37.0 37.0 56-57 35.443105020484424 37.0 37.0 37.0 37.0 37.0 58-59 35.56065829272333 37.0 37.0 37.0 37.0 37.0 60-61 35.551465063861755 37.0 37.0 37.0 37.0 37.0 62-63 35.483095416979715 37.0 37.0 37.0 37.0 37.0 64-65 35.37064863511145 37.0 37.0 37.0 37.0 37.0 66-67 35.44002003506136 37.0 37.0 37.0 37.0 37.0 68-69 35.461056849486596 37.0 37.0 37.0 37.0 37.0 70-71 35.44753318307038 37.0 37.0 37.0 37.0 37.0 72-73 35.40145254194841 37.0 37.0 37.0 37.0 37.0 74-75 35.34134735787629 37.0 37.0 37.0 37.0 37.0 76-77 35.278487352867515 37.0 37.0 37.0 37.0 37.0 78-79 35.37190082644628 37.0 37.0 37.0 37.0 37.0 80-81 35.456048084147255 37.0 37.0 37.0 37.0 37.0 82-83 35.42649636864513 37.0 37.0 37.0 37.0 37.0 84-85 35.40621086902078 37.0 37.0 37.0 31.0 37.0 86-87 35.44558745590354 37.0 37.0 37.0 37.0 37.0 88-89 35.46167334669339 37.0 37.0 37.0 37.0 37.0 90-91 35.42810621242485 37.0 37.0 37.0 37.0 37.0 92-93 35.32690380761523 37.0 37.0 37.0 31.0 37.0 94-95 35.30511022044088 37.0 37.0 37.0 37.0 37.0 96-97 35.3094341188628 37.0 37.0 37.0 37.0 37.0 98-99 35.3192414009971 37.0 37.0 37.0 31.0 37.0 100-101 35.252630134587406 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 3.0 25 13.0 26 12.0 27 20.0 28 38.0 29 66.0 30 73.0 31 85.0 32 132.0 33 185.0 34 227.0 35 497.0 36 2108.0 37 534.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.554554554554553 13.163163163163164 15.415415415415415 41.866866866866864 2 27.89753994420492 18.361653563276693 29.013441541973116 24.72736495054527 3 27.2022022022022 23.54854854854855 23.073073073073072 26.176176176176174 4 27.72772772772773 29.57957957957958 16.54154154154154 26.151151151151154 5 28.553553553553552 29.179179179179176 20.07007007007007 22.197197197197198 6 23.14814814814815 32.507507507507505 19.31931931931932 25.025025025025027 7 21.27127127127127 16.79179179179179 36.211211211211214 25.725725725725724 8 23.373373373373376 21.646646646646648 23.423423423423422 31.556556556556558 9 22.64764764764765 21.746746746746748 26.351351351351347 29.254254254254253 10-11 26.8018018018018 26.176176176176174 20.02002002002002 27.002002002002 12-13 24.8998998998999 21.72172172172172 24.386886886886888 28.991491491491487 14-15 24.11161161161161 23.86136136136136 25.125125125125123 26.901901901901905 16-17 24.86236236236236 23.423423423423422 23.8988988988989 27.815315315315313 18-19 26.176176176176174 22.96046046046046 24.04904904904905 26.814314314314313 20-21 25.525525525525527 22.96046046046046 23.94894894894895 27.565065065065063 22-23 25.863363363363362 23.8988988988989 23.573573573573572 26.664164164164166 24-25 26.126126126126124 24.124124124124123 23.023023023023022 26.726726726726728 26-27 25.325325325325327 22.71021021021021 23.923923923923923 28.040540540540544 28-29 25.275275275275277 24.01151151151151 23.385885885885884 27.32732732732733 30-31 25.412912912912912 24.762262262262265 23.736236236236234 26.08858858858859 32-33 24.66216216216216 25.775775775775777 22.30980980980981 27.25225225225225 34-35 26.726726726726728 24.36186186186186 22.74774774774775 26.163663663663662 36-37 25.2002002002002 24.46196196196196 23.46096096096096 26.876876876876878 38-39 26.33883883883884 23.6986986986987 23.24824824824825 26.714214214214216 40-41 26.739239239239236 24.01151151151151 22.722722722722725 26.526526526526528 42-43 25.43793793793794 24.386886886886888 23.44844844844845 26.726726726726728 44-45 25.625625625625624 23.24824824824825 24.3993993993994 26.726726726726728 46-47 26.626626626626624 23.54854854854855 22.597597597597595 27.227227227227228 48-49 25.225225225225223 23.986486486486484 23.886386386386384 26.901901901901905 50-51 25.0 24.762262262262265 22.40990990990991 27.82782782782783 52-53 25.882352941176475 24.25531914893617 21.877346683354194 27.98498122653317 54-55 24.918648310387987 23.128911138923655 24.730913642052567 27.221526908635795 56-57 25.585179621980224 24.383527350106394 22.768807109775942 27.26248591813744 58-59 25.804432202328787 23.01239514210592 23.049956178790534 28.13321647677476 60-61 26.496368645128975 23.466065614825947 23.31580265464563 26.72176308539945 62-63 25.444527923866765 23.153017781116954 23.115452041071876 28.287002253944404 64-65 26.383671424993736 23.328324567993988 23.829201101928373 26.458802905083896 66-67 25.720010017530683 24.179814675682447 23.27823691460055 26.82193839218633 68-69 25.65740045078888 23.59128474830954 23.165539694465316 27.585775106436262 70-71 27.1099423991986 23.6664162283997 22.501878287002253 26.72176308539945 72-73 24.593037816178313 23.415977961432507 24.66816929626847 27.32281492612071 74-75 27.18507387928876 23.153017781116954 23.61632857500626 26.045579764588027 76-77 26.170798898071624 23.541197094916104 22.789882294014525 27.498121712997747 78-79 25.832707237665915 23.178061607813675 23.215627347858753 27.773603806661658 80-81 25.99549211119459 23.94189832206361 22.852491860756324 27.210117705985475 82-83 26.62158777861257 23.153017781116954 22.71475081392437 27.510643626346106 84-85 25.156523916854496 24.75582268970699 23.115452041071876 26.972201352366643 86-87 25.96117720726362 23.694427050720098 22.8052598622417 27.53913587977458 88-89 26.265030060120242 23.772545090180362 23.196392785571142 26.766032064128257 90-91 25.425851703406817 23.296593186372746 23.208917835671343 28.068637274549097 92-93 26.753507014028056 23.810120240480963 22.77054108216433 26.665831663326657 94-95 27.843186372745492 23.171342685370742 22.081663326653306 26.903807615230463 96-97 26.893179538615847 22.843530591775327 23.37011033099298 26.893179538615847 98-99 26.375301740566638 22.817939270740695 22.983102528268326 27.823656460424345 100-101 29.326162606770012 10.091743119266056 27.12749130022145 33.45460297374249 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.5 27 2.0 28 2.0 29 2.5 30 5.0 31 10.5 32 10.5 33 14.5 34 23.5 35 29.0 36 30.0 37 42.0 38 69.0 39 82.0 40 88.5 41 109.5 42 129.0 43 125.5 44 138.0 45 155.0 46 165.0 47 165.5 48 146.0 49 147.0 50 134.0 51 118.5 52 128.0 53 128.0 54 105.0 55 94.5 56 102.5 57 102.0 58 89.5 59 72.5 60 64.5 61 72.5 62 94.0 63 93.5 64 78.0 65 80.0 66 94.0 67 89.0 68 75.0 69 71.0 70 73.0 71 71.0 72 55.5 73 43.0 74 38.0 75 34.5 76 26.5 77 18.5 78 18.5 79 16.5 80 8.5 81 7.0 82 5.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 1.425 3 0.1 4 0.1 5 0.1 6 0.1 7 0.1 8 0.1 9 0.1 10-11 0.1 12-13 0.1 14-15 0.1 16-17 0.1 18-19 0.1 20-21 0.1 22-23 0.1 24-25 0.1 26-27 0.1 28-29 0.1 30-31 0.1 32-33 0.1 34-35 0.1 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 4.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 1.0 52-53 0.0 54-55 0.0 56-57 1.0 58-59 1.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 1.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 1.0 96-97 21.0 98-99 357.0 100-101 3613.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.575 #Duplication Level Percentage of deduplicated Percentage of total 1 92.73561976775588 85.85000000000001 2 6.7512827437213065 12.5 3 0.4050769646232784 1.125 4 0.054010261949770454 0.2 5 0.027005130974885227 0.125 6 0.0 0.0 7 0.0 0.0 8 0.027005130974885227 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 8 0.2 TruSeq Adapter, Index 13 (97% over 38bp) GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808530 spots for SRR21853436.sra Written 808530 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra Read 808527 spots for SRR21853436.sra Written 808527 spots for SRR21853436.sra SRR ids: ['SRR21853436.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d4j879_a SRR21853436.sra spots: 16170543 blocks: [[1, 808527], [808528, 1617054], [1617055, 2425581], [2425582, 3234108], [3234109, 4042635], [4042636, 4851162], [4851163, 5659689], [5659690, 6468216], [6468217, 7276743], [7276744, 8085270], [8085271, 8893797], [8893798, 9702324], [9702325, 10510851], [10510852, 11319378], [11319379, 12127905], [12127906, 12936432], [12936433, 13744959], [13744960, 14553486], [14553487, 15362013], [15362014, 16170543]] SRR21853436 file size 4354547 SRR21853436 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853436 SRR21853436_1.fastq Input file: SRR21853436_1.fastq trimmed: SRR21853436-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:42:47 2024 >> started Fri Dec 6 14:42:55 2024 >> done (8.847s) 16170543 reads processed; of these: 29 ( 0.00%) short reads filtered out after trimming by size control 70503 ( 0.44%) empty reads filtered out after trimming by size control 16100011 (99.56%) reads available; of these: 517 ( 0.00%) trimmed reads available after processing 16099494 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 3 0.00% 21 6 0.00% 22 3 0.00% 23 2 0.00% 24 4 0.00% 25 3 0.00% 26 2 0.00% 27 4 0.00% 28 5 0.00% 29 5 0.00% 30 10 0.00% 31 9 0.00% 32 4 0.00% 33 8 0.00% 34 13 0.00% 35 134 0.00% 36 131 0.00% 37 118 0.00% 38 125 0.00% 39 146 0.00% 40 125 0.00% 41 139 0.00% 42 134 0.00% 43 157 0.00% 44 143 0.00% 45 136 0.00% 46 149 0.00% 47 146 0.00% 48 155 0.00% 49 159 0.00% 50 171 0.00% 51 145 0.00% 52 175 0.00% 53 187 0.00% 54 157 0.00% 55 187 0.00% 56 171 0.00% 57 186 0.00% 58 163 0.00% 59 156 0.00% 60 175 0.00% 61 194 0.00% 62 211 0.00% 63 192 0.00% 64 186 0.00% 65 223 0.00% 66 227 0.00% 67 193 0.00% 68 187 0.00% 69 188 0.00% 70 204 0.00% 71 235 0.00% 72 212 0.00% 73 246 0.00% 74 223 0.00% 75 217 0.00% 76 229 0.00% 77 266 0.00% 78 266 0.00% 79 240 0.00% 80 296 0.00% 81 269 0.00% 82 269 0.00% 83 294 0.00% 84 294 0.00% 85 307 0.00% 86 313 0.00% 87 350 0.00% 88 315 0.00% 89 419 0.00% 90 411 0.00% 91 830 0.01% 92 435 0.00% 93 551 0.00% 94 1261 0.01% 95 4277 0.03% 96 22041 0.14% 97 70968 0.44% 98 281215 1.75% 99 1063155 6.60% 100 3518515 21.85% 101 11125035 69.10% 16100011 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=25 prefix-density=0.27 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=278.38 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=24.6 sequence=CGCCGCCGCCGA Started job on | Dec 06 14:43:18 Started mapping on | Dec 06 14:43:18 Finished on | Dec 06 14:43:37 Mapping speed, Million of reads per hour | 3050.53 Number of input reads | 16100011 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 15050300 Uniquely mapped reads % | 93.48% Average mapped length | 100.27 Number of splices: Total | 4852791 Number of splices: Annotated (sjdb) | 4593128 Number of splices: GT/AG | 4784117 Number of splices: GC/AG | 58875 Number of splices: AT/AC | 2717 Number of splices: Non-canonical | 7082 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.00% Deletion average length | 1.95 Insertion rate per base | 0.00% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 470499 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 376104 % of reads mapped to too many loci | 2.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 579212 579212 579212 N_multimapping 470499 470499 470499 N_noFeature 609280 7795343 7665590 N_ambiguous 230580 18246 15376 UnstrandedReadsAssigned:14210440 PositiveStrandReadsAssigned:7236711 NegativeStrandReadsAssigned:7369334 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853436 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853436-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,100,011 reads, 14,637,965 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52973 SRR21853436.ke.tsv 35125 SRR21853436.se.tsv 88098 total ==> SRR21853436.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 15.125 2.05809 PNS24247 1044 945 43.8418 5.28388 PNS24249 1928 1829 192.319 11.9758 PNS24246 1044 945 43.8418 5.28388 PNS24248 1044 945 43.8418 5.28388 PNS24244 1471 1372 35.0303 2.90794 PNS24243 293 194 17 9.98029 KQK14069 1603 1504 8889.78 673.192 KQK14071 474 375 1169.84 355.297 ==> SRR21853436.se.tsv <== BRADI_1g14170v3 10749 BRADI_1g53295v3 85 BRADI_1g59795v3 230 BRADI_1g07683v3 0 BRADI_1g00485v3 58 BRADI_1g20270v3 1433 BRADI_1g74790v3 210 BRADI_1g09890v3 7 BRADI_1g77505v3 214 BRADI_1g48960v3 0 SRR21853436 completed mapping pipeline successfully