Starting /dee2/code/volunteer_pipeline.sh SRR21853438 current disk space = 1550525943808 free memory = 1304082328 SRR21853438 SRAfilesize f3d3fe7194ab2a1a6ad5fe5a5ae9bf70 SRR21853438.sra SRR21853438.sra file validated SRR21853438 is single end SRR21853438 is conventional basespace SRR21853438 read1 length is 46-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853438_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 46-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.282 37.0 37.0 37.0 25.0 37.0 2 35.02575 37.0 37.0 37.0 25.0 37.0 3 35.796 37.0 37.0 37.0 37.0 37.0 4 35.7325 37.0 37.0 37.0 37.0 37.0 5 35.985 37.0 37.0 37.0 37.0 37.0 6 35.9605 37.0 37.0 37.0 37.0 37.0 7 35.797 37.0 37.0 37.0 37.0 37.0 8 35.981 37.0 37.0 37.0 37.0 37.0 9 35.948 37.0 37.0 37.0 37.0 37.0 10-11 35.890249999999995 37.0 37.0 37.0 37.0 37.0 12-13 35.935249999999996 37.0 37.0 37.0 37.0 37.0 14-15 35.894000000000005 37.0 37.0 37.0 37.0 37.0 16-17 36.032 37.0 37.0 37.0 37.0 37.0 18-19 35.89725 37.0 37.0 37.0 37.0 37.0 20-21 35.90925 37.0 37.0 37.0 37.0 37.0 22-23 35.884 37.0 37.0 37.0 37.0 37.0 24-25 35.79925 37.0 37.0 37.0 37.0 37.0 26-27 35.653000000000006 37.0 37.0 37.0 37.0 37.0 28-29 35.73675 37.0 37.0 37.0 37.0 37.0 30-31 35.59775 37.0 37.0 37.0 37.0 37.0 32-33 35.663250000000005 37.0 37.0 37.0 37.0 37.0 34-35 35.6525 37.0 37.0 37.0 37.0 37.0 36-37 35.57625 37.0 37.0 37.0 37.0 37.0 38-39 35.760999999999996 37.0 37.0 37.0 37.0 37.0 40-41 35.48625 37.0 37.0 37.0 37.0 37.0 42-43 35.56 37.0 37.0 37.0 37.0 37.0 44-45 35.601 37.0 37.0 37.0 37.0 37.0 46-47 35.51455388847212 37.0 37.0 37.0 37.0 37.0 48-49 35.631157789447364 37.0 37.0 37.0 37.0 37.0 50-51 35.61790447611903 37.0 37.0 37.0 37.0 37.0 52-53 35.55263815953988 37.0 37.0 37.0 37.0 37.0 54-55 35.58339584896224 37.0 37.0 37.0 37.0 37.0 56-57 35.42535633908477 37.0 37.0 37.0 37.0 37.0 58-59 35.515128782195546 37.0 37.0 37.0 37.0 37.0 60-61 35.492873218304574 37.0 37.0 37.0 37.0 37.0 62-63 35.437859464866214 37.0 37.0 37.0 37.0 37.0 64-65 35.2768192048012 37.0 37.0 37.0 31.0 37.0 66-67 35.38384596149037 37.0 37.0 37.0 37.0 37.0 68-69 35.3373343335834 37.0 37.0 37.0 37.0 37.0 70-71 35.260815203800945 37.0 37.0 37.0 31.0 37.0 72-73 35.46036509127282 37.0 37.0 37.0 37.0 37.0 74-75 35.40710177544386 37.0 37.0 37.0 37.0 37.0 76-77 35.30257564391098 37.0 37.0 37.0 31.0 37.0 78-79 35.43485871467867 37.0 37.0 37.0 37.0 37.0 80-81 35.442860715178796 37.0 37.0 37.0 37.0 37.0 82-83 35.39659914978745 37.0 37.0 37.0 37.0 37.0 84-85 35.31682920730182 37.0 37.0 37.0 37.0 37.0 86-87 35.337084271067766 37.0 37.0 37.0 37.0 37.0 88-89 35.33958489622405 37.0 37.0 37.0 37.0 37.0 90-91 35.42460615153789 37.0 37.0 37.0 37.0 37.0 92-93 35.39934983745937 37.0 37.0 37.0 37.0 37.0 94-95 35.367841960490125 37.0 37.0 37.0 37.0 37.0 96-97 35.17299191932604 37.0 37.0 37.0 25.0 37.0 98-99 35.26613771790966 37.0 37.0 37.0 31.0 37.0 100-101 35.251371218466055 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 3.0 24 6.0 25 5.0 26 20.0 27 28.0 28 35.0 29 54.0 30 65.0 31 94.0 32 145.0 33 174.0 34 255.0 35 485.0 36 2086.0 37 543.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.799999999999997 13.350000000000001 16.975 39.875 2 25.233644859813083 20.43445314473352 30.436979035109875 23.89492296034352 3 26.075 24.275 23.0 26.650000000000002 4 28.7 27.325 17.849999999999998 26.125 5 26.900000000000002 30.8 19.8 22.5 6 22.2 32.324999999999996 21.025 24.45 7 20.1 16.0 37.875 26.025 8 22.025 21.125 25.6 31.25 9 23.849999999999998 20.275000000000002 27.325 28.549999999999997 10-11 25.05 27.250000000000004 20.025000000000002 27.675 12-13 23.7 21.2875 25.624999999999996 29.3875 14-15 25.874999999999996 22.525000000000002 23.962500000000002 27.6375 16-17 25.074999999999996 23.3375 23.8125 27.775 18-19 24.8 25.074999999999996 22.275 27.85 20-21 25.7375 23.3 23.674999999999997 27.287499999999998 22-23 24.85 23.875 24.125 27.150000000000002 24-25 25.362499999999997 24.212500000000002 23.474999999999998 26.950000000000003 26-27 24.9 23.7625 24.1125 27.224999999999998 28-29 25.575 24.025 23.375 27.025 30-31 25.55 24.212500000000002 23.8375 26.400000000000002 32-33 25.0625 24.4875 23.025000000000002 27.425 34-35 25.2625 24.125 22.925 27.6875 36-37 25.837500000000002 24.099999999999998 23.375 26.687499999999996 38-39 25.3 24.4125 23.4625 26.825 40-41 25.05 23.875 22.85 28.225 42-43 25.5125 24.6875 23.225 26.575 44-45 25.7375 24.775 23.375 26.1125 46-47 25.815726965870734 24.353044130516317 23.102887860982623 26.728341042630326 48-49 24.618654663665918 24.493623405851466 24.10602650662666 26.78169542385596 50-51 26.206551637909474 23.893473368342086 22.780695173793447 27.11927981995499 52-53 25.143785946486624 23.755938984746187 23.468367091772944 27.631907976994246 54-55 25.668917229307326 24.056014003500874 23.818454613653415 26.456614153538382 56-57 25.318829707426854 23.443360840210055 22.980745186296573 28.257064266066518 58-59 26.106526631657918 23.95598899724931 23.455863965991497 26.481620405101275 60-61 25.331332833208304 23.63090772693173 23.418354588647162 27.619404851212803 62-63 25.78144536134033 23.093273318329583 23.143285821455365 27.981995498874717 64-65 25.63140785196299 23.755938984746187 23.25581395348837 27.35683920980245 66-67 25.18129532383096 24.55613903475869 23.768442110527634 26.494123530882717 68-69 26.556639159789945 24.118529632408105 22.58064516129032 26.744186046511626 70-71 26.344086021505376 22.73068267066767 23.330832708177045 27.59439859964991 72-73 26.25656414103526 24.23105776444111 23.518379594898725 25.993998499624904 74-75 26.03150787696924 23.243310827706924 23.468367091772944 27.25681420355089 76-77 27.019254813703427 22.643160790197552 23.668417104276067 26.669167291822955 78-79 26.156539134783696 23.705926481620406 22.50562640660165 27.631907976994246 80-81 25.906476619154787 23.705926481620406 23.380845211302827 27.00675168792198 82-83 26.894223555888974 23.605901475368842 22.443110777694425 27.056764191047762 84-85 25.71892973243311 23.618404601150285 22.893223305826456 27.769442360590148 86-87 26.094023505876468 23.380845211302827 22.80570142535634 27.719429857464366 88-89 26.756689172293076 23.143285821455365 23.355838959739934 26.744186046511626 90-91 27.081770442610654 23.268317079269817 22.943235808952238 26.70667666916729 92-93 26.44411102775694 24.343585896474117 22.80570142535634 26.406601650412604 94-95 27.11927981995499 21.9679919979995 23.48087021755439 27.431857964491122 96-97 26.664997496244368 22.84677015523285 24.01101652478718 26.477215823735605 98-99 26.49073839127125 23.648820096422227 22.76072062928191 27.099720883024613 100-101 27.384907451352635 10.26736275905711 28.065179560196174 34.28255022939408 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 1.5 27 2.0 28 4.5 29 4.0 30 4.0 31 5.5 32 9.0 33 12.5 34 17.5 35 25.0 36 34.0 37 43.0 38 63.0 39 89.5 40 105.0 41 118.0 42 129.0 43 137.0 44 157.0 45 162.0 46 144.5 47 147.5 48 152.0 49 151.0 50 137.5 51 128.0 52 120.5 53 112.5 54 109.0 55 94.5 56 97.5 57 103.5 58 93.0 59 84.0 60 88.5 61 95.5 62 85.5 63 80.5 64 80.5 65 77.0 66 80.0 67 73.0 68 75.5 69 79.0 70 66.0 71 57.0 72 57.0 73 49.5 74 40.0 75 29.5 76 23.5 77 22.0 78 15.5 79 10.0 80 6.0 81 4.5 82 3.5 83 2.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.0250000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 46-47 1.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 32.0 98-99 378.0 100-101 3589.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.525 #Duplication Level Percentage of deduplicated Percentage of total 1 92.67765468792219 85.75 2 6.835990272899216 12.65 3 0.4593353147797892 1.275 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027019724398811132 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 13 0.325 TruSeq Adapter, Index 13 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686060 spots for SRR21853438.sra Written 686060 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra Read 686046 spots for SRR21853438.sra Written 686046 spots for SRR21853438.sra SRR ids: ['SRR21853438.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wpg1c5_l SRR21853438.sra spots: 13720934 blocks: [[1, 686046], [686047, 1372092], [1372093, 2058138], [2058139, 2744184], [2744185, 3430230], [3430231, 4116276], [4116277, 4802322], [4802323, 5488368], [5488369, 6174414], [6174415, 6860460], [6860461, 7546506], [7546507, 8232552], [8232553, 8918598], [8918599, 9604644], [9604645, 10290690], [10290691, 10976736], [10976737, 11662782], [11662783, 12348828], [12348829, 13034874], [13034875, 13720934]] SRR21853438 file size 3693388 SRR21853438 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853438 SRR21853438_1.fastq Input file: SRR21853438_1.fastq trimmed: SRR21853438-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:50:04 2024 >> started Fri Dec 6 14:50:11 2024 >> done (7.595s) 13720934 reads processed; of these: 11 ( 0.00%) short reads filtered out after trimming by size control 51098 ( 0.37%) empty reads filtered out after trimming by size control 13669825 (99.63%) reads available; of these: 419 ( 0.00%) trimmed reads available after processing 13669406 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 4 0.00% 21 1 0.00% 22 3 0.00% 23 3 0.00% 24 3 0.00% 25 1 0.00% 26 2 0.00% 27 2 0.00% 28 6 0.00% 29 6 0.00% 30 4 0.00% 31 7 0.00% 32 3 0.00% 33 8 0.00% 34 7 0.00% 35 84 0.00% 36 63 0.00% 37 74 0.00% 38 87 0.00% 39 85 0.00% 40 102 0.00% 41 106 0.00% 42 83 0.00% 43 104 0.00% 44 81 0.00% 45 110 0.00% 46 93 0.00% 47 125 0.00% 48 107 0.00% 49 95 0.00% 50 109 0.00% 51 118 0.00% 52 134 0.00% 53 132 0.00% 54 136 0.00% 55 143 0.00% 56 151 0.00% 57 119 0.00% 58 134 0.00% 59 132 0.00% 60 144 0.00% 61 149 0.00% 62 151 0.00% 63 129 0.00% 64 151 0.00% 65 160 0.00% 66 158 0.00% 67 140 0.00% 68 148 0.00% 69 161 0.00% 70 156 0.00% 71 161 0.00% 72 182 0.00% 73 144 0.00% 74 181 0.00% 75 135 0.00% 76 160 0.00% 77 165 0.00% 78 199 0.00% 79 222 0.00% 80 206 0.00% 81 217 0.00% 82 192 0.00% 83 218 0.00% 84 213 0.00% 85 197 0.00% 86 255 0.00% 87 268 0.00% 88 251 0.00% 89 286 0.00% 90 333 0.00% 91 662 0.00% 92 291 0.00% 93 397 0.00% 94 1002 0.01% 95 3611 0.03% 96 18845 0.14% 97 60749 0.44% 98 239761 1.75% 99 908550 6.65% 100 3011001 22.03% 101 9416355 68.88% 13669825 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=20 prefix-density=0.46 prefix-fanout=1.9 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=20 fanout-score=215.40 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=24.5 sequence=CGCCGCCGCCGC Started job on | Dec 06 14:50:33 Started mapping on | Dec 06 14:50:33 Finished on | Dec 06 14:50:53 Mapping speed, Million of reads per hour | 2460.57 Number of input reads | 13669825 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 12953291 Uniquely mapped reads % | 94.76% Average mapped length | 100.28 Number of splices: Total | 4453872 Number of splices: Annotated (sjdb) | 4237835 Number of splices: GT/AG | 4392411 Number of splices: GC/AG | 53725 Number of splices: AT/AC | 2285 Number of splices: Non-canonical | 5451 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.81 Insertion rate per base | 0.00% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 336223 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 233638 % of reads mapped to too many loci | 1.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.81% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 380311 380311 380311 N_multimapping 336223 336223 336223 N_noFeature 448283 6639589 6592119 N_ambiguous 194867 14821 11656 UnstrandedReadsAssigned:12310141 PositiveStrandReadsAssigned:6298881 NegativeStrandReadsAssigned:6349516 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853438 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853438-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,669,825 reads, 12,656,682 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52973 SRR21853438.ke.tsv 35125 SRR21853438.se.tsv 88098 total ==> SRR21853438.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.0150253 0.00233919 PNS24247 1044 945 27.8275 3.83716 PNS24249 1928 1829 155.512 11.0794 PNS24246 1044 945 27.8275 3.83716 PNS24248 1044 945 27.8275 3.83716 PNS24244 1471 1372 28.9906 2.75341 PNS24243 293 194 10 6.71684 KQK14069 1603 1504 1015.82 88.0105 KQK14071 474 375 133.492 46.3863 ==> SRR21853438.se.tsv <== BRADI_1g14170v3 1241 BRADI_1g53295v3 60 BRADI_1g59795v3 141 BRADI_1g07683v3 0 BRADI_1g00485v3 50 BRADI_1g20270v3 1413 BRADI_1g74790v3 155 BRADI_1g09890v3 8 BRADI_1g77505v3 166 BRADI_1g48960v3 0 SRR21853438 completed mapping pipeline successfully