Starting /dee2/code/volunteer_pipeline.sh SRR21853437 current disk space = 1550493224960 free memory = 1600316692 SRR21853437 SRAfilesize 6d91ca4b62d1d50fc3bf56ba16f326dc SRR21853437.sra SRR21853437.sra file validated SRR21853437 is single end SRR21853437 is conventional basespace SRR21853437 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853437_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.40075 37.0 37.0 37.0 37.0 37.0 2 35.69175 37.0 37.0 37.0 37.0 37.0 3 36.00675 37.0 37.0 37.0 37.0 37.0 4 35.95725 37.0 37.0 37.0 37.0 37.0 5 36.01425 37.0 37.0 37.0 37.0 37.0 6 35.93475 37.0 37.0 37.0 37.0 37.0 7 35.95225 37.0 37.0 37.0 37.0 37.0 8 36.14075 37.0 37.0 37.0 37.0 37.0 9 35.94775 37.0 37.0 37.0 37.0 37.0 10-11 36.176500000000004 37.0 37.0 37.0 37.0 37.0 12-13 36.099999999999994 37.0 37.0 37.0 37.0 37.0 14-15 36.0165 37.0 37.0 37.0 37.0 37.0 16-17 36.00875 37.0 37.0 37.0 37.0 37.0 18-19 35.98625 37.0 37.0 37.0 37.0 37.0 20-21 35.9245 37.0 37.0 37.0 37.0 37.0 22-23 35.969750000000005 37.0 37.0 37.0 37.0 37.0 24-25 35.9095 37.0 37.0 37.0 37.0 37.0 26-27 35.91675 37.0 37.0 37.0 37.0 37.0 28-29 35.86 37.0 37.0 37.0 37.0 37.0 30-31 35.85575 37.0 37.0 37.0 37.0 37.0 32-33 35.894 37.0 37.0 37.0 37.0 37.0 34-35 35.844750000000005 37.0 37.0 37.0 37.0 37.0 36-37 35.774193548387096 37.0 37.0 37.0 37.0 37.0 38-39 35.90497624406102 37.0 37.0 37.0 37.0 37.0 40-41 35.84571142785696 37.0 37.0 37.0 37.0 37.0 42-43 35.80145036259065 37.0 37.0 37.0 37.0 37.0 44-45 35.674418604651166 37.0 37.0 37.0 37.0 37.0 46-47 35.7136784196049 37.0 37.0 37.0 37.0 37.0 48-49 35.69617404351088 37.0 37.0 37.0 37.0 37.0 50-51 35.78894723680921 37.0 37.0 37.0 37.0 37.0 52-53 35.76869217304326 37.0 37.0 37.0 37.0 37.0 54-55 35.76869217304326 37.0 37.0 37.0 37.0 37.0 56-57 35.68592148037009 37.0 37.0 37.0 37.0 37.0 58-59 35.6859214803701 37.0 37.0 37.0 37.0 37.0 60-61 35.72743185796449 37.0 37.0 37.0 37.0 37.0 62-63 35.734183545886474 37.0 37.0 37.0 37.0 37.0 64-65 35.73968492123031 37.0 37.0 37.0 37.0 37.0 66-67 35.6816704176044 37.0 37.0 37.0 37.0 37.0 68-69 35.566391597899475 37.0 37.0 37.0 37.0 37.0 70-71 35.678669667416855 37.0 37.0 37.0 37.0 37.0 72-73 35.67966991747937 37.0 37.0 37.0 37.0 37.0 74-75 35.67541885471368 37.0 37.0 37.0 37.0 37.0 76-77 35.68367091772943 37.0 37.0 37.0 37.0 37.0 78-79 35.56089022255564 37.0 37.0 37.0 37.0 37.0 80-81 35.69192298074519 37.0 37.0 37.0 37.0 37.0 82-83 35.627906976744185 37.0 37.0 37.0 37.0 37.0 84-85 35.58814703675919 37.0 37.0 37.0 37.0 37.0 86-87 35.545886471617905 37.0 37.0 37.0 37.0 37.0 88-89 35.43435858964742 37.0 37.0 37.0 37.0 37.0 90-91 35.495623905976494 37.0 37.0 37.0 37.0 37.0 92-93 35.6042857974939 37.0 37.0 37.0 37.0 37.0 94-95 35.58168626469852 37.0 37.0 37.0 37.0 37.0 96-97 35.57568681184317 37.0 37.0 37.0 37.0 37.0 98-99 35.53526698919383 37.0 37.0 37.0 37.0 37.0 100-101 35.3513492076828 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 2.0 24 4.0 25 7.0 26 11.0 27 17.0 28 29.0 29 36.0 30 64.0 31 92.0 32 89.0 33 167.0 34 233.0 35 438.0 36 2186.0 37 622.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.657414353588397 12.528132033008252 17.30432608152038 40.51012753188297 2 27.306826706676667 18.879719929982496 30.00750187546887 23.80595148787197 3 26.506626656664167 22.780695173793447 22.95573893473368 27.7569392348087 4 28.032008002000502 28.40710177544386 17.479369842460617 26.081520380095025 5 28.182045511377847 29.532383095773945 19.629907476869217 22.655663915978995 6 21.85546386596649 32.63315828957239 19.80495123780945 25.70642660665166 7 20.955238809702426 15.778944736184048 38.05951487871968 25.206301575393848 8 22.83070767691923 20.68017004251063 25.731432858214554 30.75768942235559 9 21.355338834708675 19.72993248312078 27.631907976994246 31.282820705176295 10-11 26.019004751187797 27.19429857464366 19.70492623155789 27.081770442610654 12-13 23.843460865216304 21.80545136284071 25.056264066016503 29.294823705926483 14-15 24.381095273818453 23.53088272068017 24.268567141785446 27.819454863715933 16-17 25.918979744936234 24.118529632408105 23.443360840210055 26.51912978244561 18-19 25.431357839459867 23.1807951987997 23.78094523630908 27.60690172543136 20-21 25.29382345586397 23.605901475368842 24.243560890222557 26.85671417854464 22-23 25.84396099024756 24.143535883970994 23.755938984746187 26.25656414103526 24-25 24.893723430857715 23.730932733183295 23.80595148787197 27.569392348087025 26-27 26.019004751187797 23.99349837459365 23.568392098024507 26.419104776194047 28-29 25.71892973243311 23.243310827706924 23.50587646911728 27.53188297074269 30-31 25.143785946486624 24.268567141785446 23.793448362090523 26.79419854963741 32-33 24.731182795698924 23.868467116779193 23.69342335583896 27.70692673168292 34-35 26.081520380095025 24.143535883970994 23.018254563640912 26.756689172293076 36-37 26.04401100275069 23.568392098024507 23.3183295823956 27.069267316829208 38-39 25.1937984496124 23.705926481620406 23.3183295823956 27.781945486371594 40-41 25.468867216804203 24.593648412103025 22.943235808952238 26.994248562140534 42-43 25.143785946486624 23.13078269567392 25.168792198049513 26.556639159789945 44-45 24.918729682420604 23.380845211302827 23.680920230057513 28.019504876219052 46-47 25.893973493373345 24.493623405851466 23.10577644411103 26.506626656664167 48-49 24.99374843710928 23.868467116779193 23.455863965991497 27.68192048012003 50-51 25.64391097774444 23.85596399099775 23.293323330832706 27.206801700425103 52-53 25.36884221055264 24.18104526131533 22.930732683170792 27.51937984496124 54-55 25.756439109777446 23.068267066766694 23.843460865216304 27.33183295823956 56-57 25.30632658164541 24.256064016004 23.618404601150285 26.819204801200303 58-59 26.44411102775694 22.53063265816454 23.93098274568642 27.094273568392097 60-61 26.51912978244561 22.868217054263564 23.85596399099775 26.756689172293076 62-63 25.78144536134033 22.930732683170792 24.10602650662666 27.181795448862218 64-65 25.256314078519633 23.88097024256064 23.718429607401852 27.144286071517882 66-67 25.393848462115532 23.005751437859466 24.143535883970994 27.45686421605401 68-69 24.431107776944234 24.318579644911228 24.143535883970994 27.106776694173547 70-71 26.59414853713428 23.980995248812203 23.13078269567392 26.294073518379594 72-73 25.11877969492373 23.48087021755439 23.768442110527634 27.631907976994246 74-75 26.006501625406354 23.43085771442861 24.293573393348336 26.269067266816705 76-77 26.25656414103526 23.218304576144035 23.943485871467868 26.581645411352838 78-79 26.731682920730183 23.34333583395849 23.218304576144035 26.70667666916729 80-81 25.743935983995996 23.330832708177045 22.88072018004501 28.044511127781945 82-83 25.943985996499126 23.080770192548137 23.55588897224306 27.419354838709676 84-85 25.30632658164541 23.618404601150285 23.793448362090523 27.28182045511378 86-87 26.11902975743936 23.20580145036259 23.50587646911728 27.169292323080768 88-89 25.468867216804203 24.44361090272568 24.243560890222557 25.84396099024756 90-91 25.70642660665166 22.943235808952238 24.031007751937985 27.319329832458116 92-93 25.962981490745374 23.499249624812407 23.936968484242122 26.600800400200097 94-95 26.782586940205157 23.705278959219413 22.304228171128347 27.207905929447087 96-97 26.129961186928757 23.500688619005885 22.92475272317516 27.444597470890198 98-99 24.971450323562998 22.52252252252252 24.59078797106966 27.915239182844815 100-101 27.971808927173065 9.475332811276429 29.193422083007047 33.35943617854346 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 1.0 27 0.5 28 2.5 29 5.0 30 7.5 31 8.0 32 7.5 33 14.0 34 21.5 35 29.5 36 42.5 37 53.5 38 67.0 39 86.5 40 98.0 41 116.5 42 127.5 43 141.0 44 151.5 45 145.5 46 170.0 47 173.5 48 152.5 49 144.0 50 130.0 51 128.0 52 123.0 53 109.5 54 94.0 55 85.0 56 95.5 57 92.0 58 88.5 59 84.5 60 77.5 61 73.5 62 77.5 63 91.0 64 87.0 65 79.5 66 75.5 67 75.5 68 73.5 69 73.5 70 73.0 71 64.5 72 59.0 73 48.0 74 38.0 75 38.5 76 31.0 77 19.5 78 13.0 79 10.5 80 9.5 81 8.0 82 5.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 2.0 94-95 1.0 96-97 18.0 98-99 345.0 100-101 3633.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.5 #Duplication Level Percentage of deduplicated Percentage of total 1 92.5945945945946 85.65 2 6.918918918918919 12.8 3 0.43243243243243246 1.2 4 0.02702702702702703 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02702702702702703 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 10 0.25 TruSeq Adapter, Index 13 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254319 spots for SRR21853437.sra Written 254319 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra Read 254318 spots for SRR21853437.sra Written 254318 spots for SRR21853437.sra SRR ids: ['SRR21853437.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xyn89kfb SRR21853437.sra spots: 5086361 blocks: [[1, 254318], [254319, 508636], [508637, 762954], [762955, 1017272], [1017273, 1271590], [1271591, 1525908], [1525909, 1780226], [1780227, 2034544], [2034545, 2288862], [2288863, 2543180], [2543181, 2797498], [2797499, 3051816], [3051817, 3306134], [3306135, 3560452], [3560453, 3814770], [3814771, 4069088], [4069089, 4323406], [4323407, 4577724], [4577725, 4832042], [4832043, 5086361]] SRR21853437 file size 1367218 SRR21853437 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853437 SRR21853437_1.fastq Input file: SRR21853437_1.fastq trimmed: SRR21853437-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:47:36 2024 >> started Fri Dec 6 14:47:38 2024 >> done (2.608s) 5086361 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 15527 ( 0.31%) empty reads filtered out after trimming by size control 5070831 (99.69%) reads available; of these: 176 ( 0.00%) trimmed reads available after processing 5070655 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 0 0.00% 31 3 0.00% 32 0 0.00% 33 6 0.00% 34 0 0.00% 35 12 0.00% 36 13 0.00% 37 22 0.00% 38 16 0.00% 39 22 0.00% 40 11 0.00% 41 13 0.00% 42 15 0.00% 43 21 0.00% 44 20 0.00% 45 28 0.00% 46 25 0.00% 47 12 0.00% 48 15 0.00% 49 21 0.00% 50 20 0.00% 51 27 0.00% 52 24 0.00% 53 21 0.00% 54 15 0.00% 55 24 0.00% 56 31 0.00% 57 32 0.00% 58 35 0.00% 59 25 0.00% 60 33 0.00% 61 23 0.00% 62 33 0.00% 63 36 0.00% 64 30 0.00% 65 30 0.00% 66 42 0.00% 67 31 0.00% 68 34 0.00% 69 31 0.00% 70 21 0.00% 71 45 0.00% 72 27 0.00% 73 27 0.00% 74 30 0.00% 75 26 0.00% 76 28 0.00% 77 38 0.00% 78 45 0.00% 79 32 0.00% 80 46 0.00% 81 43 0.00% 82 51 0.00% 83 32 0.00% 84 43 0.00% 85 57 0.00% 86 49 0.00% 87 69 0.00% 88 50 0.00% 89 71 0.00% 90 77 0.00% 91 215 0.00% 92 78 0.00% 93 101 0.00% 94 336 0.01% 95 1219 0.02% 96 6804 0.13% 97 22307 0.44% 98 88759 1.75% 99 336228 6.63% 100 1117123 22.03% 101 3495897 68.94% 5070831 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=19 prefix-density=0.44 prefix-fanout=1.9 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=18 fanout-score=220.79 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=24.7 sequence=CGCCGCCGCCGC Started job on | Dec 06 14:47:54 Started mapping on | Dec 06 14:47:55 Finished on | Dec 06 14:48:04 Mapping speed, Million of reads per hour | 2028.33 Number of input reads | 5070831 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 4804293 Uniquely mapped reads % | 94.74% Average mapped length | 100.30 Number of splices: Total | 1641276 Number of splices: Annotated (sjdb) | 1562075 Number of splices: GT/AG | 1618995 Number of splices: GC/AG | 19649 Number of splices: AT/AC | 857 Number of splices: Non-canonical | 1775 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.00% Deletion average length | 1.77 Insertion rate per base | 0.00% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 125019 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 90055 % of reads mapped to too many loci | 1.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.76% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 141519 141519 141519 N_multimapping 125019 125019 125019 N_noFeature 166119 2465659 2441034 N_ambiguous 73250 5721 4351 UnstrandedReadsAssigned:4564924 PositiveStrandReadsAssigned:2332913 NegativeStrandReadsAssigned:2358908 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853437 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853437-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,070,831 reads, 4,695,517 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52973 SRR21853437.ke.tsv 35125 SRR21853437.se.tsv 88098 total ==> SRR21853437.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 13.6506 5.74351 PNS24247 1044 945 5.83333 2.17389 PNS24249 1928 1829 39.3742 7.58141 PNS24246 1044 945 5.83333 2.17389 PNS24248 1044 945 5.83333 2.17389 PNS24244 1471 1372 14.4752 3.71555 PNS24243 293 194 8 14.5225 KQK14069 1603 1504 379.972 88.9725 KQK14071 474 375 55.0733 51.7204 ==> SRR21853437.se.tsv <== BRADI_1g14170v3 472 BRADI_1g53295v3 28 BRADI_1g59795v3 63 BRADI_1g07683v3 0 BRADI_1g00485v3 16 BRADI_1g20270v3 505 BRADI_1g74790v3 58 BRADI_1g09890v3 0 BRADI_1g77505v3 49 BRADI_1g48960v3 0 SRR21853437 completed mapping pipeline successfully