Starting /dee2/code/volunteer_pipeline.sh SRR21853442 current disk space = 1550501298176 free memory = 1598572008 SRR21853442 SRAfilesize 929cc67e0f9023c6f7a4242380e0f6ac SRR21853442.sra SRR21853442.sra file validated SRR21853442 is single end SRR21853442 is conventional basespace SRR21853442 read1 length is 61-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853442_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 61-101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.3875 37.0 37.0 37.0 37.0 37.0 2 34.73175 37.0 37.0 37.0 25.0 37.0 3 35.5285 37.0 37.0 37.0 37.0 37.0 4 35.6845 37.0 37.0 37.0 37.0 37.0 5 35.7685 37.0 37.0 37.0 37.0 37.0 6 35.755 37.0 37.0 37.0 37.0 37.0 7 35.6285 37.0 37.0 37.0 37.0 37.0 8 35.79 37.0 37.0 37.0 37.0 37.0 9 35.7405 37.0 37.0 37.0 37.0 37.0 10-11 35.83725 37.0 37.0 37.0 37.0 37.0 12-13 35.82325 37.0 37.0 37.0 37.0 37.0 14-15 35.85225 37.0 37.0 37.0 37.0 37.0 16-17 35.914500000000004 37.0 37.0 37.0 37.0 37.0 18-19 35.72275 37.0 37.0 37.0 37.0 37.0 20-21 35.6895 37.0 37.0 37.0 37.0 37.0 22-23 35.67125 37.0 37.0 37.0 37.0 37.0 24-25 35.742000000000004 37.0 37.0 37.0 37.0 37.0 26-27 35.53275 37.0 37.0 37.0 37.0 37.0 28-29 35.565 37.0 37.0 37.0 37.0 37.0 30-31 35.6565 37.0 37.0 37.0 37.0 37.0 32-33 35.6335 37.0 37.0 37.0 37.0 37.0 34-35 35.53175 37.0 37.0 37.0 37.0 37.0 36-37 35.525499999999994 37.0 37.0 37.0 37.0 37.0 38-39 35.485 37.0 37.0 37.0 37.0 37.0 40-41 35.4705 37.0 37.0 37.0 37.0 37.0 42-43 35.53075 37.0 37.0 37.0 37.0 37.0 44-45 35.408500000000004 37.0 37.0 37.0 37.0 37.0 46-47 35.303250000000006 37.0 37.0 37.0 37.0 37.0 48-49 35.44775 37.0 37.0 37.0 37.0 37.0 50-51 35.454499999999996 37.0 37.0 37.0 37.0 37.0 52-53 35.37125 37.0 37.0 37.0 37.0 37.0 54-55 35.439 37.0 37.0 37.0 37.0 37.0 56-57 35.3925 37.0 37.0 37.0 37.0 37.0 58-59 35.30475 37.0 37.0 37.0 37.0 37.0 60-61 35.310500000000005 37.0 37.0 37.0 37.0 37.0 62-63 35.34333583395849 37.0 37.0 37.0 31.0 37.0 64-65 35.392098024506126 37.0 37.0 37.0 37.0 37.0 66-67 35.19604901225306 37.0 37.0 37.0 25.0 37.0 68-69 35.30482620655164 37.0 37.0 37.0 37.0 37.0 70-71 35.27531882970743 37.0 37.0 37.0 31.0 37.0 72-73 35.32608152038009 37.0 37.0 37.0 31.0 37.0 74-75 35.25906476619154 37.0 37.0 37.0 31.0 37.0 76-77 35.2880720180045 37.0 37.0 37.0 31.0 37.0 78-79 35.341335333833456 37.0 37.0 37.0 37.0 37.0 80-81 35.2275568892223 37.0 37.0 37.0 31.0 37.0 82-83 35.28989494747374 37.0 37.0 37.0 31.0 37.0 84-85 35.371685842921465 37.0 37.0 37.0 37.0 37.0 86-87 35.295936184254245 37.0 37.0 37.0 37.0 37.0 88-89 35.275206404803605 37.0 37.0 37.0 31.0 37.0 90-91 35.18663997998499 37.0 37.0 37.0 25.0 37.0 92-93 35.27423915033372 37.0 37.0 37.0 37.0 37.0 94-95 35.259009009009006 37.0 37.0 37.0 31.0 37.0 96-97 35.198159138963845 37.0 37.0 37.0 25.0 37.0 98-99 35.130984080998715 37.0 37.0 37.0 25.0 37.0 100-101 35.09950536175412 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 9.0 25 11.0 26 20.0 27 21.0 28 32.0 29 66.0 30 75.0 31 94.0 32 142.0 33 209.0 34 294.0 35 530.0 36 2126.0 37 369.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.2 16.1 15.925 37.775 2 23.278271918678524 22.16010165184244 33.1130876747141 21.448538754764932 3 25.1 25.1 26.275 23.525 4 25.825 29.875 20.5 23.799999999999997 5 26.400000000000002 32.125 21.625 19.85 6 19.45 35.55 22.525000000000002 22.475 7 19.0 18.4 41.6 21.0 8 21.675 23.1 27.400000000000002 27.825 9 20.9 23.150000000000002 29.725 26.224999999999998 10-11 24.4125 30.825000000000003 21.175 23.5875 12-13 22.2 24.0375 27.875 25.887500000000003 14-15 23.1 26.424999999999997 27.025 23.45 16-17 24.325 26.337500000000002 25.5375 23.799999999999997 18-19 23.45 26.7625 25.9875 23.799999999999997 20-21 23.5375 26.474999999999998 26.237500000000004 23.75 22-23 23.5 27.175 25.525 23.799999999999997 24-25 23.0 26.674999999999997 26.5875 23.7375 26-27 23.2125 26.137500000000003 26.5125 24.1375 28-29 23.75 26.674999999999997 26.025 23.549999999999997 30-31 23.0625 27.237499999999997 25.9875 23.7125 32-33 22.925 27.6875 26.0 23.3875 34-35 23.849999999999998 26.8125 26.150000000000002 23.1875 36-37 23.3125 26.3125 26.6625 23.7125 38-39 22.8 27.125 26.6625 23.4125 40-41 23.974999999999998 26.0125 25.8125 24.2 42-43 24.087500000000002 26.1 26.125 23.6875 44-45 23.849999999999998 26.875 25.7375 23.5375 46-47 23.849999999999998 26.0125 26.150000000000002 23.9875 48-49 23.6375 26.0375 27.4125 22.912499999999998 50-51 23.400000000000002 26.987499999999997 26.450000000000003 23.1625 52-53 23.1375 26.724999999999998 25.7875 24.349999999999998 54-55 23.5125 26.2875 26.2875 23.9125 56-57 22.925 26.55 26.150000000000002 24.375 58-59 22.975 27.3125 26.2875 23.425 60-61 23.7625 26.450000000000003 25.7875 24.0 62-63 23.618404601150285 26.819204801200303 25.431357839459867 24.131032758189548 64-65 24.318579644911228 26.44411102775694 26.51912978244561 22.718179544886222 66-67 22.893223305826456 27.33183295823956 26.531632908227053 23.243310827706924 68-69 23.668417104276067 27.069267316829208 26.36909227306827 22.893223305826456 70-71 24.281070267566893 27.156789197299325 25.143785946486624 23.418354588647162 72-73 23.218304576144035 26.619154788697173 26.581645411352838 23.58089522380595 74-75 24.33108277069267 27.24431107776944 25.51887971992998 22.9057264316079 76-77 23.893473368342086 26.506626656664167 26.19404851212803 23.40585146286572 78-79 23.493373343335833 25.743935983995996 26.39409852463116 24.36859214803701 80-81 24.406101525381345 27.11927981995499 25.18129532383096 23.293323330832706 82-83 24.337168584292147 26.91345672836418 25.42521260630315 23.32416208104052 84-85 23.424212106053027 26.450725362681343 26.825912956478238 23.299149574787396 86-87 23.527204502814257 25.8411507191995 27.07942464040025 23.55222013758599 88-89 24.505879409557167 25.481611208406306 25.69427070302727 24.31823867900926 90-91 23.46760070052539 26.394796097072803 26.169627220415308 23.967975981986488 92-93 23.458025772550982 26.485674965594896 26.886025272113102 23.170273989741023 94-95 25.400400400400404 25.775775775775777 25.900900900900904 22.922922922922922 96-97 23.39305851397068 26.099486279914796 26.688384914171152 23.819070291943365 98-99 23.703326111889893 24.85026124633618 27.526443226710846 23.91996941506308 100-101 25.075098814229246 11.525691699604742 33.48616600790514 29.91304347826087 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 3.0 2 2.0 3 1.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 2.5 21 2.5 22 1.0 23 1.0 24 2.0 25 2.0 26 2.0 27 3.5 28 8.5 29 11.0 30 11.0 31 11.0 32 16.0 33 25.5 34 35.0 35 53.5 36 66.0 37 72.0 38 89.5 39 108.5 40 137.5 41 171.0 42 184.5 43 207.5 44 221.0 45 224.5 46 236.0 47 236.5 48 212.0 49 180.5 50 167.5 51 151.0 52 135.5 53 129.5 54 108.0 55 86.0 56 85.5 57 72.0 58 59.0 59 56.5 60 48.5 61 43.5 62 42.5 63 40.5 64 35.0 65 24.0 66 24.5 67 30.0 68 24.5 69 19.5 70 15.5 71 12.0 72 11.5 73 11.0 74 7.0 75 5.5 76 5.5 77 3.0 78 2.0 79 2.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 1.0 93 0.0 94 0.0 95 1.0 96 9.0 97 20.0 98 85.0 99 237.0 100 963.0 101 2681.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.75 #Duplication Level Percentage of deduplicated Percentage of total 1 94.10666666666667 88.225 2 5.493333333333333 10.299999999999999 3 0.3466666666666667 0.975 4 0.02666666666666667 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02666666666666667 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 16 0.4 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856338 spots for SRR21853442.sra Written 856338 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra Read 856335 spots for SRR21853442.sra Written 856335 spots for SRR21853442.sra SRR ids: ['SRR21853442.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_smwkoh62 SRR21853442.sra spots: 17126703 blocks: [[1, 856335], [856336, 1712670], [1712671, 2569005], [2569006, 3425340], [3425341, 4281675], [4281676, 5138010], [5138011, 5994345], [5994346, 6850680], [6850681, 7707015], [7707016, 8563350], [8563351, 9419685], [9419686, 10276020], [10276021, 11132355], [11132356, 11988690], [11988691, 12845025], [12845026, 13701360], [13701361, 14557695], [14557696, 15414030], [15414031, 16270365], [16270366, 17126703]] SRR21853442 file size 4611926 SRR21853442 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853442 SRR21853442_1.fastq Input file: SRR21853442_1.fastq trimmed: SRR21853442-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:51:39 2024 >> started Fri Dec 6 14:51:48 2024 >> done (8.821s) 17126703 reads processed; of these: 4 ( 0.00%) short reads filtered out after trimming by size control 69938 ( 0.41%) empty reads filtered out after trimming by size control 17056761 (99.59%) reads available; of these: 254 ( 0.00%) trimmed reads available after processing 17056507 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 3 0.00% 21 0 0.00% 22 2 0.00% 23 3 0.00% 24 3 0.00% 25 5 0.00% 26 3 0.00% 27 2 0.00% 28 0 0.00% 29 2 0.00% 30 5 0.00% 31 5 0.00% 32 2 0.00% 33 6 0.00% 34 5 0.00% 35 25 0.00% 36 25 0.00% 37 42 0.00% 38 41 0.00% 39 32 0.00% 40 30 0.00% 41 33 0.00% 42 61 0.00% 43 62 0.00% 44 62 0.00% 45 37 0.00% 46 47 0.00% 47 41 0.00% 48 37 0.00% 49 73 0.00% 50 65 0.00% 51 62 0.00% 52 46 0.00% 53 76 0.00% 54 70 0.00% 55 81 0.00% 56 68 0.00% 57 75 0.00% 58 73 0.00% 59 88 0.00% 60 93 0.00% 61 87 0.00% 62 86 0.00% 63 101 0.00% 64 88 0.00% 65 92 0.00% 66 96 0.00% 67 127 0.00% 68 122 0.00% 69 120 0.00% 70 103 0.00% 71 113 0.00% 72 121 0.00% 73 142 0.00% 74 111 0.00% 75 126 0.00% 76 123 0.00% 77 122 0.00% 78 141 0.00% 79 167 0.00% 80 178 0.00% 81 152 0.00% 82 183 0.00% 83 207 0.00% 84 185 0.00% 85 221 0.00% 86 232 0.00% 87 229 0.00% 88 254 0.00% 89 328 0.00% 90 335 0.00% 91 836 0.00% 92 330 0.00% 93 456 0.00% 94 1029 0.01% 95 3497 0.02% 96 23113 0.14% 97 90539 0.53% 98 347497 2.04% 99 1165342 6.83% 100 4223986 24.76% 101 11193953 65.63% 17056761 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=34 prefix-density=0.05 prefix-fanout=2.0 sequence=GGTGCCAAGAAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=246.21 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=24.7 sequence=CAGCAGCAGCAA Started job on | Dec 06 14:52:05 Started mapping on | Dec 06 14:52:05 Finished on | Dec 06 14:52:52 Mapping speed, Million of reads per hour | 1306.48 Number of input reads | 17056761 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 15692007 Uniquely mapped reads % | 92.00% Average mapped length | 100.21 Number of splices: Total | 6066695 Number of splices: Annotated (sjdb) | 5767142 Number of splices: GT/AG | 5985483 Number of splices: GC/AG | 69836 Number of splices: AT/AC | 3525 Number of splices: Non-canonical | 7851 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.09 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 275011 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 228760 % of reads mapped to too many loci | 1.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.87% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1089743 1089743 1089743 N_multimapping 275011 275011 275011 N_noFeature 873240 8256910 8103729 N_ambiguous 236132 16050 16782 UnstrandedReadsAssigned:14582635 PositiveStrandReadsAssigned:7419047 NegativeStrandReadsAssigned:7571496 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853442 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853442-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,056,761 reads, 14,974,142 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52973 SRR21853442.ke.tsv 35125 SRR21853442.se.tsv 88098 total ==> SRR21853442.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 119.798 16.4912 PNS24249 1928 1829 89.8954 6.39376 PNS24246 1044 945 119.798 16.4912 PNS24248 1044 945 119.798 16.4912 PNS24244 1471 1372 142.709 13.531 PNS24243 293 194 18 12.0699 KQK14069 1603 1504 3494.93 302.289 KQK14071 474 375 1133.43 393.182 ==> SRR21853442.se.tsv <== BRADI_1g14170v3 5831 BRADI_1g53295v3 81 BRADI_1g59795v3 652 BRADI_1g07683v3 0 BRADI_1g00485v3 51 BRADI_1g20270v3 241 BRADI_1g74790v3 89 BRADI_1g09890v3 1 BRADI_1g77505v3 186 BRADI_1g48960v3 0 SRR21853442 completed mapping pipeline successfully