Starting /dee2/code/volunteer_pipeline.sh SRR21853444 current disk space = 1550465990656 free memory = 1599261368 SRR21853444 SRAfilesize 1ccdc1235d9ca13ca0b98f3599e56b17 SRR21853444.sra SRR21853444.sra file validated SRR21853444 is single end SRR21853444 is conventional basespace SRR21853444 read1 length is 90-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853444_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 90-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.623 37.0 37.0 37.0 37.0 37.0 2 35.994 37.0 37.0 37.0 37.0 37.0 3 36.0615 37.0 37.0 37.0 37.0 37.0 4 35.9835 37.0 37.0 37.0 37.0 37.0 5 36.0765 37.0 37.0 37.0 37.0 37.0 6 36.123 37.0 37.0 37.0 37.0 37.0 7 36.1015 37.0 37.0 37.0 37.0 37.0 8 36.1745 37.0 37.0 37.0 37.0 37.0 9 36.047 37.0 37.0 37.0 37.0 37.0 10-11 36.155249999999995 37.0 37.0 37.0 37.0 37.0 12-13 36.120999999999995 37.0 37.0 37.0 37.0 37.0 14-15 36.118750000000006 37.0 37.0 37.0 37.0 37.0 16-17 36.033 37.0 37.0 37.0 37.0 37.0 18-19 35.99975 37.0 37.0 37.0 37.0 37.0 20-21 35.97925 37.0 37.0 37.0 37.0 37.0 22-23 36.0745 37.0 37.0 37.0 37.0 37.0 24-25 35.959 37.0 37.0 37.0 37.0 37.0 26-27 35.8255 37.0 37.0 37.0 37.0 37.0 28-29 35.903999999999996 37.0 37.0 37.0 37.0 37.0 30-31 35.8655 37.0 37.0 37.0 37.0 37.0 32-33 35.77475 37.0 37.0 37.0 37.0 37.0 34-35 35.892250000000004 37.0 37.0 37.0 37.0 37.0 36-37 35.822 37.0 37.0 37.0 37.0 37.0 38-39 35.84225 37.0 37.0 37.0 37.0 37.0 40-41 35.812 37.0 37.0 37.0 37.0 37.0 42-43 35.76925 37.0 37.0 37.0 37.0 37.0 44-45 35.7445 37.0 37.0 37.0 37.0 37.0 46-47 35.7585 37.0 37.0 37.0 37.0 37.0 48-49 35.681 37.0 37.0 37.0 37.0 37.0 50-51 35.8875 37.0 37.0 37.0 37.0 37.0 52-53 35.726 37.0 37.0 37.0 37.0 37.0 54-55 35.76175 37.0 37.0 37.0 37.0 37.0 56-57 35.603750000000005 37.0 37.0 37.0 37.0 37.0 58-59 35.7245 37.0 37.0 37.0 37.0 37.0 60-61 35.801 37.0 37.0 37.0 37.0 37.0 62-63 35.70525 37.0 37.0 37.0 37.0 37.0 64-65 35.688500000000005 37.0 37.0 37.0 37.0 37.0 66-67 35.73475 37.0 37.0 37.0 37.0 37.0 68-69 35.701750000000004 37.0 37.0 37.0 37.0 37.0 70-71 35.749750000000006 37.0 37.0 37.0 37.0 37.0 72-73 35.63525 37.0 37.0 37.0 37.0 37.0 74-75 35.6715 37.0 37.0 37.0 37.0 37.0 76-77 35.551249999999996 37.0 37.0 37.0 37.0 37.0 78-79 35.747 37.0 37.0 37.0 37.0 37.0 80-81 35.718500000000006 37.0 37.0 37.0 37.0 37.0 82-83 35.66825 37.0 37.0 37.0 37.0 37.0 84-85 35.64625 37.0 37.0 37.0 37.0 37.0 86-87 35.5975 37.0 37.0 37.0 37.0 37.0 88-89 35.52075 37.0 37.0 37.0 37.0 37.0 90-91 35.60856676669167 37.0 37.0 37.0 37.0 37.0 92-93 35.66208104052026 37.0 37.0 37.0 37.0 37.0 94-95 35.61705852926463 37.0 37.0 37.0 37.0 37.0 96-97 35.56796608567112 37.0 37.0 37.0 37.0 37.0 98-99 35.54465946137418 37.0 37.0 37.0 37.0 37.0 100-101 35.51443599709563 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 2.0 23 2.0 24 4.0 25 9.0 26 13.0 27 19.0 28 20.0 29 51.0 30 51.0 31 82.0 32 103.0 33 148.0 34 183.0 35 446.0 36 2215.0 37 650.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.249999999999996 14.524999999999999 17.8 39.425 2 25.174999999999997 20.974999999999998 32.675 21.175 3 25.15 22.825 26.075 25.95 4 25.650000000000002 30.099999999999998 19.475 24.775 5 25.224999999999998 31.55 22.1 21.125 6 21.975 34.35 21.85 21.825 7 18.05 18.9 40.475 22.575 8 21.65 23.025000000000002 26.775 28.549999999999997 9 20.925 21.975 30.225 26.875 10-11 23.474999999999998 30.4375 21.5625 24.525 12-13 23.3875 23.849999999999998 26.924999999999997 25.837500000000002 14-15 22.8625 25.924999999999997 26.6 24.6125 16-17 24.425 25.587500000000002 24.825 25.162499999999998 18-19 23.4625 26.337500000000002 26.200000000000003 24.0 20-21 22.8 26.4625 25.9625 24.775 22-23 23.25 26.9625 25.650000000000002 24.1375 24-25 22.9875 26.5 25.95 24.5625 26-27 23.0125 26.200000000000003 26.900000000000002 23.8875 28-29 22.650000000000002 26.6125 26.4625 24.275 30-31 23.125 26.387500000000003 26.2875 24.2 32-33 23.1875 27.250000000000004 25.275 24.2875 34-35 24.7375 26.85 24.975 23.4375 36-37 23.849999999999998 25.7875 26.724999999999998 23.6375 38-39 23.799999999999997 26.8375 25.412499999999998 23.95 40-41 23.2125 25.9625 26.174999999999997 24.65 42-43 23.75 25.924999999999997 25.7 24.625 44-45 23.3375 26.5125 25.937500000000004 24.212500000000002 46-47 23.4375 26.337500000000002 25.3 24.925 48-49 23.8375 26.474999999999998 26.187500000000004 23.5 50-51 23.175 27.05 25.7 24.075 52-53 24.212500000000002 26.0 25.687500000000004 24.099999999999998 54-55 23.2125 26.787499999999998 25.3125 24.6875 56-57 23.474999999999998 26.575 25.9875 23.962500000000002 58-59 24.1375 26.775 25.324999999999996 23.7625 60-61 23.2375 26.737499999999997 25.525 24.5 62-63 23.7125 26.0 26.8375 23.45 64-65 23.8375 25.75 26.2125 24.2 66-67 23.35 26.237500000000004 25.45 24.962500000000002 68-69 23.875 26.0625 26.187500000000004 23.875 70-71 24.25 25.837500000000002 26.187500000000004 23.724999999999998 72-73 24.4125 26.437500000000004 25.2125 23.9375 74-75 22.9875 26.087500000000002 25.9625 24.962500000000002 76-77 24.5125 25.974999999999998 25.1 24.4125 78-79 23.925 26.075 26.487500000000004 23.5125 80-81 23.7125 26.2875 25.337500000000002 24.6625 82-83 24.1625 26.474999999999998 24.9125 24.45 84-85 24.2375 26.2625 26.325 23.175 86-87 23.9375 26.8375 25.337500000000002 23.8875 88-89 23.4625 26.737499999999997 25.412499999999998 24.3875 90-91 23.91548943617952 25.890736342042754 25.778222277784725 24.415551943992998 92-93 23.311655827913956 26.738369184592298 25.68784392196098 24.262131065532767 94-95 25.012506253126567 26.18809404702351 24.787393696848426 24.012006003001503 96-97 23.58313524333792 26.898536219191794 25.622419617165022 23.895908920305267 98-99 23.693556570268896 25.291730086250634 26.94063926940639 24.074074074074073 100-101 24.846823605288616 12.205740083843923 32.48951950983553 30.457916801031924 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.0 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 2.5 27 5.0 28 7.5 29 12.5 30 15.5 31 14.5 32 22.0 33 27.0 34 32.5 35 45.0 36 61.0 37 80.5 38 95.0 39 118.0 40 144.0 41 162.0 42 188.0 43 191.0 44 202.0 45 217.0 46 223.5 47 222.5 48 194.0 49 183.5 50 170.0 51 143.0 52 126.0 53 109.0 54 94.0 55 87.0 56 79.5 57 72.0 58 71.5 59 64.0 60 45.0 61 43.0 62 43.5 63 37.5 64 45.0 65 49.0 66 40.5 67 30.5 68 28.0 69 30.5 70 23.0 71 21.5 72 17.0 73 9.5 74 12.5 75 11.0 76 6.5 77 7.0 78 7.5 79 3.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 3.0 97 19.0 98 68.0 99 306.0 100 1002.0 101 2600.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.625 #Duplication Level Percentage of deduplicated Percentage of total 1 92.8744939271255 86.02499999999999 2 6.477732793522267 12.0 3 0.5937921727395412 1.6500000000000001 4 0.026990553306342778 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.026990553306342778 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350663 spots for SRR21853444.sra Written 350663 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra Read 350650 spots for SRR21853444.sra Written 350650 spots for SRR21853444.sra SRR ids: ['SRR21853444.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sps0y_0z SRR21853444.sra spots: 7013013 blocks: [[1, 350650], [350651, 701300], [701301, 1051950], [1051951, 1402600], [1402601, 1753250], [1753251, 2103900], [2103901, 2454550], [2454551, 2805200], [2805201, 3155850], [3155851, 3506500], [3506501, 3857150], [3857151, 4207800], [4207801, 4558450], [4558451, 4909100], [4909101, 5259750], [5259751, 5610400], [5610401, 5961050], [5961051, 6311700], [6311701, 6662350], [6662351, 7013013]] SRR21853444 file size 1885138 SRR21853444 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853444 SRR21853444_1.fastq Input file: SRR21853444_1.fastq trimmed: SRR21853444-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:56:33 2024 >> started Fri Dec 6 14:56:39 2024 >> done (6.630s) 7013013 reads processed; of these: 1 ( 0.00%) short reads filtered out after trimming by size control 22033 ( 0.31%) empty reads filtered out after trimming by size control 6990979 (99.69%) reads available; of these: 206 ( 0.00%) trimmed reads available after processing 6990773 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 1 0.00% 31 4 0.00% 32 2 0.00% 33 4 0.00% 34 1 0.00% 35 7 0.00% 36 4 0.00% 37 8 0.00% 38 7 0.00% 39 4 0.00% 40 6 0.00% 41 5 0.00% 42 9 0.00% 43 10 0.00% 44 10 0.00% 45 6 0.00% 46 14 0.00% 47 7 0.00% 48 15 0.00% 49 15 0.00% 50 10 0.00% 51 19 0.00% 52 13 0.00% 53 15 0.00% 54 9 0.00% 55 11 0.00% 56 19 0.00% 57 22 0.00% 58 16 0.00% 59 16 0.00% 60 21 0.00% 61 16 0.00% 62 30 0.00% 63 23 0.00% 64 16 0.00% 65 16 0.00% 66 19 0.00% 67 19 0.00% 68 32 0.00% 69 21 0.00% 70 32 0.00% 71 22 0.00% 72 31 0.00% 73 27 0.00% 74 29 0.00% 75 37 0.00% 76 36 0.00% 77 37 0.00% 78 31 0.00% 79 42 0.00% 80 32 0.00% 81 37 0.00% 82 41 0.00% 83 36 0.00% 84 56 0.00% 85 50 0.00% 86 64 0.00% 87 46 0.00% 88 66 0.00% 89 68 0.00% 90 111 0.00% 91 275 0.00% 92 79 0.00% 93 160 0.00% 94 357 0.01% 95 1491 0.02% 96 9729 0.14% 97 36370 0.52% 98 139844 2.00% 99 476033 6.81% 100 1705797 24.40% 101 4619408 66.08% 6990979 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=165.75 fanout-score-rank=8 prefix-density=0.44 prefix-fanout=21.7 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=294.13 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=21.7 sequence=CGCCGCCGCCGA Started job on | Dec 06 14:56:58 Started mapping on | Dec 06 14:56:59 Finished on | Dec 06 14:57:16 Mapping speed, Million of reads per hour | 1480.44 Number of input reads | 6990979 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 6440249 Uniquely mapped reads % | 92.12% Average mapped length | 100.24 Number of splices: Total | 2421915 Number of splices: Annotated (sjdb) | 2298561 Number of splices: GT/AG | 2390204 Number of splices: GC/AG | 26993 Number of splices: AT/AC | 1571 Number of splices: Non-canonical | 3147 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 2.10 Insertion rate per base | 0.01% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 125212 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 59154 % of reads mapped to too many loci | 0.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.11% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 425518 425518 425518 N_multimapping 125212 125212 125212 N_noFeature 353506 3371362 3338140 N_ambiguous 96810 6377 6866 UnstrandedReadsAssigned:5989933 PositiveStrandReadsAssigned:3062510 NegativeStrandReadsAssigned:3095243 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853444 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853444-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,990,979 reads, 6,154,042 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52973 SRR21853444.ke.tsv 35125 SRR21853444.se.tsv 88098 total ==> SRR21853444.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 25.2355 9.37869 PNS24247 1044 945 39.8886 13.1303 PNS24249 1928 1829 19.488 3.31443 PNS24246 1044 945 39.8886 13.1303 PNS24248 1044 945 39.8886 13.1303 PNS24244 1471 1372 68.6106 15.5558 PNS24243 293 194 5 8.01724 KQK14069 1603 1504 1802.2 372.744 KQK14071 474 375 572.468 474.872 ==> SRR21853444.se.tsv <== BRADI_1g14170v3 2914 BRADI_1g53295v3 36 BRADI_1g59795v3 259 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 95 BRADI_1g74790v3 62 BRADI_1g09890v3 0 BRADI_1g77505v3 86 BRADI_1g48960v3 0 SRR21853444 completed mapping pipeline successfully