Starting /dee2/code/volunteer_pipeline.sh SRR21853446 current disk space = 1550399156224 free memory = 1598935156 SRR21853446 SRAfilesize 3318504d56f25698822720b09aa72bdb SRR21853446.sra SRR21853446.sra file validated SRR21853446 is single end SRR21853446 is conventional basespace SRR21853446 read1 length is 95-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853446_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 95-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6285 37.0 37.0 37.0 37.0 37.0 2 35.803 37.0 37.0 37.0 37.0 37.0 3 35.9785 37.0 37.0 37.0 37.0 37.0 4 35.966 37.0 37.0 37.0 37.0 37.0 5 36.059 37.0 37.0 37.0 37.0 37.0 6 36.136 37.0 37.0 37.0 37.0 37.0 7 36.037 37.0 37.0 37.0 37.0 37.0 8 35.9555 37.0 37.0 37.0 37.0 37.0 9 36.133 37.0 37.0 37.0 37.0 37.0 10-11 36.00475 37.0 37.0 37.0 37.0 37.0 12-13 36.073499999999996 37.0 37.0 37.0 37.0 37.0 14-15 35.967 37.0 37.0 37.0 37.0 37.0 16-17 35.97925 37.0 37.0 37.0 37.0 37.0 18-19 35.977500000000006 37.0 37.0 37.0 37.0 37.0 20-21 35.8585 37.0 37.0 37.0 37.0 37.0 22-23 35.928 37.0 37.0 37.0 37.0 37.0 24-25 35.9345 37.0 37.0 37.0 37.0 37.0 26-27 35.81675 37.0 37.0 37.0 37.0 37.0 28-29 35.77825 37.0 37.0 37.0 37.0 37.0 30-31 35.69175 37.0 37.0 37.0 37.0 37.0 32-33 35.805499999999995 37.0 37.0 37.0 37.0 37.0 34-35 35.76875 37.0 37.0 37.0 37.0 37.0 36-37 35.749 37.0 37.0 37.0 37.0 37.0 38-39 35.884249999999994 37.0 37.0 37.0 37.0 37.0 40-41 35.7645 37.0 37.0 37.0 37.0 37.0 42-43 35.7335 37.0 37.0 37.0 37.0 37.0 44-45 35.692 37.0 37.0 37.0 37.0 37.0 46-47 35.685500000000005 37.0 37.0 37.0 37.0 37.0 48-49 35.557249999999996 37.0 37.0 37.0 37.0 37.0 50-51 35.729 37.0 37.0 37.0 37.0 37.0 52-53 35.7355 37.0 37.0 37.0 37.0 37.0 54-55 35.4935 37.0 37.0 37.0 37.0 37.0 56-57 35.64975 37.0 37.0 37.0 37.0 37.0 58-59 35.71 37.0 37.0 37.0 37.0 37.0 60-61 35.604 37.0 37.0 37.0 37.0 37.0 62-63 35.63875 37.0 37.0 37.0 37.0 37.0 64-65 35.61875 37.0 37.0 37.0 37.0 37.0 66-67 35.70025 37.0 37.0 37.0 37.0 37.0 68-69 35.586749999999995 37.0 37.0 37.0 37.0 37.0 70-71 35.6665 37.0 37.0 37.0 37.0 37.0 72-73 35.613749999999996 37.0 37.0 37.0 37.0 37.0 74-75 35.50575 37.0 37.0 37.0 37.0 37.0 76-77 35.6895 37.0 37.0 37.0 37.0 37.0 78-79 35.587 37.0 37.0 37.0 37.0 37.0 80-81 35.607749999999996 37.0 37.0 37.0 37.0 37.0 82-83 35.5845 37.0 37.0 37.0 37.0 37.0 84-85 35.645250000000004 37.0 37.0 37.0 37.0 37.0 86-87 35.43725 37.0 37.0 37.0 37.0 37.0 88-89 35.489999999999995 37.0 37.0 37.0 37.0 37.0 90-91 35.4895 37.0 37.0 37.0 37.0 37.0 92-93 35.469750000000005 37.0 37.0 37.0 37.0 37.0 94-95 35.49625 37.0 37.0 37.0 37.0 37.0 96-97 35.459927009072885 37.0 37.0 37.0 37.0 37.0 98-99 35.523354284577465 37.0 37.0 37.0 37.0 37.0 100-101 35.39171687709593 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 0.0 23 3.0 24 6.0 25 5.0 26 8.0 27 28.0 28 27.0 29 48.0 30 63.0 31 89.0 32 115.0 33 157.0 34 212.0 35 449.0 36 2192.0 37 596.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.000000000000004 13.15 17.8 41.05 2 26.3 19.075 32.1 22.525000000000002 3 25.874999999999996 23.025000000000002 24.099999999999998 27.0 4 28.4 27.85 17.299999999999997 26.450000000000003 5 27.775 30.125 21.625 20.474999999999998 6 22.525000000000002 32.824999999999996 21.349999999999998 23.3 7 20.150000000000002 16.35 38.425 25.074999999999996 8 22.35 22.875 26.474999999999998 28.299999999999997 9 21.7 21.625 27.900000000000002 28.775000000000002 10-11 24.9 27.250000000000004 20.7125 27.1375 12-13 22.925 22.5875 26.737499999999997 27.750000000000004 14-15 24.175 24.425 26.0625 25.337500000000002 16-17 25.0625 24.2 24.2875 26.450000000000003 18-19 25.0375 24.6875 24.7 25.575 20-21 23.962500000000002 25.3125 24.6625 26.0625 22-23 24.2375 24.975 24.712500000000002 26.075 24-25 23.25 25.0 25.35 26.400000000000002 26-27 23.0375 25.0625 25.162499999999998 26.737499999999997 28-29 24.775 25.3125 24.099999999999998 25.8125 30-31 24.2 25.900000000000002 24.825 25.074999999999996 32-33 25.124999999999996 24.6875 24.3625 25.825 34-35 25.662499999999998 24.4875 24.0125 25.837500000000002 36-37 24.4875 26.2875 24.4 24.825 38-39 25.2125 25.5125 23.775 25.5 40-41 25.387500000000003 25.4 23.5625 25.650000000000002 42-43 24.4 25.75 24.7 25.15 44-45 24.349999999999998 24.575 25.374999999999996 25.7 46-47 24.85 24.5125 25.0125 25.624999999999996 48-49 24.975 24.875 24.087500000000002 26.0625 50-51 23.7875 25.324999999999996 24.9125 25.974999999999998 52-53 24.825 25.0 24.375 25.8 54-55 25.4625 24.762500000000003 24.7 25.074999999999996 56-57 25.624999999999996 24.3625 24.1125 25.900000000000002 58-59 25.074999999999996 25.2625 24.725 24.9375 60-61 25.337500000000002 24.837500000000002 25.25 24.575 62-63 25.575 24.7875 24.425 25.2125 64-65 25.974999999999998 24.9375 23.4625 25.624999999999996 66-67 24.65 24.8625 24.087500000000002 26.400000000000002 68-69 25.7375 25.362499999999997 23.4875 25.412499999999998 70-71 25.3 24.6125 23.9375 26.150000000000002 72-73 25.275 24.587500000000002 24.675 25.4625 74-75 24.1625 24.6 24.8125 26.424999999999997 76-77 24.4 25.275 24.212500000000002 26.1125 78-79 25.2125 23.849999999999998 24.962500000000002 25.974999999999998 80-81 24.6 24.0625 24.725 26.6125 82-83 25.0375 25.5625 23.8625 25.5375 84-85 24.6125 24.349999999999998 25.6 25.4375 86-87 24.837500000000002 25.924999999999997 23.6375 25.6 88-89 25.25 24.675 24.462500000000002 25.6125 90-91 24.2875 24.8125 24.6 26.3 92-93 25.0 24.337500000000002 24.575 26.087500000000002 94-95 25.9625 24.675 23.974999999999998 25.387500000000003 96-97 25.513013013013015 24.537037037037038 24.5995995995996 25.350350350350347 98-99 25.36461636017755 22.828154724159795 25.770450221940393 26.03677869372226 100-101 26.105563480741793 10.572198446663498 30.274211443968934 33.04802662862577 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 1.0 24 1.5 25 2.0 26 1.0 27 2.5 28 6.5 29 10.5 30 10.5 31 10.5 32 15.5 33 18.5 34 24.5 35 32.5 36 39.5 37 55.5 38 70.0 39 90.0 40 117.0 41 135.5 42 154.5 43 174.5 44 187.0 45 201.5 46 184.5 47 177.0 48 185.5 49 166.5 50 142.5 51 128.0 52 133.5 53 115.0 54 98.0 55 101.5 56 87.0 57 72.0 58 65.0 59 68.0 60 73.5 61 67.0 62 59.0 63 59.0 64 61.0 65 59.5 66 57.0 67 53.0 68 53.0 69 48.5 70 49.5 71 50.0 72 44.0 73 40.5 74 34.0 75 27.0 76 20.5 77 14.5 78 11.0 79 8.5 80 6.0 81 3.0 82 1.5 83 2.0 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 95 2.0 96 4.0 97 17.0 98 69.0 99 285.0 100 937.0 101 2686.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.125 #Duplication Level Percentage of deduplicated Percentage of total 1 93.04697986577182 86.65 2 6.577181208053691 12.25 3 0.3221476510067114 0.8999999999999999 4 0.05369127516778523 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364713 spots for SRR21853446.sra Written 364713 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra Read 364704 spots for SRR21853446.sra Written 364704 spots for SRR21853446.sra SRR ids: ['SRR21853446.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sm6p79n5 SRR21853446.sra spots: 7294089 blocks: [[1, 364704], [364705, 729408], [729409, 1094112], [1094113, 1458816], [1458817, 1823520], [1823521, 2188224], [2188225, 2552928], [2552929, 2917632], [2917633, 3282336], [3282337, 3647040], [3647041, 4011744], [4011745, 4376448], [4376449, 4741152], [4741153, 5105856], [5105857, 5470560], [5470561, 5835264], [5835265, 6199968], [6199969, 6564672], [6564673, 6929376], [6929377, 7294089]] SRR21853446 file size 1961002 SRR21853446 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853446 SRR21853446_1.fastq Input file: SRR21853446_1.fastq trimmed: SRR21853446-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:01:42 2024 >> started Fri Dec 6 15:01:46 2024 >> done (4.318s) 7294089 reads processed; of these: 1 ( 0.00%) short reads filtered out after trimming by size control 7059 ( 0.10%) empty reads filtered out after trimming by size control 7287029 (99.90%) reads available; of these: 274 ( 0.00%) trimmed reads available after processing 7286755 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 2 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 1 0.00% 29 1 0.00% 30 0 0.00% 31 3 0.00% 32 5 0.00% 33 6 0.00% 34 5 0.00% 35 18 0.00% 36 13 0.00% 37 17 0.00% 38 19 0.00% 39 31 0.00% 40 10 0.00% 41 11 0.00% 42 16 0.00% 43 16 0.00% 44 13 0.00% 45 20 0.00% 46 11 0.00% 47 20 0.00% 48 23 0.00% 49 10 0.00% 50 21 0.00% 51 22 0.00% 52 16 0.00% 53 18 0.00% 54 17 0.00% 55 34 0.00% 56 24 0.00% 57 37 0.00% 58 25 0.00% 59 30 0.00% 60 34 0.00% 61 23 0.00% 62 31 0.00% 63 31 0.00% 64 32 0.00% 65 23 0.00% 66 36 0.00% 67 26 0.00% 68 28 0.00% 69 38 0.00% 70 31 0.00% 71 33 0.00% 72 36 0.00% 73 40 0.00% 74 31 0.00% 75 36 0.00% 76 28 0.00% 77 46 0.00% 78 48 0.00% 79 49 0.00% 80 46 0.00% 81 37 0.00% 82 60 0.00% 83 50 0.00% 84 53 0.00% 85 50 0.00% 86 57 0.00% 87 53 0.00% 88 59 0.00% 89 75 0.00% 90 122 0.00% 91 280 0.00% 92 83 0.00% 93 150 0.00% 94 428 0.01% 95 1677 0.02% 96 9820 0.13% 97 34700 0.48% 98 136014 1.87% 99 487262 6.69% 100 1680000 23.05% 101 4934753 67.72% 7287029 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=219.72 fanout-score-rank=13 prefix-density=0.83 prefix-fanout=25.1 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=416.67 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=25.1 sequence=CGCCGCCGCCATC Started job on | Dec 06 15:02:04 Started mapping on | Dec 06 15:02:04 Finished on | Dec 06 15:02:19 Mapping speed, Million of reads per hour | 1748.89 Number of input reads | 7287029 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 6700325 Uniquely mapped reads % | 91.95% Average mapped length | 100.24 Number of splices: Total | 2280251 Number of splices: Annotated (sjdb) | 2161168 Number of splices: GT/AG | 2249304 Number of splices: GC/AG | 25679 Number of splices: AT/AC | 1354 Number of splices: Non-canonical | 3914 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 125259 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 129657 % of reads mapped to too many loci | 1.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.29% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 461445 461445 461445 N_multimapping 125259 125259 125259 N_noFeature 311013 3460117 3463223 N_ambiguous 100115 6079 6652 UnstrandedReadsAssigned:6289197 PositiveStrandReadsAssigned:3234129 NegativeStrandReadsAssigned:3230450 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853446 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853446-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,287,029 reads, 6,464,236 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52973 SRR21853446.ke.tsv 35125 SRR21853446.se.tsv 88098 total ==> SRR21853446.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 43.1194 12.6341 PNS24249 1928 1829 123.722 18.73 PNS24246 1044 945 43.1194 12.6341 PNS24248 1044 945 43.1194 12.6341 PNS24244 1471 1372 35.9198 7.2491 PNS24243 293 194 8 11.4181 KQK14069 1603 1504 4744.27 873.426 KQK14071 474 375 728.944 538.229 ==> SRR21853446.se.tsv <== BRADI_1g14170v3 5900 BRADI_1g53295v3 34 BRADI_1g59795v3 194 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 88 BRADI_1g74790v3 116 BRADI_1g09890v3 0 BRADI_1g77505v3 83 BRADI_1g48960v3 0 SRR21853446 completed mapping pipeline successfully