Starting /dee2/code/volunteer_pipeline.sh SRR21853445 current disk space = 1550406078464 free memory = 1599168704 SRR21853445 SRAfilesize 842055bd8b62d871ec9274f0bd935995 SRR21853445.sra SRR21853445.sra file validated SRR21853445 is single end SRR21853445 is conventional basespace SRR21853445 read1 length is 85-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853445_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 85-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.303 37.0 37.0 37.0 37.0 37.0 2 34.83775 37.0 37.0 37.0 25.0 37.0 3 35.511 37.0 37.0 37.0 37.0 37.0 4 35.634 37.0 37.0 37.0 37.0 37.0 5 35.862 37.0 37.0 37.0 37.0 37.0 6 35.705 37.0 37.0 37.0 37.0 37.0 7 35.4785 37.0 37.0 37.0 37.0 37.0 8 35.9995 37.0 37.0 37.0 37.0 37.0 9 35.886 37.0 37.0 37.0 37.0 37.0 10-11 35.9285 37.0 37.0 37.0 37.0 37.0 12-13 35.777249999999995 37.0 37.0 37.0 37.0 37.0 14-15 35.7615 37.0 37.0 37.0 37.0 37.0 16-17 35.79325 37.0 37.0 37.0 37.0 37.0 18-19 35.791 37.0 37.0 37.0 37.0 37.0 20-21 35.878 37.0 37.0 37.0 37.0 37.0 22-23 35.75925 37.0 37.0 37.0 37.0 37.0 24-25 35.65 37.0 37.0 37.0 37.0 37.0 26-27 35.55075 37.0 37.0 37.0 37.0 37.0 28-29 35.613749999999996 37.0 37.0 37.0 37.0 37.0 30-31 35.55475 37.0 37.0 37.0 37.0 37.0 32-33 35.569 37.0 37.0 37.0 37.0 37.0 34-35 35.620000000000005 37.0 37.0 37.0 37.0 37.0 36-37 35.585499999999996 37.0 37.0 37.0 37.0 37.0 38-39 35.426 37.0 37.0 37.0 37.0 37.0 40-41 35.516 37.0 37.0 37.0 37.0 37.0 42-43 35.424499999999995 37.0 37.0 37.0 37.0 37.0 44-45 35.4375 37.0 37.0 37.0 37.0 37.0 46-47 35.5285 37.0 37.0 37.0 37.0 37.0 48-49 35.346000000000004 37.0 37.0 37.0 31.0 37.0 50-51 35.41525 37.0 37.0 37.0 37.0 37.0 52-53 35.4735 37.0 37.0 37.0 37.0 37.0 54-55 35.434749999999994 37.0 37.0 37.0 37.0 37.0 56-57 35.436499999999995 37.0 37.0 37.0 37.0 37.0 58-59 35.29175 37.0 37.0 37.0 31.0 37.0 60-61 35.370000000000005 37.0 37.0 37.0 37.0 37.0 62-63 35.33275 37.0 37.0 37.0 37.0 37.0 64-65 35.376000000000005 37.0 37.0 37.0 37.0 37.0 66-67 35.1785 37.0 37.0 37.0 25.0 37.0 68-69 35.212500000000006 37.0 37.0 37.0 31.0 37.0 70-71 35.232 37.0 37.0 37.0 25.0 37.0 72-73 35.259249999999994 37.0 37.0 37.0 31.0 37.0 74-75 35.349000000000004 37.0 37.0 37.0 31.0 37.0 76-77 35.391999999999996 37.0 37.0 37.0 37.0 37.0 78-79 35.201750000000004 37.0 37.0 37.0 25.0 37.0 80-81 35.36275 37.0 37.0 37.0 37.0 37.0 82-83 35.195750000000004 37.0 37.0 37.0 25.0 37.0 84-85 35.223749999999995 37.0 37.0 37.0 31.0 37.0 86-87 35.23705926481621 37.0 37.0 37.0 31.0 37.0 88-89 35.422355588897226 37.0 37.0 37.0 37.0 37.0 90-91 35.216804201050266 37.0 37.0 37.0 25.0 37.0 92-93 35.324081020255065 37.0 37.0 37.0 37.0 37.0 94-95 35.26156539134784 37.0 37.0 37.0 31.0 37.0 96-97 35.17754582967024 37.0 37.0 37.0 25.0 37.0 98-99 35.23299807373152 37.0 37.0 37.0 25.0 37.0 100-101 35.1278263808671 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 0.0 20 1.0 21 1.0 22 1.0 23 0.0 24 2.0 25 11.0 26 11.0 27 29.0 28 37.0 29 56.0 30 73.0 31 100.0 32 148.0 33 211.0 34 282.0 35 570.0 36 2117.0 37 348.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.725 15.575 17.9 37.8 2 24.63951429294207 22.210979003288642 31.393878067290665 21.755628636478626 3 25.1 24.275 25.525 25.1 4 24.099999999999998 32.275 19.775000000000002 23.849999999999998 5 26.525 31.775 20.75 20.95 6 20.974999999999998 34.25 22.425 22.35 7 19.0 18.5 39.925 22.575 8 21.224999999999998 23.425 26.400000000000002 28.95 9 20.75 22.6 28.499999999999996 28.15 10-11 24.5625 29.4375 21.5625 24.4375 12-13 23.025000000000002 24.7 26.900000000000002 25.374999999999996 14-15 22.7625 25.874999999999996 26.7625 24.6 16-17 23.0125 26.687499999999996 25.7125 24.587500000000002 18-19 22.45 26.75 26.05 24.75 20-21 23.599999999999998 25.474999999999998 25.5 25.424999999999997 22-23 23.3 27.3125 25.837500000000002 23.549999999999997 24-25 22.3125 25.412499999999998 26.75 25.525 26-27 23.125 26.924999999999997 24.8125 25.137500000000003 28-29 23.775 26.724999999999998 25.55 23.95 30-31 23.225 26.575 25.687500000000004 24.5125 32-33 23.0375 26.3125 25.624999999999996 25.025 34-35 23.9125 26.237500000000004 25.887500000000003 23.962500000000002 36-37 23.7375 26.1625 25.3125 24.7875 38-39 22.725 25.8625 26.9125 24.5 40-41 24.125 25.474999999999998 26.2625 24.1375 42-43 23.825 26.55 25.4375 24.1875 44-45 23.0375 26.375 25.587500000000002 25.0 46-47 23.849999999999998 27.1 24.4375 24.6125 48-49 23.2625 26.5 25.825 24.4125 50-51 24.2375 26.337500000000002 25.687500000000004 23.7375 52-53 24.525 26.3625 24.9375 24.175 54-55 24.1875 26.2125 25.825 23.775 56-57 23.4125 25.775 25.5375 25.275 58-59 24.55 24.762500000000003 26.075 24.6125 60-61 24.125 26.450000000000003 25.6 23.825 62-63 23.825 26.0375 25.587500000000002 24.55 64-65 23.6125 25.7375 26.575 24.075 66-67 23.9375 26.5 25.687500000000004 23.875 68-69 23.799999999999997 25.2875 26.2125 24.7 70-71 24.5 26.450000000000003 25.25 23.799999999999997 72-73 23.275000000000002 26.450000000000003 25.887500000000003 24.3875 74-75 24.125 25.7875 25.687500000000004 24.4 76-77 24.474999999999998 26.025 25.15 24.349999999999998 78-79 24.95 25.7375 25.0375 24.275 80-81 23.974999999999998 26.125 26.0375 23.8625 82-83 24.2625 26.674999999999997 24.962500000000002 24.099999999999998 84-85 23.724999999999998 26.025 25.587500000000002 24.6625 86-87 24.918729682420604 26.206551637909474 25.218804701175294 23.655913978494624 88-89 24.256064016004 24.843710927731934 27.131782945736433 23.768442110527634 90-91 24.043510877719427 26.619154788697173 25.79394848712178 23.543385846461614 92-93 24.718679669917478 26.71917979494874 25.431357839459867 23.13078269567392 94-95 24.10602650662666 26.294073518379594 25.506376594148538 24.093523380845213 96-97 23.771929824561404 26.31578947368421 25.32581453634085 24.586466165413533 98-99 25.07002801120448 25.948561242678892 24.560733384262797 24.420677361853834 100-101 25.73940847322142 12.75779376498801 31.910471622701834 29.592326139088733 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.5 21 2.5 22 2.0 23 2.5 24 2.0 25 1.0 26 2.0 27 4.0 28 6.5 29 9.5 30 13.5 31 18.0 32 20.0 33 18.5 34 24.5 35 39.0 36 53.0 37 67.0 38 87.0 39 114.5 40 132.5 41 153.5 42 184.0 43 199.0 44 209.0 45 219.5 46 232.5 47 219.0 48 202.5 49 193.0 50 172.0 51 149.5 52 123.5 53 104.5 54 93.0 55 94.5 56 83.0 57 77.5 58 76.0 59 67.0 60 62.0 61 57.5 62 47.5 63 37.5 64 39.0 65 34.5 66 30.5 67 34.0 68 32.0 69 26.0 70 23.5 71 21.5 72 17.5 73 14.5 74 14.0 75 11.5 76 8.0 77 5.0 78 3.5 79 3.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.175 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 1.0 96 16.0 97 26.0 98 58.0 99 290.0 100 961.0 101 2647.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.175 #Duplication Level Percentage of deduplicated Percentage of total 1 93.50684196404615 87.125 2 6.117520794204454 11.4 3 0.29514354708881135 0.8250000000000001 4 0.026831231553528307 0.1 5 0.026831231553528307 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026831231553528307 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 17 0.42500000000000004 TruSeq Adapter, Index 7 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCGCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Read 757212 spots for SRR21853445.sra Written 757212 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Read 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra Written 757209 spots for SRR21853445.sra SRR ids: ['SRR21853445.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_flghkwu_ SRR21853445.sra spots: 15144183 blocks: [[1, 757209], [757210, 1514418], [1514419, 2271627], [2271628, 3028836], [3028837, 3786045], [3786046, 4543254], [4543255, 5300463], [5300464, 6057672], [6057673, 6814881], [6814882, 7572090], [7572091, 8329299], [8329300, 9086508], [9086509, 9843717], [9843718, 10600926], [10600927, 11358135], [11358136, 12115344], [12115345, 12872553], [12872554, 13629762], [13629763, 14386971], [14386972, 15144183]] SRR21853445 file size 4076922 SRR21853445 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853445 SRR21853445_1.fastq Input file: SRR21853445_1.fastq trimmed: SRR21853445-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:59:13 2024 >> started Fri Dec 6 14:59:21 2024 >> done (7.860s) 15144183 reads processed; of these: 12 ( 0.00%) short reads filtered out after trimming by size control 74578 ( 0.49%) empty reads filtered out after trimming by size control 15069593 (99.51%) reads available; of these: 262 ( 0.00%) trimmed reads available after processing 15069331 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 2 0.00% 21 0 0.00% 22 4 0.00% 23 2 0.00% 24 1 0.00% 25 0 0.00% 26 6 0.00% 27 4 0.00% 28 5 0.00% 29 4 0.00% 30 3 0.00% 31 1 0.00% 32 4 0.00% 33 7 0.00% 34 1 0.00% 35 40 0.00% 36 36 0.00% 37 46 0.00% 38 33 0.00% 39 58 0.00% 40 42 0.00% 41 59 0.00% 42 54 0.00% 43 58 0.00% 44 48 0.00% 45 49 0.00% 46 52 0.00% 47 46 0.00% 48 55 0.00% 49 54 0.00% 50 52 0.00% 51 80 0.00% 52 60 0.00% 53 83 0.00% 54 70 0.00% 55 86 0.00% 56 70 0.00% 57 73 0.00% 58 89 0.00% 59 91 0.00% 60 86 0.00% 61 88 0.00% 62 99 0.00% 63 106 0.00% 64 107 0.00% 65 105 0.00% 66 107 0.00% 67 106 0.00% 68 129 0.00% 69 89 0.00% 70 82 0.00% 71 134 0.00% 72 112 0.00% 73 126 0.00% 74 94 0.00% 75 113 0.00% 76 129 0.00% 77 172 0.00% 78 156 0.00% 79 139 0.00% 80 162 0.00% 81 175 0.00% 82 199 0.00% 83 203 0.00% 84 177 0.00% 85 229 0.00% 86 219 0.00% 87 239 0.00% 88 240 0.00% 89 293 0.00% 90 405 0.00% 91 754 0.01% 92 295 0.00% 93 422 0.00% 94 930 0.01% 95 3336 0.02% 96 20894 0.14% 97 78095 0.52% 98 301494 2.00% 99 1026031 6.81% 100 3674329 24.38% 101 9956664 66.07% 15069593 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=165.47 fanout-score-rank=10 prefix-density=0.44 prefix-fanout=21.4 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=286.87 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=21.4 sequence=CGCCGCCGCCGA Started job on | Dec 06 14:59:42 Started mapping on | Dec 06 14:59:43 Finished on | Dec 06 15:00:13 Mapping speed, Million of reads per hour | 1808.35 Number of input reads | 15069593 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 13867311 Uniquely mapped reads % | 92.02% Average mapped length | 100.21 Number of splices: Total | 5206604 Number of splices: Annotated (sjdb) | 4941874 Number of splices: GT/AG | 5137747 Number of splices: GC/AG | 58548 Number of splices: AT/AC | 3270 Number of splices: Non-canonical | 7039 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.10 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 272549 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 125437 % of reads mapped to too many loci | 0.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.21% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 929733 929733 929733 N_multimapping 272549 272549 272549 N_noFeature 741659 7238112 7188392 N_ambiguous 209602 13733 14854 UnstrandedReadsAssigned:12916050 PositiveStrandReadsAssigned:6615466 NegativeStrandReadsAssigned:6664065 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853445 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853445-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,069,593 reads, 13,253,159 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,280 rounds 52973 SRR21853445.ke.tsv 35125 SRR21853445.se.tsv 88098 total ==> SRR21853445.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 127.027 19.2379 PNS24249 1928 1829 109.915 8.60075 PNS24246 1044 945 127.027 19.2379 PNS24248 1044 945 127.027 19.2379 PNS24244 1471 1372 134.004 13.9784 PNS24243 293 194 18 13.279 KQK14069 1603 1504 4448.16 423.278 KQK14071 474 375 1306.49 498.617 ==> SRR21853445.se.tsv <== BRADI_1g14170v3 6866 BRADI_1g53295v3 72 BRADI_1g59795v3 529 BRADI_1g07683v3 0 BRADI_1g00485v3 44 BRADI_1g20270v3 208 BRADI_1g74790v3 134 BRADI_1g09890v3 0 BRADI_1g77505v3 163 BRADI_1g48960v3 0 SRR21853445 completed mapping pipeline successfully