Starting /dee2/code/volunteer_pipeline.sh SRR21853443 current disk space = 1550454108160 free memory = 1342016400 SRR21853443 SRAfilesize a131ec65284021e4a8a3c770dabdfbc2 SRR21853443.sra SRR21853443.sra file validated SRR21853443 is single end SRR21853443 is conventional basespace SRR21853443 read1 length is 53-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853443_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 53-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.2195 37.0 37.0 37.0 25.0 37.0 2 34.81425 37.0 37.0 37.0 25.0 37.0 3 35.758 37.0 37.0 37.0 37.0 37.0 4 35.904 37.0 37.0 37.0 37.0 37.0 5 35.904 37.0 37.0 37.0 37.0 37.0 6 35.895 37.0 37.0 37.0 37.0 37.0 7 35.578 37.0 37.0 37.0 37.0 37.0 8 35.757 37.0 37.0 37.0 37.0 37.0 9 35.901 37.0 37.0 37.0 37.0 37.0 10-11 35.957499999999996 37.0 37.0 37.0 37.0 37.0 12-13 35.88875 37.0 37.0 37.0 37.0 37.0 14-15 35.88549999999999 37.0 37.0 37.0 37.0 37.0 16-17 35.85575 37.0 37.0 37.0 37.0 37.0 18-19 35.86025 37.0 37.0 37.0 37.0 37.0 20-21 35.85875 37.0 37.0 37.0 37.0 37.0 22-23 35.815 37.0 37.0 37.0 37.0 37.0 24-25 35.77925 37.0 37.0 37.0 37.0 37.0 26-27 35.8505 37.0 37.0 37.0 37.0 37.0 28-29 35.705 37.0 37.0 37.0 37.0 37.0 30-31 35.6435 37.0 37.0 37.0 37.0 37.0 32-33 35.72825 37.0 37.0 37.0 37.0 37.0 34-35 35.6385 37.0 37.0 37.0 37.0 37.0 36-37 35.637 37.0 37.0 37.0 37.0 37.0 38-39 35.748 37.0 37.0 37.0 37.0 37.0 40-41 35.582499999999996 37.0 37.0 37.0 37.0 37.0 42-43 35.65775 37.0 37.0 37.0 37.0 37.0 44-45 35.62875 37.0 37.0 37.0 37.0 37.0 46-47 35.52525 37.0 37.0 37.0 37.0 37.0 48-49 35.568 37.0 37.0 37.0 37.0 37.0 50-51 35.54325 37.0 37.0 37.0 37.0 37.0 52-53 35.69 37.0 37.0 37.0 37.0 37.0 54-55 35.59139784946237 37.0 37.0 37.0 37.0 37.0 56-57 35.587966026023764 37.0 37.0 37.0 37.0 37.0 58-59 35.61430715357679 37.0 37.0 37.0 37.0 37.0 60-61 35.61405702851426 37.0 37.0 37.0 37.0 37.0 62-63 35.57928964482241 37.0 37.0 37.0 37.0 37.0 64-65 35.41395697848924 37.0 37.0 37.0 37.0 37.0 66-67 35.27163581790896 37.0 37.0 37.0 31.0 37.0 68-69 35.41995997999 37.0 37.0 37.0 37.0 37.0 70-71 35.458229114557284 37.0 37.0 37.0 37.0 37.0 72-73 35.394447223611806 37.0 37.0 37.0 37.0 37.0 74-75 35.450975487743875 37.0 37.0 37.0 37.0 37.0 76-77 35.364932466233114 37.0 37.0 37.0 37.0 37.0 78-79 35.38794397198599 37.0 37.0 37.0 37.0 37.0 80-81 35.44547273636819 37.0 37.0 37.0 37.0 37.0 82-83 35.41845922961481 37.0 37.0 37.0 37.0 37.0 84-85 35.30140070035017 37.0 37.0 37.0 37.0 37.0 86-87 35.3775331498624 37.0 37.0 37.0 37.0 37.0 88-89 35.375531648736555 37.0 37.0 37.0 37.0 37.0 90-91 35.30052293975236 37.0 37.0 37.0 31.0 37.0 92-93 35.29329329329329 37.0 37.0 37.0 31.0 37.0 94-95 35.24252588007282 37.0 37.0 37.0 31.0 37.0 96-97 35.38745042349318 37.0 37.0 37.0 37.0 37.0 98-99 35.184818390904525 37.0 37.0 37.0 25.0 37.0 100-101 35.136265517854824 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 2.0 25 9.0 26 14.0 27 23.0 28 36.0 29 52.0 30 63.0 31 109.0 32 136.0 33 168.0 34 280.0 35 527.0 36 2098.0 37 480.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.599999999999998 13.275 17.4 40.725 2 25.806451612903224 20.6248412496825 30.30226060452121 23.266446532893063 3 25.374999999999996 24.15 24.3 26.174999999999997 4 27.675 28.499999999999996 18.224999999999998 25.6 5 28.025 30.049999999999997 19.575 22.35 6 21.625 32.925 20.875 24.575 7 20.599999999999998 15.65 38.725 25.025 8 22.35 20.375 24.275 33.0 9 21.349999999999998 21.5 27.675 29.475 10-11 26.325 27.437499999999996 19.575 26.6625 12-13 23.7375 21.5375 25.5625 29.1625 14-15 23.974999999999998 23.875 25.0125 27.1375 16-17 24.712500000000002 24.474999999999998 23.05 27.762500000000003 18-19 24.087500000000002 24.6 24.5125 26.8 20-21 26.075 24.1125 24.05 25.7625 22-23 23.9 25.95 23.775 26.375 24-25 24.3875 24.3875 24.775 26.450000000000003 26-27 25.112499999999997 24.55 24.1125 26.224999999999998 28-29 25.337500000000002 23.549999999999997 24.7875 26.325 30-31 24.8625 24.462500000000002 24.875 25.8 32-33 25.162499999999998 24.962500000000002 23.4625 26.4125 34-35 25.275 23.9 23.6875 27.1375 36-37 24.837500000000002 23.625 24.1625 27.375 38-39 23.775 24.7875 24.2625 27.175 40-41 24.7375 23.7875 23.8625 27.6125 42-43 24.3125 24.675 24.887500000000003 26.125 44-45 25.05 23.7125 24.575 26.6625 46-47 25.2875 23.8625 22.9875 27.8625 48-49 24.825 24.474999999999998 23.875 26.825 50-51 25.5625 24.2375 24.0 26.200000000000003 52-53 26.575 23.799999999999997 23.8125 25.8125 54-55 25.206301575393848 23.95598899724931 23.868467116779193 26.969242310577645 56-57 24.321620607727898 24.27160185069401 23.93397524071527 27.472802300862824 58-59 26.025512756378188 23.686843421710854 23.17408704352176 27.113556778389196 60-61 25.337668834417208 25.237618809404704 23.36168084042021 26.063031515757878 62-63 25.987993996998497 24.69984992496248 23.12406203101551 26.18809404702351 64-65 25.287643821910955 24.787393696848426 23.699349674837418 26.225612806403202 66-67 24.96248124062031 24.73736868434217 24.062031015507753 26.23811905952976 68-69 25.812906453226613 23.78689344672336 22.948974487243625 27.4512256128064 70-71 25.437718859429715 23.92446223111556 24.374687343671837 26.263131565782892 72-73 25.3751875937969 24.54977488744372 23.32416208104052 26.750875437718857 74-75 25.7503751875938 23.611805902951478 23.974487243621812 26.663331665832917 76-77 26.313156578289142 24.12456228114057 23.224112056028016 26.338169084542272 78-79 25.025012506253123 24.474737368684345 23.62431215607804 26.87593796898449 80-81 25.6128064032016 23.961980990495245 24.12456228114057 26.300650325162582 82-83 26.32566283141571 23.986993496748372 23.011505752876438 26.675837918959477 84-85 24.937468734367183 24.149574787393696 24.437218609304654 26.475737868934466 86-87 25.894420815611706 24.055541656242184 23.254941205904426 26.79509632224168 88-89 26.720040030022517 24.44333249937453 23.380035026269702 25.456592444333246 90-91 26.810959589640937 23.80833229075441 23.93344176154135 25.447266358063303 92-93 25.037537537537535 24.4994994994995 24.174174174174173 26.288788788788786 94-95 25.403579026404703 23.7141784507571 24.077086722562882 26.80515580027531 96-97 25.32581453634085 24.01002506265664 23.684210526315788 26.979949874686714 98-99 25.839267548321466 22.863682604272633 24.61851475076297 26.678535096642932 100-101 26.401389546818255 11.179535765040265 29.417337754618668 33.00173693352282 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 1.5 27 1.5 28 4.5 29 6.0 30 4.0 31 8.5 32 14.5 33 20.5 34 27.0 35 36.5 36 41.0 37 46.5 38 60.0 39 77.5 40 97.0 41 123.0 42 138.0 43 139.0 44 158.0 45 159.0 46 167.0 47 181.0 48 177.5 49 161.0 50 139.0 51 127.5 52 123.5 53 115.5 54 94.0 55 97.5 56 103.0 57 90.5 58 92.5 59 102.0 60 87.0 61 70.5 62 74.5 63 83.5 64 80.5 65 76.5 66 73.0 67 74.5 68 69.0 69 52.0 70 47.5 71 47.5 72 47.5 73 42.5 74 34.0 75 27.5 76 23.0 77 15.5 78 10.5 79 9.5 80 4.5 81 3.5 82 4.5 83 1.5 84 1.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 53 1.0 54 0.0 55 0.0 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 1.0 91 0.0 92 0.0 93 0.0 94 1.0 95 2.0 96 6.0 97 21.0 98 68.0 99 271.0 100 921.0 101 2706.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.725 #Duplication Level Percentage of deduplicated Percentage of total 1 92.04142818206596 84.425 2 7.004633415099482 12.85 3 0.8721722540201691 2.4 4 0.05451076587626057 0.2 5 0.027255382938130283 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 5 0.125 TruSeq Adapter, Index 13 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874448 spots for SRR21853443.sra Written 874448 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra Read 874439 spots for SRR21853443.sra Written 874439 spots for SRR21853443.sra SRR ids: ['SRR21853443.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x9yrdkvy SRR21853443.sra spots: 17488789 blocks: [[1, 874439], [874440, 1748878], [1748879, 2623317], [2623318, 3497756], [3497757, 4372195], [4372196, 5246634], [5246635, 6121073], [6121074, 6995512], [6995513, 7869951], [7869952, 8744390], [8744391, 9618829], [9618830, 10493268], [10493269, 11367707], [11367708, 12242146], [12242147, 13116585], [13116586, 13991024], [13991025, 14865463], [14865464, 15739902], [15739903, 16614341], [16614342, 17488789]] SRR21853443 file size 4710356 SRR21853443 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853443 SRR21853443_1.fastq Input file: SRR21853443_1.fastq trimmed: SRR21853443-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:54:47 2024 >> started Fri Dec 6 14:54:56 2024 >> done (9.256s) 17488789 reads processed; of these: 26 ( 0.00%) short reads filtered out after trimming by size control 32276 ( 0.18%) empty reads filtered out after trimming by size control 17456487 (99.82%) reads available; of these: 496 ( 0.00%) trimmed reads available after processing 17455991 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 4 0.00% 22 2 0.00% 23 7 0.00% 24 6 0.00% 25 6 0.00% 26 7 0.00% 27 6 0.00% 28 8 0.00% 29 9 0.00% 30 6 0.00% 31 5 0.00% 32 5 0.00% 33 10 0.00% 34 6 0.00% 35 84 0.00% 36 101 0.00% 37 109 0.00% 38 102 0.00% 39 116 0.00% 40 100 0.00% 41 94 0.00% 42 124 0.00% 43 138 0.00% 44 120 0.00% 45 114 0.00% 46 127 0.00% 47 127 0.00% 48 126 0.00% 49 123 0.00% 50 133 0.00% 51 127 0.00% 52 138 0.00% 53 135 0.00% 54 147 0.00% 55 166 0.00% 56 165 0.00% 57 158 0.00% 58 165 0.00% 59 184 0.00% 60 176 0.00% 61 191 0.00% 62 182 0.00% 63 179 0.00% 64 198 0.00% 65 199 0.00% 66 210 0.00% 67 180 0.00% 68 195 0.00% 69 172 0.00% 70 192 0.00% 71 185 0.00% 72 209 0.00% 73 220 0.00% 74 222 0.00% 75 216 0.00% 76 219 0.00% 77 226 0.00% 78 250 0.00% 79 293 0.00% 80 263 0.00% 81 278 0.00% 82 308 0.00% 83 305 0.00% 84 316 0.00% 85 337 0.00% 86 345 0.00% 87 368 0.00% 88 397 0.00% 89 437 0.00% 90 520 0.00% 91 915 0.01% 92 491 0.00% 93 607 0.00% 94 1318 0.01% 95 4657 0.03% 96 24402 0.14% 97 80228 0.46% 98 312474 1.79% 99 1165905 6.68% 100 3908127 22.39% 101 11946062 68.43% 17456487 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=22 prefix-density=0.39 prefix-fanout=1.8 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=32 fanout-score=212.47 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=23.7 sequence=CCGCCGCCGCCA Started job on | Dec 06 14:55:22 Started mapping on | Dec 06 14:55:22 Finished on | Dec 06 14:55:42 Mapping speed, Million of reads per hour | 3142.17 Number of input reads | 17456487 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 16489948 Uniquely mapped reads % | 94.46% Average mapped length | 100.25 Number of splices: Total | 5735731 Number of splices: Annotated (sjdb) | 5451905 Number of splices: GT/AG | 5654539 Number of splices: GC/AG | 70444 Number of splices: AT/AC | 3164 Number of splices: Non-canonical | 7584 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.00% Deletion average length | 1.81 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430965 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 334418 % of reads mapped to too many loci | 1.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.87% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 535574 535574 535574 N_multimapping 430965 430965 430965 N_noFeature 623574 8431024 8456490 N_ambiguous 258085 18380 15697 UnstrandedReadsAssigned:15608289 PositiveStrandReadsAssigned:8040544 NegativeStrandReadsAssigned:8017761 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853443 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853443-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,456,487 reads, 16,082,850 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52973 SRR21853443.ke.tsv 35125 SRR21853443.se.tsv 88098 total ==> SRR21853443.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 24.0363 2.97814 PNS24247 1044 945 32.0935 3.52199 PNS24249 1928 1829 151.546 8.59279 PNS24246 1044 945 32.0935 3.52199 PNS24248 1044 945 32.0935 3.52199 PNS24244 1471 1372 25.1373 1.90006 PNS24243 293 194 16 8.55306 KQK14069 1603 1504 1283.32 88.4895 KQK14071 474 375 168.444 46.5829 ==> SRR21853443.se.tsv <== BRADI_1g14170v3 1582 BRADI_1g53295v3 119 BRADI_1g59795v3 240 BRADI_1g07683v3 0 BRADI_1g00485v3 82 BRADI_1g20270v3 2092 BRADI_1g74790v3 166 BRADI_1g09890v3 15 BRADI_1g77505v3 185 BRADI_1g48960v3 0 SRR21853443 completed mapping pipeline successfully